Last drawing of my artistic fervor today :) Naruto playing a little prank on Sasuke. Set kinda post Shippuden? I forgot the arm thing so um I’m gonna call it an AU where they keep both arms are stupid little high schoolers (bc they’re that age anyways). I love the boys. I will most likely never draw them again bc I hate drawing their hair it is hard. Their bond is deep yes but I love thinking about the shallow stupid parts >:D
15 notes
·
View notes
Modern Zhuzhi Lang goes on a date with Shen Yuan and forgets to take one of his pet snakes out of his pocket before he leaves and early on the date it pokes his head out of ZZL’s clothes and startles the shit out of Shen Yuan, and ZZL is crestfallen because most people don’t like snakes and he’s totally blown this before it even started which is a shame because he likes Shen Yuan so much, and he starts apologizing profusely and explaining why there’s a snake in his shirt and offering to just, like, leave so SY doesn’t have to tell him to go—
but Shen Yuan recovers quickly from the shock of seeing an unexpected Shirt Snake and once he hears that it’s a pet and it’s supposed to be there he’s leaning in and cooing “Hello! What’s your name??” and Zhuzhi Lang has to clamp his mouth shut mid-explanation so he doesn’t say anything embarrassing like “PLEASE MARRY ME”
7 notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 8/7/24)
consider helping me pay to finish my education!
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.)
for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
for additional phobias: i tag with the specific phobia (trypophobia, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
according to democracy, yes
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.
2K notes
·
View notes
Father's Day (Toji xFem!Reader)
Summary: It's father's day and you forgot to get Toji his gift.
Tags: dilf Toji, babysitter reader, secret relationship, age gap (reader early 20s, Toji early 30s), daddy kink, breeding kink, lactation kink, spanking, mating press, mention of doggy style, cumplay, blowjob, gagging, deep throating, creampie, heavy usage of pet names (baby, sweetheart, angel, slut, etc), soft!dom Toji being a condescending piece of shit, Megumi being an absolute angel, hope i'm not forgetting anything, pls don't murder me.
Word Count: 4.3k divided between fluff and smut.
“That’s it, Megs! You did so well today!” You smiled, giving the boy’s spikes a little affectionate ruffle. “I’m sure your dad will be so happy to see how hard you worked on his gift.”
“Liar.” Megumi put the glue stick face-down against the table. “It’s not as good as the ones you make, Y/N.”
“That’s because I’ve put years into it, you know? When you get older, I’m sure you’ll be the one teaching me.” You promised, holding his drawing toward the light.
The pasta on the paper depicted the face of a silly-looking man; chopped lasagna for his dark hair, spinach-flavored shells for his green eyes, penne for the jagged scar on his fusilli lips, and broken spaghetti to help frame the sharp edges of his chiseled jaw. The inscription “World’s Best Dad” was written at the bottom corner by yours truly, Megumi being too young to know the proper spelling.
Admittedly, it looked nothing like Toji, but even if you got the man himself to pose for your DIY project, you doubted you’d get any closer to capturing his charms. At least it resembled a human being, and that was the core difference between based on and loosely inspired by.
Megumi jumped from his stool and waved his hands before you, his fingers stuck together as if he were a duckling. You chuckled, meaning to settle the drawing on the table so you could escort him to the bathroom when you heard keys twisting in the door lock.
“Quick, go wash your hands and I’ll take care of your daddy, okay?”
Megumi nodded, dashing upstairs in seconds while you browsed the kitchen for a hiding spot, panicking as a couple of macaroni were chipped off. You grabbed the glue and hastily pieced them back in place, but it was too late. A pair of strong arms snaked around your waist, pressing you flush against an unmovable wall of muscle.
“T-Toji!”
Your yelp was silenced by his lips, hungry from having to spend an entire day filling forms and sorting mail at a work he despised with every inch of his being— some of those very inches poking against your ass as his hips bucked into yours almost possessively. Coming home to the cute little babysitter he’d made his girlfriend was everything he needed to recharge his batteries.
“Meg-gu…mi will see us,” you panted in between heated kisses, trying and mostly failing to defend your body from his greedy palms diving into your shorts.
He felt your skin flare up, so sensitive for him even after countless days of the same ritual. His index pried beneath your panties —the lacy ones he’d gotten you for your birthday— to meet with your pussy’s puffy lips, gliding across the gathering slick as if he meant to say “Hello”. His thumb rubbed a rough circle over your clit, giving the nub a few teasing flicks that were enough for you to arch your back against his chest, a hushed moan bitten into his neck. He chuckled to himself as he retracted his fingers and gingerly licked them one by one.
“Missed ya so much, angel,” Toji coed in a low voice. “Y’always taste sweeter when I’m not around, know that?”
You giggled against his mouth, his tongue eager to share your essence. “How would you know that if you’re away?”
“I just do,” he smiled, putting an end to the unforeseen display of affection with a gentle kiss on your cheek. “Where’s Megumi?” he searched through the space.
You moved in accordance with his eyes, swaying left and right to cover as much of the table as possible. “He’s in the bathroom. Washing his hands for dinner.”
Toji hummed, thumbing his tie loose around his neck. He could hate his job all he wanted, but nothing compared to the sight of seeing Fushiguro Toji in office attire. His sleeves were rolled around his elbows, toned biceps popping under the tight fabric of his white button-up. He paired straight black pants with a plain black belt— nothing impressive on its own until he bent over the lower cabinets to grab himself a glass, and you stole a quick peek at his rare and the impossible way the fabric hugged his—
In any case, you were convinced Toji had somehow missed Megumi’s drawing, his primary interest to fill and then refill his glass with fresh tap water. You seized the chance to transfer his gift to a safer location, though before you could take another step, he grabbed your wrist and forced your hand into play.
He studied his own face harder than your art professors evaluated your semester’s projects, his nose scrunching up at the finer details of his farfalle ears. “That why I pay your tuition for?” He snorted at you snatching the art piece from his hands.
“Better act excited when Megs comes here,” you straightened the creased edges and stored it in an empty drawer. “He’s already doubting his talent.”
“His what?”
He assured you he was just joking when you shot him a mean glare, your voice strict as you ushered him to follow his son’s example while you hurriedly collected the art supplies and replaced them with cutlery.
In no time, the three of you were seated around the table— Megumi on your lap while you cut his pork into bite-sized pieces, and Toji on the other side, wishing that their positions would switch. You swore this man got ten times handsier after you got together, seeking excuses to touch you even in front of his own kid. Megumi had just turned four but at this rate, it wouldn’t take long for such a bright kid to put two and two together.
The decision to keep it a secret was mutual (read: one vote for, and another against). There was no reason to disturb Megumi’s routine or throw him off balance. You’d grown fond of the little guy, and with his dad being away 2/3 of the day, you were each other’s only company. No matter how well things with Toji were going, if you suddenly fell apart, the one to hurt the most would be Megumi and you didn’t want that weight on your conscience. Being his number 1 nanny was good enough.
A certain type of silence familiar to the Fushiguro household shrouded dinnertime, with Toji trying to engage Megumi in small talk, and Megumi constantly glancing over his shoulder at you as if you were his designated spokesperson. “Yes, Megumi had a lot of fun today.” “Yes, Megumi ate all of his veggies at lunch, even the icky red peppers.” “No, Megumi knows nothing about the neighbor’s broken window.” The boy was relieved with every blatant lie you told his father, his knees gleefully flapping against your own.
By the time their plates were emptied, your food had gone completely cold, the oil in the curry sauce encasing the cutlet in a greasy coat. You gobbled it up as it was and stacked the plates into a pile that you placed in the sink, signaling for Megumi to come over. You handed him his drawing, encouraged him with two thumbs up, and sent him off to his “unsuspecting” father.
Your lips stretched into a smile as Megumi presented his drawing, mumbling a strained “Happy Father’s Day” under his breath as if he had a gun pointed at his head. So stubborn, though you could definitely see where he took it from, Toji’s reply being an equally stern “Thanks, kiddo”. You rolled your eyes and rushed to the scene, praising a blushing Megumi over his artwork and exaggerating his achievements to Toji who just wouldn’t take a hint. How these two managed to survive by themselves, was a wonder on its own.
Eventually, Toji gave his son a more fatherly rub on the back and hoisted the boy over his shoulders to lead him to his bedroom. Megumi squeaked, planting his tiny fingers into Toji’s hair, and clasped his legs tight around his neck. You remembered a meek confession from a few nights ago, muffled out by the covers and the plush toy over his mouth, as he let you in on how fun mounting his father was, feeling like a real mecha pilot atop his broad shoulders. He could be such a sweet kid when he wanted to. If only he was more vocal with Toji, too.
You watched the two disappear up the stairs and picked the drawing from the table, pinning it in the middle of the fridge for the world to see. You rinsed the pots with hot water and shoved them into the dishwater rack, figuring it’d be best to get as much work done as you could in Toji’s absence.
“This is the last one,” you said once the sound of feet thudding against the stairs became apparent.
You made quick work of the glass, rotating the sponge inside out, while the man leaned against the door frame without saying a thing, content with being a bystander to your impromptu clean-up session. Many a woman passed Toji’s threshold, some older, others younger, and yet you were the first to worry about the state of his bundle-bought glasses. He couldn’t pinpoint what made such a mundane sight endearing to behold, but maybe it was because of the very commonness and familiarity behind it that he hesitated to interrupt.
“Meg’s asleep?” You caught his reflection nodding through the glass, your following questions answered the same way.
“You got him in his pj’s? The blue, not the green ones, right? Got him to brush his teeth? Turned on the night light for him? Gave him his—”
A sigh echoed as he stepped into the space with his hands lost in his pockets. “How d’ya do that?”
“Do what?”
“The kid, the house,” he paused to measure his words, “me. How do you handle all that?”
Your lips pursed into an affectionate simper as you wiped your hands against the towel, looping it around the cabinet’s handle. You turned to face him and lifted your forefinger playfully. “One, the kid happens to have a very attractive father. Two, the house owner himself is sexy as hell, and you? I guess you are pretty easy on the eye.”
“Am I now?” His raspy tone was set on confirming every last impression you had of him, his tongue licking his slanted scar into a smile that was all but coy. “Which one you prefer then? The father, the house owner, or me?”
“Hmm, if I had to pick just one then,” your cheeks burned prior to your admission. “The version of you I get to call daddy.”
Satisfied with your answer, Toji pinched your chin between two fingers, admiring how eagerly your mouth popped open as the pad of his thumb swiped against your bottom lip, pushing slightly in. “Smart girl,” he cooed, feeling out the flat surface of your tongue, hot, warm, and oh-so-perfect when pressed against his cock.
“So what did you get me?” he smeared saliva over your lips, making them all nice and glossy. You stood still, faded eyes caught in the motion of his other palm shamelessly cupping your ass, his question barely registering.
“W-what?”
“Don’t ‘what’ me, you know exactly what I’m talkin’ about.” His fingers dug into the fat of your cheek, a warning in his voice. “Where’s my gift?”
“S-sorry, Toji. Didn’t think I had to—” A light smack cut your sentence in half, the recoil forcing you to drop onto his chest.
“Mm? What is it that y’are sorry for, princess?” He mocked, squeezing your bum against the growing bulge in his pants. Your cunt fluttered in response, clit whining at the little friction he provided. You wanted more. Wanted to feel all of him. The weight of his cock dragging between your folds and soaking in your juices before being plunged inside, every ridge and every line you’d memorized finding their rightful place in a hole that was meant for him.
You bit your lip in brewing anticipation, mustering the courage to look into his hooded green eyes that shared the same lust yours did. “Sorry I didn’t get you a gift, Toji. Should’ve known better.”
His smile softened, head cocking to the side. “Don’t sweat it. My pretty baby knows how to make it up to me, doesn’t she?”
You nodded, standing on your tiptoes to whisper in his ear, “How about I gave you a second reason to celebrate today?”
As soon as the words came out of your mouth, you were being lifted into the air, both of Toji’s hands finding purchase in your plushy thighs, while his lips begged to hush whatever mention of Megumi before it was even conceived. He kicked his bedroom door open and shut it with his heel, tossing you against the covers of his made-up bed. (“Why bother if they gonna crinkle anyway?”)
He lost his shirt almost as quickly as he lost his tie, flinging both fabrics over his shoulder. No matter how many times you got to lay eyes on his naked body, you always managed to spot a new scar on his chest from his former lifestyle, the danger it packed serving as an additive to the wanton fantasy of having your guts rearranged by your boss.
Your legs spread quite the sight for him as he tugged off your shorts, your panties sporting a sizable wet spot right at the center. He forced the drenched fabric into your slit, drawing it taut around your hip bone. You moaned softly, mindful of the kid across the hall, while your hips rocked forward, chasing after the finger he pulled away.
“Taking care of my kid ain’t enough for you? Wanna be a real mommy now?” Toji sneered, yanking the belt off his pants.
“I want us to be a real family,” you confessed, bowing to help him with the rest of his clothes. You slid his pants down his briefs and let them drop to his knees, your cheek nuzzling to his clothed cock. You licked a strip over the fabric, thrilled to hear a breath hitch in Toji’s throat. “Let’s give Megs a sibling. One that is half me, and” you paused, wrapping your lips around the imprint of his balls, “half you.”
His cock sprung free the moment you lowered his underwear, the way his fat tip glistened with precum enough to make your mouth water. You wrapped a fist around his length, fingers barely closing around his hefty base, and gave him a languid, thorough pump. He watched intently, keeping all sounds to himself until your lips parted to fit his cock head, stretching around his thick girth.
“Fuck, baby—” Toji hissed, helping your hair out of the way while your throat molded back into his shape. You were taught how to take as much of him in as possible, yet no matter how diligent you were in your practice, you could never fit him whole. You bobbed your head up and down, hand stroking the parts you couldn’t swallow and tongue pitching in the action with sparse kitten licks along his shaft.
His fingers firmly gripped onto your hair, forcing your head to pick up speed as they traveled from your scalp to the back of your head. Your gag reflex protested with each thrust, hot tears gradually pooling in your eyes while you struggled to keep them open.
“Look so fucking good chocking on my dick.” His voice oozed sweetness that matched his stare, a look of utter adoration fluttering behind his pretty eyelashes.
If he thought you were the one to look good, then he should’ve seen himself; messy obsidian strands casting shadows over his darkened eyes, his pink lips agape more often than closed with all the unregulated profanities and praise that spilled out of them, turning up in volume the closer he got to his climax.
You felt him twitch in your mouth, the salty tang drooling down your jaw along with your saliva, though just when you thought he was about to cum, he pulled out, the string of fluids following after him. “Don’t want any of that going to waste, do we?” Toji smirked, pumping his length once or twice before letting go altogether.
He hunched over your body, his knees making the bed dip lower as his lips sought yours, jaw too slack to properly reciprocate. Rough palms slid below your top and ran over your sides, his fingers unhooking your bra with unmatched expertise. He broke the kiss to let you remove your shirt, his hands quick to wrap around your tits and fondle their way toward your nipples. He pinched at them, rolling the peaks between his thumbs until they stiffened.
“Can’t wait for them to get all round and full,” Toji mumbled as he lowered his head to suck a nipple into his mouth, suckling so hard that he just might draw milk. He wet it with his tongue, and then turned to the other, repeating the same motion. “Gonna get me addicted if the taste’s half as sweet as your pussy.”
Your fingers clenched into fists around the sheets, the sheer imagery of Toji feasting on your breasts enough to make your legs go weak. He was keen on sharing his fantasies with you, down to every last insignificant detail, but not as keen as he was on fulfilling every single one of them, and this one, was just a matter of time.
“T-Toji,” you said in a breathy voice.
A sexy smirk plastered on his scarred lips as he detached from your nipple with a soft pop. He left your call unanswered, instead spreading your legs further apart and settling in between. You saw him stroke his cock, and soon you felt the leaking head tap on your clothed clit. Only then did he bother to look up, taking stock of the little whines and pretty moans you selfishly withheld.
He couldn’t wait for his next leave to take you someplace nice and quiet, where the sounds of you crying his name at full volume would come in abundance.
“P-please,” you begged, fidgeting a lot more than before.
“Please what?” he played dumb, rubbing his hard cock along your entrance. “Use your words, sweetheart.
“Please f-fuck,” your voice cracked, too frail to handle his games. “Please, fuck me.”
“Aren’t ya forgetting something?” his thin eyebrow questioned.
“Please fuck me, daddy.”
Toji smiled slyly to himself, obliging enough to peel the panties away from your twitching cunt. “Don’t want a warm-up first? My girl big enough to take me without any prep?” he asked in a condescending tone, matching every beat of his voice with another slap against your clit. “Or is she that eager to be a mommy? That’s it, right?” he chuckled, your moan not going unregistered.
“You’ve gotten so greedy, Y/N,” he said after a series of little tsks. “Bet you also gonna ask to be my wife soon, huh?”
The air was knocked out of your lungs for a brief, albeit painful second as Toji aligned with your entrance and rammed his cock halfway in, his overwhelming size felt first as a sting in your walls and later as a tremor across your entire body. Even with how wet you were, it still hurt a lot more than your horny self thought it would— though it wouldn’t take long for the pain to melt into pleasure.
You didn’t realize you’d screamed until he hushed you, bending forward to press a sweet peck against your lips. “I’ll take that as a yes,” he gave your thigh a reassuring squeeze and gathered your wobbly knees onto his brawny shoulders, refraining to move until you stopped wincing and contorting. “Stay relaxed for me, okay?”
You shook your head and pulled him into a tight embrace, loving the contrast of his hard pecs against your squishy breasts. “Want you close, Toji. Please.”
And how could he possibly refuse when his baby begged him so well?
Your nails began raking at his back as he sunk himself deeper and deeper, the position he’d bent you into making it seem as if there were no limits to how deep his cock could reach before it was buried to the hilt. He stretched you so good, stuffing your pussy full of ecstasy and your mind full of dick as he started to thrust at a steady pace, never deviating from sealing the whimpers in your mouth with sloppy kisses.
“Doing such a good job, angel. Must really want that baby, hah— can feel ya really open up for me.” A calloused hand slid between your bodies and pressed against the tiny bulge in your stomach, appearing and disappearing with each slam of his hips. “Feel that? That’s how deep you’ve taken daddy.”
He dragged his cock out and pounded it back in, his heavy balls slapping hard against your jiggly ass. His hand lowered over your clit, flicking the nub in sync with his frantic thrusts until the coiling tension in your guts snapped, a shuddering orgasm washing over him as much as it washed over you.
“Love you s-so much, Toji,” your fingers slipped onto his neck, gradually hiking up to cup his cheek.
Specks of light glimmered in his eyes as they held your loving stare, the scarred corner of his lip curling into a cocky smirk as if to defy him. “Yeah? Is it me that you love or my cock? Came into my house so I can fuck you g-good, ah?” he stuttered along with his hips. “All that money I gave ya to watch my kid goin’ to that tight-ass pussy?”
“Answer my question, slut,” he insisted.
Your brain was going blank on answers, your eyes rolling to the back of your head as his cock found all the right places, hitting every single spot that led into your fertile womb until you were back to writhing below him. “B-both, Toji, fuck love your cock so much ‘s fucking me so well.”
A hand moved over your dampened forehead, swiping your disheveled hair so he could plant a kiss. “Love you too, sweets.”
You felt yourself drowning in love as the squelching grew louder, the four-bedroom walls too thin to contain the sounds of hips snapping against hips and of his husky groans as he closed in on his high a second time. “Gonna fill ya up real good. Gonna—fuck, give my pretty baby all my babies,” Toji grunted, and you repeatedly nodded, cute little sobs severing the chants of his name.
Sharp teeth dug into your neck as Toji buried himself in the crook of your shoulder, his sultry moans reverberating against your skin until they hit their crescendo when his cock began to throb, painting your walls with thick ropes of his creamy load. He slowed down, luscious thrusts shoving his cum further in while you held him close, snaring your legs around his torso.
When he finally lifted his head, you’d both regained a sliver of composure, your pants falling back into rhythm.
“You’ll be such a good mama,” he murmured, his voice silky smooth over the shrewd ringing in your ears.
“Think so?” Your lips stretched into a faint smile that he was quick to kiss.
“You already are the better parent. Kid likes you most. Bust my balls when you have your tests and needa study.”
You chuckled, tracing the outline of his scar with your thumb. “Why do I get the feeling it’s the other way around, hmm?”
A tsk twisted his lips into a scoff as he bit onto your finger. “Ouch! What was that f—”
Your voice faltered as he spun you around; face shoved into the pillows and back forced into an arch while Toji positioned himself behind your ass and dragged his cock between your swollen red folds.
“Don’t tell me you thought we were done here.”
The next morning found all three of you at the starting point of last night’s exploits, Toji sipping on a cup of black coffee and scrolling on his phone, while Megumi quietly sat beside him on the kitchen table, awaiting his breakfast to be served. Your body felt sore all over while you grilled his salmon, sand in the corners of your eyes. Normally, you’d be trying to keep everyone entertained with idle chit-chat, but with how often you yawned, getting a word out demanded serious effort— effort you weren’t prepared to put in.
“Say, Megumi.” Toji took the reins, setting his phone down. “How would you feel about having a new mommy?”
The spatula almost fell into the pan, your objection stifled by Megumi’s voice. “I don’t mind.”
“You don’t?” Toji cocked his head curiously, propping his chin onto his palm. “Then ya wouldn’t mind if it was someone you knew?”
“Mister Fushiguro, could you please help me with the fish a bit—” you pleaded through gritted teeth, only to be dismissed with a swift gesture as if you were a housefly.
“I don’t mind having a new mommy, but I don’t want to be a brother,” he declared, stomping his fork against the wood for emphasis. “Never!”
You glanced over your shoulder, first at Toji and then at Megumi, before serving the fish on a plate and kneeling in front of the child. “Why is that, Megs? Don’t you wanna be a big brother to a little sister or a little brother?”
His eyes stubbornly refused to meet with yours, all the while they shot daggers at his father. “Don’t want one if it hurts to make.”
You chuckled, tapping at his knee gently. “What are you talking about?”
“I heard you cry last night,” Megumi admitted. “Dad hurt you, didn’t he?”
“That’s not what—”
Toji smirked as he spread his legs apart, preparing himself for the show. “Kinda late for that, buddy. And don’t worry about Y/N. Adults can cry from pleasure, too—”
“Toji!”
And thus, your little house of cards fell apart.
2K notes
·
View notes
I just had a thought, after seeing a meme. Now I wonder.... which would you most willingly suffer through? xD
After writing up the poll, I mayyyyy have a choice, even if it's not my overall favourite character. So, who is yours? Feel free to interpret as you like 😉
(And yes, you can probably see a theme on my tumblr on which characters I tend to use... 😅😅)
Post-poll: The results omg. Okay, I did kind of anticipate it. Since I had similar thoughts, but it's nice to see every other character get some love despite their "characteristics" xD
Here are my thoughts when I asked myself the same (in the undercut):
Doffy: Sorry, you might be my favourite villain but there's such a thing as personal space and no, that bit of personal space does not have your name on it!
Aokiji: You are one of my absolute faves, but I hate the cold. So I'll have to pass thanks! (I only realised after posting the poll that I was just thinking vaguely that it was 5°C but it could be interpreted as 5°F. But the poll is so limited in character spaces that I left out the C/F and left it for interpretation. Both are cold anyway xD)
Rosi: You are my second option, if I can bear to have my things broken that is. Maybe if I puppy proof everything, it might be okay, get super protective bubble wrap on my laptop and delicate things, it'll be fine!
Kid: As a fave, you're great, but I need sleep, and you also don't take no for an answer. So, no thanks. I mean if you took yes as an answer, sure, maybe, but no means no!
Ace: You're my all time fave, but even my tolerance for heat has its limits. I don't think we can afford all the icebags and you might break the cooling.
Killer: He would be my first pick, because he literally has the least problematic traits. Though, if he only cooks spaghetti and as someone who doesn't like wasting food, I might have a problem with a full spaghetti diet. BUT this is tolerable, I'll just put him on heavy exercise regime or something, so he eats as much as he cooks. Then I can cook what I like. *Looks at helmet* Fine, don't show, keep your face to yourself.
Drake: I would be fine with his pets. I like lizards and tortoises. But snakes? No thanks. And the space bit... I do like my personal space... don't care if his side is stacked to the ceiling though.
Well that was fun, thanks for the votes xD the reblog tags were hilarious to read.
117 notes
·
View notes
The list of regrets I totally have and am not just writing because Charlie is making me, Vagina Vaggie is glaring at me, and I want the free rent:
By Angel Dust, 3 time X-X-X award winner.
(Warning, there is some victim blaming in this. The abuse Angel faces from Val is not his fault, but given that I’m writing this from his perspective I figured it would be something he’d add.)
1. Writing this list
2. Verbally complaining about writing this list cause now Vagina wants to stab me.
3. Only taking half my usual hit before starting today.
4. Complaining about not being high enough.
5. Not hiding my drugs better
6. Not having more stashes of drugs
7. Calling TV superior to radio.
8. Not killing that snake before he had a chance to go to the hotel.
9. Not “trying hard enough” at this shitty hotel.
10. Being too close to roof so the CRAZY BITCH COULD THROW ME OFF OF IT.
11. Walking up the stairs with Pentious only to have to go IMMEDIATELY BACK DOWN.
12. Signing my deal with fucking Valentino. Seriously I’m a fucking idiot.
13. Even suggesting the idea that Charlie should come to the studio. She’s just going to get hurt.
14. Mouthing off to Val.
15. Not getting Charlie out of the hotel sooner
16. Being such a pathetic, dick sucking ho who isn’t good at anything beyond sex.
17. Not being able to take all of this.
18. Not acting well enough cause some this bitchass cat is seeing through me.
19. Ever offering that bitchass cat my services.
20. Pushing Husk’s boundaries
21. Not being my true self.
22. Acting for so long I don’t even really know who my true self is
23. Being a dick to Charlie
24. Being a dick to Husk
25. Being a dick to everyone
26. Putting my dick in a vacuum cleaner.
27. Calling Smiles a creepy dommy daddy.
28. Letting Niffty know about some of my more kinky films. She’s getting ideas…
29. Trying to play poker with Husk (and not even strip poker!)
30. Testing if my venom works on myself (it doesn’t and now I have pink bite marks)
31. Leaving what I used to clean my bites out because somehow Alastor found them and is now TEMPORARILY PARALYZED AND I DONT WANT HIM TO KILL ME WHEN HE CAN MOVE AGAIN.
32. Not answering Val’s texts.
33. Wearing boots. Seriously these things hurt sometimes.
34. Having ugly feet so I can’t NOT wear boots.
35. Tracking mud into the hotel
36. Mentioning sex around the Egg Bois because now I have to explain what it is.
37. Describing sex as something their boss “has never had,” it got back to Pentious and I’m scared.
38. Mentioning “Vox” anywhere in Alastor’s vicinity.
39. Agreeing to play Monopoly with Niffty. In general Monopoly sucks but Niffty likes to get knives involved?!?!
40. Getting addicted to drugs.
41. Getting caught in that alleyway by my BITCHASS brother.
42. Not trying harder for Molly.
43. Not saying goodbye.
44. Fucking overdosing.
45. Doing literally fucking nothing with my life and nothing with my death.
46. Taking the easy was out and doing whatever pops told me to
47. Yelling “FUCK” loudly in church that one time
48. Not teaching these people at the hotel how to FUCKING MAKE SPAGHETTI RIGHT?!
49. Getting high with Cherri.
50. Telling Val to “fuck off”
51. Flirting with that one cannibal guy because now they all seem to want to EAT ME (and not in the sexy way)
52. Leaving those pot brownies out. High cannibals, Egg Boiz, and Nifftys are terrifying.
53. Letting myself be named “Angel” because this makes shit too damn confusing plus I think Niffty wants to KILL ME?!
54. Not spending more time with these losers
55. Not opening myself up to Husk sooner.
56. Being too much of a coward to tell him how I feel.
57. Mentioning Pent has two dicks to Cherri cause she won’t stop asking about it.
58. Not doing enough to save Pentious.
59. Not telling him how much he means to me.
60. Trying to lift way more than I should have. Apparently six arms doesn’t mean I’m super strong.
61. Calling Niss a short motherfucker who nobody likes. I’m sorry, I’ll be better (and call him something even worse next time.)
62. Still being too much of a coward to tell Husk how I feel.
63. Flirting with Husk in Italian when he UNDERSTOOD ME THIS WHOLE DAMN TIME?!
64. Getting a room on the same side of the building as Alastor’s because he keeps laughing at 3 in the morning???
65. Kissing Husk in public. Val is mad.
66. Trying to even have a boyfriend with Val around. It’s stupid.
67. Calling yourself stupid for wanting to have a boyfriend.
68. Giving my boyfriend access to this list.
69. No regrets. Only 69. :D (Jesus Christ you’re a child.)
232 notes
·
View notes
My Cute, Baby Giraffe
A/N : Hello! Here's a little fic for u bc Niki is adorable :>
Pairing : Bf!Niki X Fem!Reader
Warnings : Fluff, Niki is a little upsetti spaghetti, snuggling and cuddling, kissing(little bit of a make out?), tickle fight, name calling
Word count : 667 words
Masterlist
"Hi baby" you greet him, your smile dropping when you see his frown. He offers you a sad smile. Partly because he was happy to finally see you but at the same time he still felt like crap after practice.
He doesn't say anything but makes his way to your bed where you close your laptop and sit up to welcome him better. He lays on his stomach with his hands wrapped around your waist and his face somewhere on your lap.
You coo at him and gently caress his hair, making him hum in appreciation. "Bad day today?" you ask softly when you see his eyes close. He just nods and snuggles deeper into your warm body.
"Do you wanna talk about it?" you offer, tilting your head to look down at him. He remains silent but doesn't shake his head neither.
"It's nothing" he begins, not raising his head from your lap. "Practise was just overly tiring today" he explains, sighing. "And I w-wasn't really acing the moves" he sniffles, closing his eyes once again to block his tears.
He hides his face into your thighs and you smile sadly at his cuteness. "It okay Riki, you'll get them next time for sure" you don't stop caressing his hair "Maybe you just need to rest a little"
You can feel him nod as he hugs your waist tighter. "And I Missed you too" he continues, making your heart ache in your chest. He was such a sweet boy.
"Aw, I missed you too Riki" you unwrap his arms from your waist and bring him up to your chest so he can hug you. His arms now wrap around your torso and his head rests on your chest. "Missed you a lot" he mumbles.
He suddenly pulls away and looks at you for a hot second, almost as if he's wondering whether he's dreaming or not. He leans in a little and you lean into him halfway, connecting you lips.
You can feel him smile into the kiss, finally happy that you were so close to him. He climbs into your lap as he struggles to kiss you due to the height difference. "mph, you're so short" he say between kisses.
He captures your lips again but you pull back "And you're like a giraffe" you reply back breathlessly, pulling him back into your kissing session. He giggles a little and you giggle too "My cute, baby giraffe" you add once you pull away, leaning back in to boop his nose with your own. With your foreheads touching, you stare into each others eyes and wonder how both of your got so lucky.
It's not long before his cheeky hands snake around your sides and start wiggling like crazy, tickling the living day lights out of you. You start laughing non-stop, breathlessly begging him to stop as you try to grab his arms.
Instead, he grabs your arms, with his left hand, binding your wrists above your head. You laughter subsides as you find yourself looking at him again. He looks at your helpless figure and smirks. Heck, he can hold you down with just one hand.
He leans down again, his lips barely brushing yours, just to tease you before chuckling and actually pressing his lips to yours. His hands let go of yours to be able to wrap themselves around you again, and so do yours.
Ugh how you can't get enough of each other. You try to pull away but he places one hand at the back of your head, pulling you closer into his lips. He giggles at your heavy breathing when he finally pulls away.
Your head falls back into your pillows due to how lightheaded you were feeling. He falls into bed with you too, snuggling back up to your chest and kissing your cheek this time.
"You're so cute y/n" he adores, smiling contently when you start to brush his hair again with your fingers.
"I love you"
Hi again :) I hope you liked this post, inbox open, but only for short requests! Have a good day/night and remember that ily <3333
If you enjoyed reading this post you can help support my blog by tipping me here! Anything is highly appreciated :)
524 notes
·
View notes
Desire
Synopsis: Taehyung is your step brother and for the past month he’s had a growing desire for you he cannot ignore anymore.
Warnings: Public (kind of) sexual acts, fingering, praising and degrading, Pov changes, Mentions of masturbation, spanking
Pairings: StepBrother!Taehyung x Fem!Reader
A/n: Sorry for the wait guys, been busy and had some writers block. Don’t be shy to send requests!!
^^^^^^^^
Taehyung’s POV:
I let a heavy sigh leave my lips as I made my way up the stairs. I had just come home from my friends house and the aroma of my Step Mom in the kitchen making dinner lingered through out the house. After making it up the stairs I walked down the hall to my room, not before peeking into my step sisters room to see what she was up to.
Her door was cracked as I peeked in. She was in her black spaghetti strapped top with some baggy pj shorts. My eyes wandered and I couldn’t help but noticed how perfect her breasts sat in view for me. I couldn’t help but admire a little longer as she sat at her desk looking at her book.
I forced myself to look away and continue my walk down the hall to my room. I felt the tightening begin in my pants and I mentally cursed myself. I don’t know how much longer I could be around my own step sister without fucking her right then and there.
I shut my door closed making sure to lock it. I quickly lied back onto my bed, pulling my shorts down enough to watch my hardening dick pop out. My tip was soaked with pre-cum and it was slightly embarrassing that just the sight of her could get me like this.
Wrapping my hands around the base of my dick, I started pumping making sure to rub my tip. This was becoming a routine for me and I needed more of her. More than just a metal image of her.
^^^^^^^^
Y/n’s POV:
My book slammed closed the second I heard my mom’s voice from downstairs call mine and my brothers name. I pulled the glasses from my face and quickly made my way down the stairs. I heard Taehyung behind me but chose to ignore him and made my way into the kitchen to help Mom plate food.
While setting the plates of food down onto the dinner table, I couldn’t help but noticed how Taehyungs eyes followed my movements. How his eyes traced up and down my body, like it would be the last time he saw me. He’s been doing this for a while and I don’t really understand, but I chose to distance myself if maybe I’m making him uncomfortable.
Our parents have only been married for six months so it would be understandable if he felt uncomfortable around me now that we live together. But I’d still appreciate an explanation over the unbearable stares.
I thanked my Mom as I sat down next to Taehyung, across from our parents. Our parents made conversation asking how our days were and how dinner was but started to focus on their on talk, leaving me and Taehyung to find our own conversation or to like usual, eat quietly.
While taking a bite, i felt a grasp on my bare thigh. I pull the spoon from my mouth and look over at Taehyung who had his hand placed right on my thigh. He kept his gaze on me which I could now tell was something very different compared to my initial thought. Turned on. Taehyung, your Step-Brother, was turned on by you.
It was rather evident as you could feel his hand inching up your leg before stopping on the hem of your shorts. You looked at him with widened eyes as your parents were directly in front of you two, and this was very wrong. Taehyung was your step brother, technically there is no REAL problem except for the fact your parents are married. But there is no relation between the two of you.
You both knowing this, knew you are attracted to each other. Unbeknownst to you, Taehyung knew you were attracted to him. He’d hear you moan his name ever so quietly when he’d get home late and walk past your room. So this just solidified the attraction between the two of you.
You felt his hand snake under your shorts and underwear, finding your clit quickly. You bit down on the spoon to hide the moan ready to escape your lips. He chuckled a little and continued to eat his meal like his fingers weren’t against your throbbing clit. Needing more than to just be touched by his fingers.
The cough that left your mouth caught the attention of your parents but that did not stop Taehyung. His long fingers ending up pumping into your pussy slowly, but the curl of his fingers inside you sent shock waves through your body. “Sweetie! Are you ok??” Your mother asked hurriedly as she looked at you choke on a cough, struggling to keep yourself together.
Taehyung analyzed your face, his fingers not stopping once. “I-I’m ok! Just inhaled some rice.” You tried to muster a smile and ended up looking away at the plate in front of you. Your mother stared a little longer before looking back at your Step-Father who had already moved his attention back to your mom.
“I’m done.” You said quickly, pulling Tae’s hand out of you and stood up, putting your plate in the sink and walking up the stairs. You heard Tae excuse you and him and say he heard you throwing up earlier and quickly walked to you.
“What a good brother. I’m glad they’re getting along.” You heard your mother tell your step dad and you mentally cursed yourself. What a good brother my ass.
You made it into your room, but not quick enough as your door was pushed open and shut immediately. Followed by Taehyung pushing you against it and locking it. “Aw baby, I wasn’t done.”
“I definitely was.” You said and tried to move but Tae was quick to push you back against the door and pull your shorts down with your underwear. “Tae…” You spoke and looked up at him.
“That’s what I thought.” He said and put his fingers back over your clit. “Want your step brothers fingers in this pussy don’t you.” It was so vulgar yet you couldn’t help but feel your clit throb as his words. Your pussy wet for HIM.
He rubbed his fingers up and down and looked down at you. His other hand cupping your face. “A whore for your brothers fingers huh?” Your mouth went agape when three of his fingers were shoved into you. “Taehyung it hurts-” You were cut off by the immediate thrusting of his fingers.
Your walls clenched around him and he kept your face cupped in his hand. “Mm fuck stretch me so good.” You moaned, looking at him watching his own fingers go in and out of your soaked core. “So fucking wet for me.” He grunted and moved faster, feeling you clenching. “Gonna cum already baby?” You nodded vigorously and could almost whine at the emptiness you felt as his fingers left you.
“Turn around, arch and spread your legs.” You looked at him a little shocked and he arched a brow and spoke up again, “that wasn’t a question, be a good slut for me.” You kicked your shorts off your ankles and did as you were told. Pressing your face against your bedroom door and arching your back for him.
You heard him moan behind you at the sight. “Such a pretty fucking pussy.” You clenched around nothing. His words turning you on so much you needed to cum or you were gonna cry.
“Tae…please, wanna cum.” There was shuffling behind you before you felt two hands on your ass, spreading your cheeks for him. Not too long after you felt his tongue swipe along your slit.
“Mm fuck yes please.” You moaned quietly, remembering your against the door. “Taste so fucking sweet.” You heard him mutter against your pussy dip his tongue inside of you.
Your eyes rolled as you felt his tongue thrusting in and out of your swollen pussy. His other hand reaching up between your legs to rub your clit. You felt your knees buckle as you bit your lip. Your moans muffled as he used his other hand to land a hard slap to your ass. “Wanna hear you slut.” He started to suck aggressively on your clit and you yelped at the feeling.
“F-fuck Tae don’t stop.” Your body pushed harder into the door and your back arched harder as you felt Tae’s hands spreading your cheeks and slapping them as he continued sucking on your clit. Using his tongue to flick your clit every now and then.
“G-gonna cum, fuck.” You barely got out before you felt your legs start to shake at the violent orgasm that ran through your body. Taehyung moaned against your clit and cupped his mouth on your pussy. Not wanting to miss a bit of you.
“Such a good girl for me.” He said as he stood up and helped you stand. He used his thumb to wipe his lip and looked down at you. “Next time you wanna masterbate to me, just ask for the real thing.”
117 notes
·
View notes
i sound rlly weird asking but can u make a part two of the jerk!ng off head cannons for carl 😇😇
literally of course my man ALWAYS deserves to feel good
this is short and sweet, also strayed away from headcanons and did a little bit of a fic….actually loved writing this
NSFW under the cut, all characters depicted are 18+, MDNI.
It was a hot summers day in Alexandria, resulting in a group of teenagers making their way down to a nearby lake, intending on cooling off and having some fun.
Usually, Carl considered himself more… mature than his peers. There was a war actively brewing, and that’s not to mention walkers, so he didn’t see the value in such a meaningless activity.
Yet, you’d convinced him to come.
“Please, Carl. It’ll be fun!” You’d pleaded, “What else were you gonna do all day? Read comics?”
At the time, he’d protested, made some excuse that he was helping his father. But he wasn’t, and you were right.
So here he was, sitting on one of the large rocks lining the lake, flannel still cast over his shoulders.
The few other teens, yourself included, were enjoying the cool reprieve from the heat. Splashing around, throwing handfuls of sand at each other.
Carl was trying his hardest not to look at you.
Now, he’d never actually seen.. so much of a woman before. Sans those lewd comics, but this was different.
Your bikini was tiny, spaghetti straps wrapping over your shoulders, little triangle cups covering a portion of your breasts. Though the bottoms didn’t match, they were equally small, riding up your ass cheeks and showing a sliver of your inner thighs.
“Carl! Come in!” You’re suddenly calling out to him, which immediately draws his gaze. There’s no avoiding it as you tread closer, propping your elbows up onto the rock that he’s sitting on.
It only squeezes your breasts together, presented nicely in the frame of your arms. Sitting there, waiting.
He forces himself to maintain eye contact, not wanting you to pick up on his obvious disarray. The flush of his cheeks, or the way he squirms a little under the attention. “No, I’m alright.” He excuses.
But you won’t accept this, your grin widening as you hoist yourself onto the rock, coming to sit next to him. “C’mon, you’ve gotta chill out a bit, sometime. Taking a quick dip in the lake isn’t gonna hurt anyone.”
As you speak, your wet skin brushes against his flannel, the contact only worsening the flood of emotions that Carl is experiencing. It’s too much, too quickly, the presence of a pretty, dripping wet, girl is too much to handle.
The sun shines down through the trees, reflecting off your water-coated skin and hair, making it shine. Little droplets slip down your curves, and his eyes fall to one in particular, travelling down the open valley of your breasts.
“I’m going to check the perimeter.” Carl quickly says, swiftly standing up and turning away from you, not wanting to spare another glance at your body. It’s too tempting. That, and a shameful blush makes it’s way to his cheeks, his own body reacting to the contact in a way he’d rather you not realise.
He trudges past the treeline, out into the expanse of forest that circles the lake. It’s not too far off from Alexandria, in fact, he can just see the walls from this distance.
Carl wants to stay, he really does. Anything to put that smile on your face, where you’d say his name in that happy tone, completely enamoured by the smallest thing.
But he’s got a problem to deal with.
He leans against a tree, the thin flannel acting as a barrier between his back and the bark. There’s an obvious tent in his swimmers, poorly hidden due to the loose material.
“Fuck..” Carl curses under his breath, a little annoyed that he even has to do this. It doesn’t feel leisurely, but a chore, an irritating burden that needs to be solved before he can go have fun with everybody else.
So he takes another look around, making sure the area is clear before snaking his hand underneath the waistband, letting his fist wrap around his half-hard cock. A few strokes brings it to its full length, already hot and throbbing, where he can pull it free.
This isn’t the time to draw it out, so Carl clamps one hand over his mouth, the other working feverently to jerk himself off, as quickly as possible.
Yet, he can’t help but fall into a pleasurable rhythm, eye falling closed as he savours the feeling. His mind wanders, curious as to what you’d think of him now, doing something so lewd with no privacy.
It causes embarrassment to well in his gut, but it only fuels his desire, squeezing his hand a little tighter around his length, thumb collecting the precum from the tip only to spread it back down.
Each time his mind lingers too long on you, in that tiny bikini, he can practically feel it oozing out of him. Desperation floods his veins, now more focused on cumming, a reality that isn’t far away now that his brain is filled with images of you, on your knees before him.
What would your mouth feel like? Your hands? Would you take it slow, drag it out, or were you more of a quickie person?
Eventually Carl’s mind lands on you with your mouth open, plump lips wrapped around the tip of his cock. He similarly stimulates the swollen head, groaning into the back of his hand as he finally shoots his load onto the forest floor.
The pleasure begins to subside, ebb away, but the embarrassment stays. Though he takes a moment to compose himself, try and regain his footing, when Carl finally comes back to the lake, it’s quite obvious the boy is in some state.
There’s tree bark in his hair.
You smile, finally coaxing Carl into the water. He still doesn’t look at you, all embarrassed and flushed. This time, you make a point to lean as close as possible, to stroke your hand up his arm, let your thighs touch under the water.
How long will he last this time?
230 notes
·
View notes
what fearsome critters is your cowboy dungeon meshi crew going to cool up?
Of course there are your standard lower level monsters:
Jackalopes that Marcille refuses to eat because of how much they look like cute rabbits. Still, Senshi prepares stew, cutlets, and other dishes with them because of how common they are in the western wilderness.
Hoop snakes that grab ahold of their own tails to roll around like stray hula hoops to get to you faster. Prepared as jerky for a nice travel snack or filleted to put in heartier dishes.
Cacti Cats that blend into their surroundings with their greenish short fur and spikey backsides. They make their nests by digging holes into saguaro or other large cacti species and rely on them for food, usually eating the fruits they grow or hunting birds and other species the fruits attract. They’re territorial and will attack adventures that get too close. To prepare, Senshi would probably pare their meat with pickled or fresh cacti fruits all roasted together to have a nice sweet and savory combo dish.
Giant Scorpions that act the same as in the show except that they lurk in abandoned animal dens and rocky patches instead of cracks in a dungeon wall.
Goofus Birds that fly backwards and hang their nests upside down with eggs that stick to the nesting so they don’t fall. These birds are hostile, but quite dumb and easy to defeat. To prepare, their meat works best in dishes you’d usually have chicken in (they taste very similar).
As for higher level monsters:
The Look Behind is a fierce opponent only skilled adventures have survived. They’re all black and it’s hard to tell what exactly you’re looking at especially with how elusive they are to the people they stalk. If the gang is ever able to defeat one, they’d probably make spaghetti with vodka-based marinara sauce, and the Look Behind meat would be ground up into meatballs.
There are others it’s just this post is already kind of long so I’ll leave it as this for now.
Shout out to @just-anarchie for showing me a cool website that I used to reference a lot of these monsters. Western mythology is so goofy especially in how things were named. Of course not everything in my interpretation is faithful otherwise I would’ve just linked the website and been done. Most changes are to make the creatures more aggressive to fit the same hostile environment of the dungeon for the west.
That website if you want to be inspired and make your own interpretations of western folk creatures: http://www.lib.lumberwoods.org/fc/agropelter.html
48 notes
·
View notes
SOLDIER Fanclubs Conspiracy Theories
A compilation of speculation and murmur amongst the Silver Elite, Keepers of Honor and Red Leather.
Sephiroth wears a wig
Genesis can't read and has just memorized LOVELESS to make people think he can
Angeal has been arrested twice before
Sephiroth is an android
Genesis has gotten three separate women pregnant, one of which was Sephiroth
Angeal can't actually lift his buster sword
Genesis definitely does drag in his off time
Sephiroth and Genesis are secretly married
Zack Fair is Angeal's child
Sephiroth can barely read too. That's why he points and mouths at whatever he's reading
Genesis is deathly afraid of squirrels
Angeal and Sephiroth accidentally burned Genesis's first copy of LOVELESS and replaced it
Sephiroth doesn't exist
Genesis is secretly plotting to place hair-removal in Sephiroth's shampoo
Angeal has had penis reduction surgery
Sephiroth is addicted to spaghetti and meatballs
Genesis isn't a natural redhead
Angeal's facial hair is sprayed on
Genesis has been to therapy for his LOVELESS addiction
Sephiroth is part cat and turns into a cat every full moon
Angeal swears A LOT
Genesis puts dumbapples in everything literally EVERYTHING
Sephiroth's breath smells like disinfectant
Genesis is colorblind and can only see red, that's why it's the only color he wears
Angeal has caused multiple insect infestations in the ShinRa tower due to his plants
Angeal has a pet snake named Genesisssss
"Sephiroth" is an alias and his real name is Anthony
Angeal has multiple secret tattoos, one of which is "certified DILF" on his back
Genesis lies about his age and he's actually younger than the other two
Genesis has an evil twin named Revelation
Angeal gets paid by ShinRa to put up with Sephiroth and Genesis
Angeal, Genesis and Sephiroth are actually married and have adopted Zack and Cloud as their kids
Genesis plans on sacrificing his friends to the goddess to obtain the gift
Sephiroth will eventually turn evil
Cloud Strife is from the future
Sephiroth can't swim
181 notes
·
View notes
Ryan having a lil' snake break 💃
Some side notes :]
First off, the sketch I did for this drawing had been laying around in my files for a couple of days, and I wasn't really sure if I wanted to try and finish it before or after going on my vacation. But, as y'all can see here, I ended up finishing it now.
This lil' drawing features some HCs I have of Ryan! One of which being that he has a pet snake (idk what to name the snake, tho' I could see Ryan calling it Slinky, Spaghetti, Noodle, or something silly like that).
The other HC I've got for him is that he's somewhere on the Aromantic spectrum, to which I colored one of the pillows after the Aromantic flag. He does have some romantic attraction towards men (evident by his ex-hubby Reed and I think a couple other guys that caught his interest in that way?), but not as much as others tend to have. So yeah, I bestow upon him the Aromantic HC :]
In case it isn't as obvious, the bottom-most pillow has the homosexual pride flag. And also, the cat socks makes a return. That's about it 👍
25 notes
·
View notes
luka couffaine headcanons
• luka is a pretty laidback person
• he sometimes stargaizes at night, just so he can look at the constellations
• he isn't actually afraid of snakes, in fact, he's actually considering having one as a pet
• he and juleka have a secret communication system through music. like when one of them asks a question or speaks they would respond by playing a few notes on an instrument and they would know what it means.
juleka: "luka, have you seen my phone?"
luka: *plays a few strings on his guitar*
juleka: "found it, thanks!"
____________________________________________
luka: "what happened to my toffee pudding?"
juleka: *plays a few strings on her bass*
luka: "really, jules? I was saving that!"
juleka: *plays some more strings on her bass"
luka: "how was I supposed to know that spaghetti was yours? I didn't even see your name"
juleka: *aggressively plays some more strings on her bass while also pouting and glaring at luka*
luka: "okay, it was half finished. but i was hungry and i wasn't really craving any other foods"
juleka: *plays some more strings on her bass*
luka: "whatever, i'll just buy some"
____________________________________________
• might want a houseboat when he's older. he just loves listening to the calm waves of the water when he's sleeping or meditating
• writes songs for marinette even when they broke up
• sometimes uses juleka's head as an armrest because he's taller than her. just a way for him to tease her and laughs when she gets annoyed.
• he has really good memory. this stems from his obsession with music. not to mention that he's pretty observant. like if someone places a book somewhere and they can't remember where they put it, luka would tell them where it is.
• luka's love for music comes from when his mom used to play guitar for him and juleka as a kid. in fact, the guitar was the first instrument he learned how to play
• luka goes to the pet store to buy mice because sass admits that mice are his favorite food.
• luka is pretty chill, it's rare for him to get angry. there are only a few times where he gets angry (silencer for example)
• remember when I said that luka isn't afraid of snakes? yeah, may I mention that snakes are his favorite animal? he's considering having a snake tattoo when he's an adult, although he's not sure if he wants it on his arm or on his back.
• an empath
• his favorite flower is the devil's trumpet
• studies psychology & philosophy
• he keeps his hair his natural color for a while because keeping his edges blue can be a pain in the ass since the color washes off very quickly. so he keeps it black until he gets bored and dyed them again
• he has chromesthesia
• he firmly believes in rebirth and that there is life after death
• reads past life regression books
• he doesn't really have any aspirations for fame. despite his dad being a famous rockstar, he doesn't want to be in the spotlight. he instead wants to teach music to other people, which is why his choice of a career is a music teacher
• he is a buddhist. he believes in the majority of buddhist beliefs, including samudaya
• allergic to seafood
• plans on getting just a few more piercings
• luka is explicitly against sass calling him master
• luka will sometimes play with sass' tail whenever the kwami sits in an elevated position
• he knows how to play the lyre (due to being viperion), keyboard, & the cello.
• he is very protective, especially towards juleka. he has gotten in trouble a lot as a child for starting fights with people that bullied her.
• despite being french, he does not like cheese. he once passive-aggressively (but in a good way) gave adrien deodorant because he couldn't stand the smell of camembert
• when luka is stressed. he plays notes on his guitar with his eyes closed and tries to guess what pitch the note is at
• he is pansexual i refuse to believe he's straight!
• jokingly refers to himself as an old man because he mostly hangs out with juleka's friends, who are all two years younger than him
41 notes
·
View notes
Cats of Ambrose
Part 4?? 5???
Noodle: She’s a bright yellow cat with long legs. She wiggles and waddles and screams for spaghetti noodles. She was found with a group of tourists.
Snail: Fattests gray cat you’ll ever see. He walks slow, earning his name, and was founded after a thunderstorm.
Sir. Pendragon III: He’s a bright red cat with a missing front leg. He is strong and stands his ground when fighting snakes and alligators, which is how he lost his front leg. Lester brought him to the vet in the other town and waited for him to get better. At the end, he ended up taking the brave cat home to his cabin.
Zero: A short hair white kitten that won Vincent’s heart. She came to him while he was working on his new pice and just got in his bed and slept. No clue where she came from. Kinda looks like Zero from The Nightmare Before Christmas.
Joe: This gray short haired cat is chill. He’s Joe. Bo just strangled someone in front of him? Don’t care; he’s Joe. Vincent beheading a woman? He’s chilling; he’s Joe. Lester gutting a man? No opinion; he’s Joe. Joe is Joe.
Zelda: She’s a gray tiger cat that sleeps on Bo’s chest after his nightmares. She purrs and stays close, offering warmth and affection, and doesn’t leave until morning light.
Flower: Just a silly tiger cat that loves to play! She came to town from the marsh after a flood. Bo cleaned her up and takes care of her. She brings flowers to him.
37 notes
·
View notes
"YOU SEE THAT IN THE MOVIES?"
In the original release of MGS3, Para-Medic would talk about one of 39 different movies when the game was saved. Two of these were westerns. Copycat Ocelot models himself after the on-screen cowboys that appeared in the movies he was so obsessed with, emulating their shooting styles, dressing in Old West inspired outfits and at one point even adopting a stereotypical twang while speaking English. The concept of his character came about due to Kojima's love of Django (1966). His original design was inspired by the actor, Lee Van Cleef, renowned for his performance in the iconic "Dollars" trilogy. Being able to shoot his beret off during his boss battle in MGS3 is almost certainly a reference to a scene from For A Few Dollars More (1965). That same boss battle has tumbleweeds rolling, dust blowing and the option to engage in a standoff with him. He uses revolvers, engraved and otherwise. His gloves! His spurs! His horse! His moustache! "Draw"! There's so much about him that it doesn't need to be explained - Ocelot is THE cowboy character. The westerns Para-Medic mentions were no doubt chosen with him in mind.
1. A Fistful of Dollars (1964)
Para-Medic: "Snake, have you ever seen 'For a Fistful of Dollars'?"
Snake: "Nope, never."
Para-Medic: "It's a spaghetti western."
Snake: "Spaghetti western?"
Para-Medic "It's really cool. Especially the main character's stylish gunplay."
Snake: "Gunplay..."
Para-Medic: "I saw it in England on the major's recommendation, but it hasn't come out in the States yet. It's so cool! They'll bring it to America, I'm sure. You have to see it sometime."
Snake: "Sure."
This is the first movie in the Dollars trilogy (The third is The Good, The Bad and The Ugly, which is decidedly more popular but its inclusion would've been anachronistic as all the movies featured in MGS3 were released in or before the year 1964). Cultural significance is not the only reason for this selection. The protagonist, The Man With No Name - or "Joe" as he is referred to by the locals - is a drifter and skilled gunfighter who wanders into a small town dominated by two corrupt rival families. Without reciting the entire plot, Joe remains loyal only to himself and exploits both families in order to turn a profit. He assists, endangers and kills people of either allegiance. Making money isn't Ocelot's ultimate goal but he is, of course, infamous for his treachery, suspicious even to characters in the games. Joe is described as being uncomfortably intelligent for a hired grunt, much like Ocelot, whose preferred approach is to act as a simple stooge, feigning ignorance to his bosses, all the while observing and devising schemes to enact his secret plans.
In the end, Joe outsmarts and outlives the two families, having played a role in the downfall of them both. It's important to note that the town sheriff being a member of one of the families does not (in true cowboy fashion) sway Joe's decisions. Ocelot is similar in that he will not bow to authority simply because they wear a badge or have a title. Joe also seems to only trouble the people who "deserve it" - he sees the corrupt families as fair game, but shows no malice towards anyone else. In fact, he takes a risk and goes out of his way to reunite a captive woman with her family, which could be called noble. Ocelot considers himself noble (In MGSV, for example - "Assuming they see [Quiet] as a prisoner here, no, even more so if they do, she deserves to be treated humanely. I always thought our men were a bit more noble-minded".) and although he can be cruel, it seems to be reserved for those who, again, "deserve it", as in, they're already operating in a military environment. Every character Ocelot kills is either a war profiteer, a military operative or is corrupt in some way. In MGSV, he laments the effects of war on civilians and shares Big Boss' sentiment of, "You pick up a gun, and sooner or later you're going to hell". Ocelot describes the Venom Snake project as "a detour on [Venom's] journey to Hell". Venom is a man Ocelot must surely respect for protecting Big Boss but he still recognises him as a soldier. Not to say that Ocelot a good person but he is aware of the harm that he and those he encounters in the military and intelligence spheres inflict by engaging in direct combat and inciting violence through manipulation that results in prolonged conflict. He speaks mournfully about the cycle of vengeance that he and those like him feed into. Still, he finds it fulfilling because that's the life he was prepared for. For him, there is no alternative.
Anyway, Joe also uses a Colt .45 ("the greatest handgun ever made"), even against the main antagonist, who claims that a man with a rifle will always beat a man with a pistol. The antagonist's signature killing style is to aim for the heart, which is what Ocelot does in MGS2. There's also torture in this movie. And a cat.
2. The Magnificent Seven (1960)
Para-Medic: "Snake, have you seen 'The Magnificent Seven'?"
Snake: "Sorry."
Para-Medic: "It's a remake of the Japanese classic, 'The Seven Samurai', only in a western setting. This tiny Mexican village is attacked every year by bandits. Finally, the village elder can't stand it any longer and decides to hire someone to protect the village. Seven gunmen respond to the call. They teach the villagers how to shoot and prepare for the oncoming attack. But then, the enemy shows up at the village with a huge band."
Snake: "Then what happens?"
Para-Medic: "You'll just have to see it for yourself. I don't want to spoil it."
Snake: "...Oh."
Para-Medic: "Movies are only fun when you actually watch them. They're something you have to experience for yourself."
In this movie, the main character, Chris, rounds up six other gunfighters to help protect a farming village that is regularly ravaged by bandits. Major Ocelot is EXTREMELY reminiscent of Chico, the youngest of the seven. After witnessing Chris' impressive skills, Chico is amazed and becomes desperate to be recruited by Chris. As Chris searches for suitable candidates, Chico persists in following the growing gang around, even after becoming infuriated by what he perceives as a ridiculous, childish game (link to scene - the way he flounces off reminds me SO much of the scene where The Boss disassembles Ocelot's gun - "very young and very proud"!). Young Ocelot is just like Chico in that he is an inexperienced, volatile young man who is eager to impress someone he idolises. Snake and Chris both act as older role models who teach the rookies to temper their pride in order to become a better soldier/gunfighter.
This movie script excerpt shows Chico's youthful naivety, as well as the likely reason Ocelot is so fond of westerns:
Chico: "Villages like this, they make up a song about every big thing that happens. Sing them for years."
Chris Adams: "You think it's worth it?"
Chico: "Don't you?"
Chris Adams: "It's only a matter of knowing how to shoot a gun. Nothing big about that."
Chico: "Hey. How can you talk like this? Your gun has got you everything you have. Isn't that true? Hmm? Well, isn't that true?"
Vin: "Yeah, sure. Everything. After a while you can call bartenders and faro dealers by their first name - maybe two hundred of 'em! Rented rooms you live in - five hundred! Meals you eat in hash houses - a thousand! Home - none! Wife - none! Kids... none! Prospects - zero. Suppose I left anything out?"
Chris Adams: "Yeah. Places you're tied down to - none. People with a hold on you - none. Men you step aside for - none."
Lee: "Insults swallowed - none. Enemies - none."
Chris Adams: "No enemies?"
Lee: "Alive."
Chico: "Well. This is the kind of arithmetic I like."
Chris Adams: "Yeah. So did I at your age."
Here, Chico is primarily concerned with the glory of being a gunfighter, whereas the older men who have actually lived that life have a bleaker perspective. Young Ocelot also values his reputation, pridefully reminding the KGB soldiers at Rassvet: "That's Major Ocelot to you - and don't you forget it!"
The arrogance of youth puts Ocelot in danger more than once. Snake spares him after every encounter, explaining to EVA that Ocelot is "still young". Over the radio, Snake says that he doesn't think Ocelot is "any older than 18 or 19", which is younger than his actual age of 20. Snake is 29 in MGS3, whereas Ocelot has only been out of his teenage years for a few months. A nine-year gap at that age is massive in terms of maturity, which is why Snake assumes Ocelot is still just a teenager. In the MGS3 novel, it seems the devious aspect of Ocelot's character is toned down, with more of a focus on how immature he is instead. His youth is mentioned at every opportunity and his admiration for Snake surviving Volgin's torture is described as "naive". Like in the game, his emotions often get the better of him which could be seen as quite childish too, as could the way he looks for guidance and approval (checking his unit are laughing along with him, ditching the engraved revolver because Snake mocked it, etc.). One of his super cool and necessary gun juggling moments is even compared to a traditional Japanese children's game called "otedama" where beanbags are tossed and juggled - a literal child's game. Snake looks on Ocelot as The Boss looks on Snake: young, inexperienced and naive. This relationship connects Snake and Ocelot through The Boss: Ocelot is her biological son, Snake her spiritual son. The Boss was Snake's mentor, and he became Ocelot's.
These lines sum up the most likely reason for Ocelot's love of westerns:
"Places you're tied down to - none. People with a hold on you - none. Men you step aside for - none."
That kind of freedom is probably something that Ocelot, raised to be a tool by the Philosophers, has desired since a very young age. Watching westerns might have inspired some kind of hope that he could have that agency over his life one day, too.
There's also a scene where Chico infiltrates the enemy camp and returns with information, an act he later brags about. Ocelot is too cautious to brag about being a spy but he does have a high opinion of himself (on the surface). Chico makes a speech in the village, ringing a bell to demand everyone's attention, a grandiose display that matches Ocelot's cockiness and dramatic gestures. While alone in the woods, Chico encounters a docile bull and tries to play bullfighter with it ("Toro! Toro! Toro!" It doesn't respond.). He kisses his hand and places it on the bull, transferring the kiss indirectly as a symbol of his harmless intent. It's another example of the light-hearted playfulness that might be expected from a young person. Considering Ocelot's fondness for animals (particularly the markhor) and tendency to be playful, it's not difficult to imagine him acting in the same way.
3. Gunfight At The OK Corral (1957)
Para-Medic: "Hey, Snake. Ever seen Gunfight At The OK Corral?"
Snake: "No, I haven't."
Para-Medic: "It's a color western about a showdown between Wyatt Earp and the Clantons in Tombstone. I was touched by the friendship between Wyatt Earp, the lawman, and Doc Holliday, the man whose life he saved."
Snake: "Was it an American that Wyatt Earp had? I thought it might have been a Peacemaker."
Para-Medic: "What are you talking about?"
Snake: "Nothing. I was just thinking about the Single Action Army Ocelot-"
Para-Medic: "Snake. He's not Kirk Douglas."
Snake: "I know that."
This movie was only added to the 3DS version of MGS3 in 2012, so the main MGS story had already come to an end four years earlier in MGS4. Ocelot's life was over and his motivations were clear. As EVA says: he idolised Big Boss.
In this call, Para-Medic says to Snake, "[Ocelot's] not Kirk Douglas." Kirk Douglas plays Doc Holliday, making Snake Wyatt Earp. These are real-life historical figures but the following is solely based on the depictions of them in this movie.
Wyatt Earp is a virtuous lawman who crosses paths with crooked (but strangely refined) gambler, gunfighter and former dentist, Doc Holliday. Through circumstance and debt, they save each other's lives and develop a familiarity with other. Their friendship is unusual considering they operate on either side of the law. Similarly, Snake and Ocelot form a bond despite their opposing allegiances. Snake spares Ocelot's life multiple times and also saves him from falling debris during the motorcycle chase in MGS3. In the novel, Ocelot concludes that every instance of him and Snake evading death at each other's hands is fate. In the game, the only time Ocelot is "allowed" to shoot Snake is when his gun is loaded with a blank.
Doc becomes somewhat distracted by Earp, even to the point of arousing jealousy in his former brothel worker girlfriend. Both she and Doc are broadly considered to be socially undesirable. He tells her plainly that people like them "haven't mattered since the day [they] were born". Doc also expresses indifference when warned that he might be killed if he confronts another character (played by Lee Van Cleef!) who is hostile to him:
Bartender: "You act as if you want to get killed."
Doc Holliday: "Maybe I do."
He later tells Earp he would prefer to die in a gunfight rather than waste away "little by little".
Ocelot was always thrilled by combat. He refused to shuffle off and succumb to illness or allow old age to snuff him out. He found fulfilment in the brutal fistfight immediately before his death at age 70. It held great meaning for him to fight with an opponent he respected in the image of an aged Big Boss.
Like Doc Holliday, Ocelot holds himself in low regard, which is referenced in the MGS4 novel with the line about his "insignificant personality" and he certainly believes himself to be disposable given the damage he voluntarily inflicts on his mind. Ocelot does not value himself as an individual and instead lives his life devoted to Big Boss and his ideals.
Doc repeatedly refers to Earl as "preacher" which is again reminiscent of the relationship between Ocelot and Snake. Before Operation Snake Eater, Snake idolised his mentor, The Boss, who became elevated to something of a sacred figure after her death. Snake is The Boss' spiritual successor and acts as Ocelot's mentor. Ocelot respects and reveres him, and in MGSV, helps to further cement Big Boss as a battlefield legend, granting him an almost supernatural status akin to The Boss'. In the Japanese script for MGS3, Snake's initial advice to Ocelot is described as "preaching" and Para-Medic later calls it a "sermon".
Until that moment at Rassvet, Ocelot obeyed but likely didn't respect many people in his life. The Philosophers, who abducted him as a baby, raised him as a tool to carry out their orders. As a teenager, he is stationed at Groznyj Grad where his only role model is the sadistic Colonel Volgin, who rules his men with fear. Ocelot has never been allowed input into the direction of his life. He has never known his parents, never had stability and is obsessed with westerns, indicating that he longs for freedom. Snake encouraging him to use revolvers is hugely significant for Ocelot. Snake's advice to switch from modern standard gear to an outdated weapon is actually a recognition of Ocelot as an individual, something that he has likely never experienced. As a child of the Philosophers, he has been trained since birth to deceive and suppress his true emotions in order to make him a more effective spy. The revolver suits Ocelot's style and brings him genuine fulfilment, even though it's tactically obsolete. He was already wearing spurs at Rassvet and was able to procure at least three revolvers within a week. If he was interested in westerns and had easy access to revolvers, the fact that he wasn't suggests that he was suppressing part of his individuality. Ocelot looks up to Snake as a guiding figure after this.
Eventually, Doc falls deathly ill and becomes bedbound. Miserable in his weakened state, he learns that Earp's brother has been killed. On the day of the fight, he becomes invigorated and by sheer force of will, sets out to join Earp and his other brothers in avenging their sibling. He says, "If I'm going to die, at least let me die with the only friend I ever had."
Ocelot constantly risked his life for Big Boss and eventually died for him after the distinct impact of his words in 1964. He pushed the young Ocelot towards true freedom and helped him shape what little personal identity he had. He irreversibly changed the course of his life. No other person or organisation could ever do what Big Boss did for Ocelot and so were undeserving of his loyalty. Doc fighting alongside the Earp brothers is indicative of his relationship with Wyatt being so strong that it approaches the familal. Ocelot is first introduced in MGS1 as one of the "Sons of Big Boss" and then, after grafting Liquid Snake's forearm onto his elbow, can be partially described as a literal "son", which is explained in the MGS4 novel:
"He had been born an ocelot but was now—even if only in fiction—a
snake.
That might have been what he had always desired—to be the son of
the warrior whom he respected more than anyone else."
The dynamic between Wyatt Earp and Doc Holliday is similar to Snake and Ocelot in that their friendship is unexpected, strong and has elements of admiration and devotion. Earp is dedicated to his duty and inspires a loyalty in the notoriously devious Doc after displaying genuine decency and treating him fairly despite his reputation, a decision criticised by other characters. Snake plays a similar role for Ocelot throughout MGS3, where he consistently shows strength of character, skill and devotion to duty, even in extreme circumstances. Snake is also able to see past any prejudice he might be expected to have towards Ocelot as an enemy operative and reaches him on a personal level. Their budding friendship, like Wyatt Earp and Doc Holliday's, is questioned by their respective associates and colleagues.
Doc's character shares multiple traits with the many iterations of Ocelot as he appears across the series: he is refined, duplicitous, cynical, a loner and a remarkable gunfighter. Wyatt Earp also says this to him:
"I hear you did some pretty fancy shooting, Doc."
The influence of all three westerns mentioned in MGS3 on Ocelot's character is clear: A Fistful of Dollars typified the shrewd cunning he is known for; The Magnificent Seven demonstrated his youthful pride and idolisation; and Gunfight At The OK Corral evoked the strong friendship and devotion that defined his life.
85 notes
·
View notes