Tumgik
#hate it here I'm never gonna find anything to do with my life
nobodybetterlookatme · 10 months
Text
Lmao y'all ever think about where you should be in life vs where you actually are
2 notes · View notes
stinkbeck · 6 months
Text
words of wisdom: my profs are just kinda mean.
0 notes
hellsitegenetics · 7 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: according to democracy, yes
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.
Tumblr media
2K notes · View notes
taylorman2274 · 7 months
Text
We Care About You (Part II)
The aftermath that follows is a struggle for everyone to comprehend.
Content Warning(s): N/A
Notes: SAGAU; GN!Reader
Word Count: 1k
Previous || Next
Taglist: @silverstarred
---------------------------------------------------------
The past few days have been hard for your mind to wrap around.
Ever since that particular incident you had while playing Genshin, you've been extremely hesitant to log back on. Now that you knew all the people of Teyvat were self-aware, you were scared to imagine what they thought of you.
"Have they been self-aware the entire time that I've been playing? Have they always been able to hear my voice whenever I spoke aloud? Do the Traveler and their friends hate me for forcibly controlling their movements and actions like puppets? If that's the case, wouldn't it be better for me to leave them alone without letting them know?"
It doesn't seem like there's any part of your day where you're not thinking about how to follow up with the world of Genshin Impact. In fact, it's gotten so bad for you that some of your friends have noticed your change in mood and asked if anything was wrong.
Knowing that this situation is not only unheard of but also impossible to comprehend for anyone, you simply told them that you were dealing with personal issues, which honestly isn't that far from the truth.
Eventually, you began to worry if some of the people in Teyvat would figure out a way to reach you beyond the computer should you not reach back to them soon. In the past, you would've laughed at such a thought. But now that you've witnessed the impossible, you didn't want to wait around and find out.
"If I'm going to continue playing Genshin, I should at least try and accommodate their needs and wants better."
As much as you didn't want to delay your return to Genshin any further, you felt that researching all of your current playable character's needs, wants, likes, and dislikes took top priority over anything else in your life right now.
...Well...besides your needs and wants.
First, you took note of their favorite and least favorite foods. You would feel pretty bad if you kept feeding them food that wasn't their preference. Especially since characters like Lisa and Ganyu were vegetarians.
Second, you took note of everyone's talents. While you know that some characters had passive talents which gave you extra dishes when cooking or extra materials when crafting, you felt that those jobs should be left to the professionals, such as Xiangling and Albedo respectively.
"Let's see. First off, I should probably remove the people in my party with full-time jobs, as they take priority over exploring with the Traveler. So I should probably replace any Knights of Favonius, Liyue Qixing, Tri-Commission Member, etc. However, that doesn't exactly leave me with a lot of options to choose from. Although Xiangling works for Wanmin Restaurant, she's currently exploring Teyvat for ingredients. I assume accompanying the traveler would be fine with her. Bennett works for the Adventure's Guild so that works as well. But that also leaves me with a Pyro-heavy party, which may pose a problem for enemies such as Pyro slimes..."
However, the more you spent time researching, the more pessimistic and depressed you began to feel. Here you were spending all this effort trying to accommodate to all the characters you've obtained without even knowing if they gave a single thought or care in the world towards you.
"...I never really asked if they wanted to join the Traveler's adventures. ...So...maybe I should just only use the Traveler...?"
You sighed deeply. This was not gonna be good for your mental health.
---------------------------------------------------------
Meanwhile...
---------------------------------------------------------
The Traveler didn't know what to think.
On one hand, they were happy that [Y/N] was getting some much deserved rest. On top of that, they were also happy that they got to have a break from doing commissions all the time. But on the otherhand...
They were really starting to miss you.
This is the longest that they have gone without feeling your presence and they were starting to worry if they had accidentally scared you off due to that incident.
The incident that revealed Teyvat's self-awareness.
"...You're thinking about [Y/N] again, aren't you?" Paimon asked.
The Traveler chuckled sadly. "Is it really that obvious?"
"Kind of? Paimon thinks that's what everyone is thinking about."
They believe her. Zhongli, Venti, and a few others had reached out to them over the past couple of days for any news about [Y/N]. They were saddened by their expressions when they told them they had no news to give.
“...Y/N..." The Traveler sighed.
"Hmm?" Paimon hummed in thought, "What was that?"
"...To think that was their name all along. And to even think that they may be just as human as most people in Teyvat! It’s honestly kind of relieving when you think about it.
Although they weren't going to lie. At first, they saw [Y/N] as an unknown entity that possessed them to do its bidding. It was scary at first, knowing that neither them nor Paimon were able to figure out a way to interact with or avoid it. However, after solving both Mondstadt's and Liyue's respectable crises and powering them up with newfound strength, they started to see you as a sort of companion similar to Paimon.
"Yeah, even Paimon is starting to miss traveling and exploring with them."
"Is that so?" The Traveler taunted, "I thought that at one point you were trying to prove yourself as the better guide?"
"Hey! Paimon told you already that she has proved herself as the superior guide time and time again." She exclaimed as she crossed her arms.
They laughed. It felt nice to tease Paimon like this to distract them from the lack of [Y/N]'s presence, but they were starting to feel like they couldn't keep this up forever.
"Regardless, Paimon hopes that [Y/N] comes back soon. Everybody will feel a lot better once they do."
The Traveler looked up to the night sky and watched the stars flicker with light. Paimon followed their gaze and gave a sorrowful frown.
"I hope so too."
---------------------------------------------------------
Author Side Notes: I had an idea.
But in all seriousness, I'm flattered by all the positive comments, reblogs, and likes from the previous post. I only expected to get around 20 notes since it was my first post but somehow I've ended up at 800+ and counting? It's almost too much for me to handle lol.
As for the rest of this story, I've decided that it will likely take around six parts for me to reach its conclusion. We've got two down so far, so that makes four more to go. Of course, that's only if y'all want to read more.
1K notes · View notes
justliketoreadsowhat · 2 months
Text
Tumblr media
All-Star Weekend ✯
✯ 𝐅𝐮𝐧 𝐬𝐢𝐝𝐞 𝐪𝐮𝐞𝐬𝐭𝐬, 𝐚𝐧𝐭𝐢𝐜𝐬 & 𝐬𝐭𝐞𝐥𝐥𝐚𝐫 𝐟𝐢𝐭𝐬 ✯
_______________________________
“𝐈𝐭’𝐬 𝐨𝐯𝐞𝐫 𝟏𝟎𝟎° 𝐨𝐮𝐭𝐬𝐢𝐝𝐞 𝐚𝐧𝐝 𝐲𝐨𝐮’𝐫𝐞 𝐠𝐨𝐢𝐧𝐠 𝐭𝐨 𝐰𝐞𝐚𝐫 𝐥𝐨𝐧𝐠 𝐬𝐥𝐞𝐞𝐯𝐞𝐬? 𝐓𝐡𝐞𝐫𝐞’𝐬 𝐧𝐨 𝐰𝐚𝐲“ 𝐏𝐚𝐢𝐠𝐞 𝐬𝐭𝐨𝐨𝐝 𝐢𝐧 𝐭𝐡𝐞 𝐝𝐨𝐨𝐫𝐰𝐚𝐲 𝐨𝐟 𝐲𝐨𝐮𝐫 𝐬𝐡𝐚𝐫𝐞𝐝 𝐬𝐮𝐢𝐭𝐞𝐬 𝐛𝐚𝐭𝐡𝐫𝐨𝐨𝐦, 𝐚𝐬𝐭𝐨𝐧𝐢𝐬𝐡𝐞𝐝 𝐛𝐲 𝐲𝐨𝐮𝐫 𝐨𝐮𝐭𝐟𝐢𝐭 𝐜𝐡𝐨𝐢𝐜𝐞.
"The jacket goes with my outfit!" you protested tugging on your jean jacket. "We're gonna be inside anyways, the air will be blasting in there"
Arenas were always overly cold, one of the many things you've learned while being with Paige for the past two years. Today was one of her first All-Star appearances of her career. You made it your #1 priority to be there, even if that meant melting away from the scorching heat.
"Whatever you say, the outfit is beautiful though don't get me wrong" she smiled pulling down your cream-colored dress.
"It's meant to be short Paige! you're gonna stretch it out" moving away from her grip, re-adjusting yourself for another countless time in the mirror.
"I can stretch it it out some more if you want me to" her smug smirk formed in the corners of her lips, eyeing your figure"
"Don't start something you can't finish, we're gonna be late anyways let's go" pushing her taller frame out the doorway, your palms pressed against her bare skin, exposed by her bright green mesh crop top.
"Are you doubting me right now?" she questioned squinting her eyes "I was ready 20 minutes ago anyways, you're the one who decided to dress like the Met-Gala". Paige always had to make sure she got the last word and hated being proven wrong, her competitiveness shined throughout every conversation.
Luckily, she met her match the moment she laid eyes on you.
"Well then, I guess I'll stay here and go out by myself in my "Met-Gala" outfit" Crossing your arms, patiently waiting for her to give in.
"Alright come onnn" grabbing both your hands kissing them gently, ushering you out the door.
__________________________
The two of you arrive promptly 10 minutes early surprisingly. Cars were lined up past the building, as some people resorted to parking in the grass. The music blasting from the inside could be heard from miles away. The atmosphere was so lively, it was such a rush of excitement.
"You nervous?" Paige questioned. Being so indulged in the scenery, you zoned out, silencing any form of words being said to you.
Snapping out of it you turned to your girlfriend who had a concerned look on her face. "Yeah I'm good, it's beautiful out here"
She nodded in agreement, placing her arm around your shoulders pulling you closer. "If anything I should be asking you that question"
"Nah, real ones never get nervous" denying her nerves rising with each second. Patting her biceps, flexing her muscles.
"You've got to stop doing that' shaking your head in disapproval. "Let's go see what's going on inside" nudging her side.
Hoping out the car taking her soft hands into yours, you felt the warm heat hit your skin painfully slow. You wouldn't dare fix your lips to say you were hot though.
Stepping foot into the arena, the view filled with children of all ages dribbling basketballs that were about 3x their size. Applause and frequent screams erupted throughout the air as Paige walked in front of you.
You smiled to yourself seeing the outgoing love and support she received no matter where she went. It was all well deserved.
"They're all so cute" she gushed over the children running rampt across the court. Paige always loved kids and they loved her equally as much. "I know, we gotta get some good pictures with them! I'm gonna find a seat to get a good shot"
You had been urgent to put your digital camera to use and now was the perfect time. Soon you would have your own scrapbook filled with photos to embellish your core memories with the love of your life.
------------------------------
𝐋𝐚𝐭𝐞𝐫 𝐓𝐡𝐚𝐭 𝐍𝐢𝐠𝐡𝐭
𝟗:𝟒𝟕𝐩𝐦
“𝐂𝐨𝐦𝐞 𝐦𝐚𝐤𝐞 𝐭𝐡𝐢𝐬 𝐭𝐢𝐤 𝐭𝐨𝐤 𝐰𝐢𝐭𝐡 𝐦𝐞!!“ 𝐡𝐞𝐫 𝐯𝐨𝐢𝐜𝐞 𝐞𝐜𝐡𝐨𝐢𝐧𝐠 𝐟𝐫𝐨𝐦 𝐭𝐡𝐞 𝐛𝐚𝐭𝐡𝐫𝐨𝐨𝐦. “𝐘𝐨𝐮 𝐜𝐚𝐧’𝐭 𝐬𝐚𝐲 𝐧𝐨 𝐞𝐢𝐭𝐡𝐞𝐫“
You sighed looking up from the kindle, eager to finish the last chapter of your novel. You had already showered, did your skin care, had your sweet treat before bed and filled your Stanley with ice cold water for the night.
Paige on the other hand, insisted on going out with a couple of her friends who you absolutely adored, but once you were settled in bed, there was no going back out.
"You're right I'm not gonna say no, I'm going to nicely decline your offer" you stated, focusing your eyes back on your book.
"You just don't want to see me win" she groaned walking into the bedroom. Her footsteps heavier than usual causing you to pause your reading once more.
Looking up you met with Paige who had completely changed her outfit for earlier. Her black crop top was accompanied by her silver chain that read "pb5" " Her white collared button-up had slight paint splatter spread across it. Black distressed jorts flattered her tall frame perfectly, crips white air forces on her feet, per usual.
"You like the fit huh?" she beamed doing a 360 spin for your viewing
You couldn't hide your laugh as your admired her physic. She always looked utterly perfect. "You look so beautiful P, as always, but I'm still not making a tik tok with you"
She groaned once more, jumping on the bed rolling her into entire body onto yours, nearly suffocating you. "At least go out with me, pleaseee" she pleaded, burying her face into your neck.
Although Paige was always the life of the party, she adored you being there with her, even if it was from a distance. You were the puzzle piece keeping her together.
"Okay fine" you mumbled kissing her head softly "but I need more than 10 minutes to get ready so don't rush me this time"
Lifting her head she gave you a confused look "Why can't you wear what you have on?"
"My pajamas?!"
"it's dark in there, nobody is gonna see fr"
Snatching the pillow next to you, smacking her head against it. “Just get up so I can get ready Bueckers"
✯✯✯✯✯✯✯✯✯✯
474 notes · View notes
rinsoap · 2 months
Text
THEM AS YOUR BOYFRIEND!
includes : ken ryuguji and baji keisuke. they are in their late teens/early 20s.
note : UR WELCOME TO THE FOURTEEN REQS IN MY INBOX BEGGING FOR BAJI CONTENT! i was gonna write mitsuya and mikey but i got tired lol
Tumblr media
ken ryuguji as your boyfriend.
he loves taking you out on his bike. he likes how you hold him so tightly, and he likes the feeling of your cheek pressed against his back. when you first asked him, he was a little wary at first because he was kind of scared you might get hurt, but who was he to say no to his girl?
the girls at the brothel fucking love you. you exchange makeup tips and self care remedies, they pinch your cheek and tell you how cute you are. "hi love, what are you doing here looking so pretty!? ain't she pretty, kenny? yeahh he thinks so, look at him, he's blushing" "'course i think she's pretty, i'm the one dating her" oh and they love to give you life advice too; men, money, independance, all of it. draken is embarassed by how they act, but you think it's sweet.
he hates being posted to your socials. he's cool with it if his face isn't in the picture, but he values his privacy. his own social media presence is practically nonexistent, other than one highlight with one story from your birthday of you holding flowers he got you. the song he posted to you is my girl by the temptations.
though he likes his privacy, he does like pda. not intense pda, it's not like y'all have your tongues down each other's throats in public or anything, but he likes a lil kiss here n there. his arm around your waist, or your fingers intertwined with his. a kiss on your shoulder, and always one on your lips before you part. and while he doesn’t typically like to make a scene, when he misses you its a whole different story. he loves when you run to him when you see him after being away from each other for far too long, throwing your arms around his shoulders and his wrap around your waist to spin you around, peppering the side of your face with kisses as you tell him how much you missed him through giggles. "missed you too, angel," a kiss on your jaw. "i'm sorry i've been so busy lately," a kiss on your cheek "'m gonna make it up to you though, i promise." a kiss on your lips. yeah, it's that kind of pda.
he will call you so many pet names, it's not even funny. they're out of his mouth before he even realizes it. it's not like he hides his loving side exactly, it's just that with you, he gets to be a whole other type of gushy. his friends make fun of him whenever they get a glimpse of his softer side when he speaks to you, but he does not care!!! he'll never stop calling you his pretty princess or kissing your cheek or holding all your bags when you go shopping just because his friends think he's whipped. he would happily admit that they're right!!
Tumblr media
baji keisuke as your boyfriend.
he may come across as cold, but make no mistake, physical touch is his love language. he always finds himself gravitating to touching you, even in public. whether he's holding your hand or resting his head on your shoulder or tracing hearts and stars into the skin of your thigh, he just wants to touch you!!! in private, it is so much more egregious. he'll be on top of you, attacking you with kisses, hands roaming over your skin. he loves when you sleep over because then he can extend his time to cuddle with you. he likes little spoon and big spoon equally, he just wants SOMEONE to be held!!!
he has and will fight someone for you, absolutely no question. he doesn't exactly get jealous, you express how much you love him enough for him to have interalized it, but he does let a threat or two slip out when a man's flirting with you right in front of him. when someone is being creepy to you, yes, he has been known to throw a couple punches. he'll stop when you ask!! its not like he's batshit!!!! when he's finished, you tend to his wounds. muttering about how stupid he is but giving him a kiss to his temple.
he knows how obsessed you are with his hair. he watches you from the corner of his eye, staring lip tucked between your teeth as he puts it up. he complains, but he secretly loves it. "man you treat me like some slut" "true i'm just using you for your hair. one day you'll wake up bald and i'll be half way across the country with a ziploc bag full of your beautiful hair" "i hate you" he loves lying on top of you, cheek pressed against your chest as you run your fingers through your hair. he always ends up mumbling how much he loves you when your fingers find their way into his hair. he also lets you play around with different hairstyles too! his favourite will always be a half up half down moment :p
he calls you bro more than actual pet names tbh. generally, he doesn't use a lot of pet names because he'd rather call you by your name, but when he's being extra sweet or when he's tired, he'll use them. you love how cute he is when he's about to fall asleep, he starts going on and on about how much he loves his pretty girl. "soo sweet to me, love you soo much... my lovely girl... my love" he'll whisper into your neck, not even knowing exactly what he's saying himself as his eyes slowly flutter shut. when he's in a good mood he'll greet you with a lil "hey baby" or "hello perfect beautiful girlfriend" bc he's annoying like that 😞
he can ALWAYS tell when something is wrong. a clench of your jaw or a slight falter in your eyes, he immediately knows. he'll ask about it as soon as he picks up on it. he's surprisingly very good at comforting. he'll listen as long as you need him to, he'll give you a temple kiss, a gesture that quickly became a sign of love and understanding in your relationship. he'll kiss you on one, then the other, and add "to ease your mind." and you laugh because it's corny, and he rolls his eyes and claims he's never doing a nice thing for you again, but he grabs your hand to take you out to eat because he knows food is the best comfort.
389 notes · View notes
steddieas-shegoes · 22 days
Text
i'm glad i get forever to see where you end
check all tags on and read if you prefer on ao3
rated e, minors dni
happy birthday to my wife in all but law, @messessentialist. this whole idea came out of nowhere and then just kept growing and growing, much like my love for you. anytime you're ready to live our rv life dreams, i'm ready.
i'm not gonna post any links here, but just know i had 8 tabs open of different fish and birds that can be seen in and around indiana lakes. i didn't have a particular lake in mind, but there are plenty to choose from so if it matters to you, i mostly looked at lakes in the northeast and northwest area of indiana.
title is lyrics from forever by noah kahan, which is a song you should absolutely listen to if you haven't before.
this work is for sadie. if she is the only one who reads this, then that's all that matters to me.
//////////////////////////////////////////
🎣🎣🎣🎣🎣
He stares down at the paper in his hands. He thought he’d feel relief, maybe a tiny bit of happiness that he’d never admit to. He even considered that he might feel a small speck of sadness the day his brother died.
But all Wayne Munson feels right now is disbelief and anger, and he doesn’t know where to hide it before Eddie gets home.
“God damn idiot. Couldn’t even have the decency to die of old age. Had to go and get killed behind bars,” Wayne mutters under his breath as he folds the paper and slips it back into the envelope, hoping that keeping it out of sight might help him come to terms with the emotions flooding his chest. “Bullshit.”
Wayne is tired. He feels exhaustion in his bones, even in his fresh retirement.
For some, retirement is a time to reflect on the life you’ve lived and experience the things you couldn’t while you worked and raised a family. For others, retirement never happens at all.
For Wayne, retirement is a reminder that he almost lost his nephew, his son, and the government had to make sure he wouldn’t say a damn thing about how.
He knows he shouldn’t complain, but damn he sure would like to.
And now he has to figure out a way to tell Eddie that his father got killed in prison. The letter doesn’t say much, just that it was violent and the person responsible for his death is facing further consequences. As if Wayne cares about that. As if it helps explain this situation to a boy who already lost enough.
He sighs as he grabs a beer from the fridge and glances at the clock. Eddie should be home soon. He can’t hold onto this for too long; The news will get out soon enough and he’ll hear it from somewhere else, somewhere who won’t take the time to see what Eddie needs.
He takes a sip of the beer, then another, hoping the next taste of the bitter hops will help him decipher what he needs to say to Eddie.
It’s almost a blessing that Eddie doesn’t arrive home for another hour, giving Wayne time to finish his beer and get started on dinner.
Wayne is already prepared to ask Steve to head out tonight instead of linger, using the excuse of making sure Eddie doesn’t need anything before he goes. Usually Wayne finds it endearing, and hopes Eddie can see what’s so obvious there, but not tonight.
But Steve doesn’t walk in with Eddie.
Eddie’s humming something when he walks in, setting his cane against the table before sitting down in a chair and looking at Wayne with a smile.
“Hey, Wayne. How’s your day been?”
Wayne knows he’s about to ruin Eddie’s day at the very least and he’s not sure if he wants that task. He silently curses Al Munson again, wishing for someone to show up and say it was a mistake just so he doesn’t have to do this.
“Oh, boring. Ya know I hate retirement,” Wayne says as he brushes off the stress, tries to figure out a way to lead in to the news naturally. “Too much time on my hands.”
“You love fishing, though. Thought that’s where you went all morning.”
Wayne nodded. “You’re right about that. Guess I just like keeping my mind busy.”
He’s met with silence, which leads him to looking over to the table, where Eddie is staring at the envelope the letter came in.
Why did he leave it out in the open like that? It’s clearly marked from the prison.
“What’s this?” Eddie asks, always curious to the point of danger. “Dad get out?”
This was one of the worst things Wayne ever had to do and that’s saying something. Vietnam wasn’t for the weak, losing the love of his life nearly killed him, and seeing Eddie in a hospital bed after just barely escaping death is something he’d feel deep in his chest for years. But this was up there.
“No, son,” Wayne sighed, turning away from the pot on the stove. Beef stew and bread with butter was one of Eddie’s favorites, but it took a lot of work. That didn’t matter as much as making sure Eddie had support. “They sent a letter to let me know your dad passed away.”
Eddie didn’t look away from the letter. He was playing with the rings on his fingers, replaced by Steve the moment he realized they were missing in the hospital.
“Did they say how?” Eddie finally asked, still not looking up at Wayne.
“They just said another inmate was responsible. I don’t know any details. I’m sorry, Ed. Really sorry.”
And he is. Despite the fact that Al was a terrible father and made Eddie’s life harder than it should have ever been, he knows Eddie must have a lot of complicated emotions.
“Welp!” Eddie claps his hands on his thighs before finally looking back up at Wayne. “Guess that’s that.”
“It…is?” Wayne is trying to watch for any sign of discomfort or sadness, maybe anger. He sees none.
“Yeah. Not like I’ve really had him around to feel much of a loss.” Eddie smiles. It’s not fake, at least not according to Wayne’s judgment. “You’ve been my dad more than he ever was.”
Wayne feels warmth spreading in his chest at the thought of Eddie seeing him as his parent. It makes sense, but he’s never outright said something. Sure, he gave him Father’s Day cards, often handmade. And yeah, he braved a fishing trip every year for Wayne’s birthday because he knew it meant a lot to him. There was that one time he’d called him Dad when he was on morphine in the hospital.
Hearing it changes something in Wayne.
“You really feel that way, kid?” Wayne asks, sitting down at the table across from Eddie.
“Yeah. I kinda thought you knew that already.”
“Guess it’s nice to hear anyway.”
They don’t say anything else. They don’t need to.
A few minutes goes by before Wayne stands up and walks over to the stew, giving it a stir and taking a spoonful out to test the carrots and beef.
“Is that beef stew?” Eddie asks as the scent hits him.
“Sure is.”
“You were worried about how this was gonna go, huh?” Eddie teases, smirk evident in his voice.
“A little. Can’t blame me, can ya?” Wayne decides it’s done and turns off the stove. He’s grabbing two bowls from the cabinet when the front door opens.
“You forgot the meds!” Steve yells as he runs into their kitchen with a bottle of prescription pills in his hand. He freezes when he sees Wayne dishing out stew. “Sorry. Uh. Am I interrupting?”
Wayne laughs around a sigh, reaching up to grab a third bowl.
“No, have a seat, son. Just gettin’ ready to eat.”
Eddie stands and limps his way to Steve, taking the pill bottle to pocket it before he leans further in his space.
“I’m an orphan!”
Steve’s jaw drops and Wayne does all he can not to laugh. It’s not funny, and he knows that Eddie’s probably not processing the news properly yet, but he’d rather laugh than cry.
“Sorry, what?”
“My dad’s dead. The biological one in prison. Rest in peace to the man who gave me, like, two useful skills and musical talent.” Eddie is still leaning into Steve’s space and Wayne’s watching, waiting.
“I’m sorry, Eddie, that sucks.”
“Nah, it sucks that he was such a shitty dad I barely even feel sad that he’s dead.” Ah, there it is. That’s why he’s doing better than Wayne expected. “I’ve got Wayne.”
“Damn right,” Wayne adds as he pulls spoons out of the drawer. “Let’s eat.”
Steve seems lost for a moment as he looks between Wayne and Eddie, unsure what else to say in this admittedly strange situation.
He finally grabs two bowls off the counter and sets them in his and Eddie’s spots at the table.
“Let’s eat.”
- - -
Two days pass before it really hits Eddie.
Wayne’s been waiting.
Nothing major happens. Eddie doesn’t break down in tears or lash out in anger. He doesn’t even mention saying goodbye in some way.
“We should go on a trip.” He says to Wayne while they’re eating breakfast.
“What kinda trip?” Wayne asks without looking up from his newspaper.
“Camping. Or maybe cabin-ing. Somewhere with walls and running water.” Eddie sounds breathless, like he’s run a marathon. Wayne finally looks up and sees the look in his eyes. “Could go fishing and roast marshmallows and swim and stuff. Like that one time.”
He’s talking about the trip they took together a few months after he moved in permanently. His mama was gone and his dad was sitting in jail waiting for sentencing on an armed robbery turned homicide. Wayne wanted to get Eddie’s mind off everything before he had to go back to school, so he took him up to a friend’s cabin at the lake for a few days.
Eddie’s never been an outside person, but they had fun there.
It was the first time Wayne felt like Eddie was his.
It may have been the first time Eddie felt safe with Wayne, too.
“I could see if that cabin’s available. My buddy doesn’t rent it out much anymore so I’m sure he’d be fine with us using it.”
“Could Steve come?”
“Sure.”
He agrees without a second thought.
This is Eddie’s way of seeking comfort in the people he has left, he can see it from a mile away. If Eddie needs Steve to come with them, it’s no skin off Wayne’s back.
Plus, Wayne can recognize how badly Steve needs to relax. He can’t believe someone as young as him walks with so much tension in his shoulders and lines on his forehead.
“Sweet. He’s never been fishing,” Eddie explains. “Or hiking in the right side up. At least not proper hiking. I guess we aren’t really doing proper hiking. I’m wearing jeans. Can’t be real hiking.”
Wayne smiles down at the sports section of the paper, nodding and humming in agreement when Eddie recommends something else for their trip.
- - -
Steve tries insisting on taking his car as his contribution to the weekend, but Wayne tells him they need the space in his truck for all their gear. It occurs to him when Steve just blinks back at him that Eddie didn’t explain how much is actually involved in all this.
But Wayne takes the time to show him some of the stuff he already has packed in the bed of his truck.
“I thought we were staying in a cabin. Why do we have a tent?” Steve sounds nervous when he asks.
“It’s not a full tent. Just a canopy to hang up to protect us from the sun if we get caught up somewhere during our hike.”
“Hike?” Steve turns towards the trailer, glaring at Eddie, who is too busy trying to figure out which of his sneakers to wear to notice. “He didn’t say anything about hiking. I don’t have boots or, or, anything!”
Wayne grabs Steve’s shoulders, looks him in the eye, and lets out a laugh.
“Do ya think Eddie would agree to go on a hike that requires special boots?” Wayne shakes his head. “Don’t think I could bribe him to go on anything but an easy trail unless that Lars guy from Metallica was at the end of it.”
“So I’ll be fine in my Nikes?” Steve clarifies.
“Better than.” Wayne turns back to the truck bed. “I grabbed an extra pole for ya, but it’s a bit short. We can make it work, though.”
Steve stares at everything piled into the truck. Wayne stares at Steve.
He can’t read him quite like he can read Eddie, not yet, but he’s got a feeling that Steve’s overwhelmed by the effort. Wayne doesn’t know much about his upbringing, but he can imagine it was pretty lonely what with his parents being gone more than they were home.
He’s certain Richard Harrington wouldn’t even know how to cast a line, let alone catch a fish.
“Wayne! Should I just bring both?” Eddie’s standing barefoot on the top step of the deck, holding two pairs of sneakers up.
“Sure, Ed.” Wayne looks down at his bare feet and wrinkles his nose. “Don’t forget your socks.”
“Does he do that a lot?” Steve asks, still staring at everything in the truck.
“Not so much anymore. When he’s got a lot on his mind, though, he forgets little stuff. Socks, underwear, eating.” Wayne could go on, but he’s pretty sure Eddie will kill him if he does. “He’s excited for this trip so it probably isn’t at the front of his mind.”
“Right, yeah. I noticed that.” Steve finally looks at Wayne, small smile on his face. Fond, Wayne would say. “He was so caught up on picking up the kids for game night, he forgot the games.”
“Sounds like our boy,” Wayne said, waiting for any kind of negative reaction from Steve at his words.
But Steve’s smile grew, his cheeks flushing a light pink. He looked over at where Eddie had been standing moments ago, and Wayne watches him.
“Steve, I feel like-“
“Wayne! We forgot hot dogs!” Eddie calls from inside the trailer, front door wide open allowing him to see Eddie’s movement by the fridge. “And buns!”
Steve looks back at Wayne. “I can run and get some while you finish up here.”
“I already grabbed them. Check that red cooler and the bag next to it,” Wayne gestured towards three coolers along the side of the truck bed. “He wasn’t payin’ attention when I told him I was packin’ everything.”
“Not surprising.”
“We got it all Ed! Throw your bag in and let’s go!” Wayne calls towards the trailer. “He’s gonna throw a fit about ridin’ in the middle, but that’s what he gets for bein’ a bean pole.”
Steve snorts as he walks over to open the passenger door. “He’ll live.”
Wayne thinks Steve’s gonna fit right in.
- - -
The cabin is off the beaten path. It’s actually off of all paths. They’re lucky that Wayne’s friend visited recently to clear bushes and trees away so they could get to it.
Forest surrounds it on three sides, the lake is in the back.
It’s quiet, an escape for all of them, but especially for Eddie. Whatever thoughts are trying to cloud Eddie’s mind might just float away in the fresh air if he manages to relax enough.
They unload the truck efficiently, bringing everything inside except the fishing equipment, which stays on the front porch so Wayne can load it on the boat before nightfall. He doesn’t bother locking his truck up; There’s no one around for two miles at least.
Steve’s loading things into the fridge and Eddie’s…
“Where’s Ed?” Wayne asks as he grabs his duffel bag to bring to one of the bedrooms.
“Said he wanted to see how cold the water is,” Steve shrugs, shoving the beer to the side so he can make room for Eddie’s Mountain Dew. “Told him it’s probably not that cold since it’s August.”
“Anything less than boiling is too cold for that one,” Wayne chuckles. “I’ll go load the boat.”
He goes out the back door, immediately locating Eddie at the water’s edge. At least he didn’t go far. He was a bit of a flight risk at the best of times and these weren’t really the best of times.
His shoes and socks are off, sitting in the mix of sand and rocks that make up the shoreline. The rocks are smooth, worn down over thousands of years of water and animals and people. Perfect for skipping across the top of the water, splashes disrupting the calm of a lake with few visitors this close to the end of summer.
Wayne showed Eddie how to skip rocks years ago, not on this lake, but a much smaller one that they’d visited for the day the summer before he started high school. It took him about 100 tries before he got it, but when he did, he’d beamed back at Wayne, proud of himself for possibly the first time in his life.
But he’s not skipping rocks now. He’s standing at the shoreline, where the small waves break against the sand, staring out at the horizon. Wayne is tempted to leave him be, but he can’t.
He walks up behind him, makes sure to clear his throat so he isn’t completely startled when Wayne stops right where the water stops. It licks right at the toes of his boots, but they’re his work ones, steel-toe.
Eddie turns and gives him a small smile.
“Sorry, just wanted to dip my feet in.” Eddie apologizes as if Wayne would care that he’s already finding solace in the solitude of the lake.
“Stay out here as long as you want, kid. You okay?” Wayne watches as Eddie’s hands curl into fists and then relax against his thighs.
“Yeah. Thanks for bringing me out here. I’ll help load the boat,” Eddie offers, already turning towards Wayne fully and taking a step out of the water. Wayne holds his hand up to stop him. “What?”
“I got it. You can help pack the cooler in the mornin’.”
Eddie shrugs and turns back to the lake.
Wayne watches him for another minute, silent so he doesn’t disturb whatever thoughts are brewing in Eddie’s head.
As he walks back to the porch to grab the tackle boxes and poles for the boat, he sees Steve watching Eddie out the kitchen window, concerned frown and furrowed brow on his face.
Steve doesn’t notice him.
- - -
The first night is Wayne making dinner while Steve and Eddie argue over which side of the queen sized bed they’re sleeping on. He can’t help but laugh at how quickly it went from calmly suggesting the other person sleeps on the window side to personal insults.
When he hears Eddie say something about Steve’s hair being too big, he shouts for them to join him.
Dinner is relatively peaceful considering the warzone that was their shared bedroom moments before sitting down to eat. Everyone enjoys the chicken and green beans Wayne cooked, barely leaving any for leftovers. They talk about their plans for the morning, and Steve offers to clean up after they eat so Wayne can have an early night.
It’s kind of him, but he already knows their arguing is just gonna wake him up if they haven’t settled on the bed issue.
“How about you take turns sleepin’ by the window?” Wayne asks before agreeing to an early bedtime. “That way it’s fair.”
“But who has to sleep there tonight?” Eddie asks, sticking his tongue out at Steve.
“Rock, paper, scissors?”
“That’s stupid.”
Wayne raises his brow at Eddie’s crossed arms. “Draw straws then.”
“We don’t have straws.” Steve looks around the kitchen, trying to find something they can use in place of straws, but fails. “It’s fine. I’ll take the window.”
Wayne can tell he doesn’t want to, and he’s pretty sure he can guess why neither of them is thrilled with sleeping directly under a window that looks out into a dense forest, but Steve’s a self-sacrificial kind of guy. That’s been clear for as long as Wayne’s known him.
He also knows that Eddie, even as stubborn as he is, wouldn’t let a friend feel uncomfortable.
“I’ll take it tonight.” Eddie offers.
“No, it’s okay. I can take it.”
Wayne rolls his eyes. “Y’all will argue over anything.”
Steve and Eddie both turn to him with matching grins. “Mhm.” They agree in unison.
“Eddie takes window tonight,” Wayne says. “Steve can have it tomorrow night. Whoever catches the biggest fish this weekend gets to pick on the last night.”
“Sounds fair,” Steve nods, turning to Eddie to see if he agrees.
“Sure. Fair.” Eddie stands and starts clearing the drinks from the table.
Wayne decides to leave before he gets dragged into a new disagreement. He’s only got so much patience.
He’s not surprised to hear them go out the back door after the sun sets, voices quiet, but still audible through Wayne’s open bedroom window.
They don’t go far, just past the porch, about halfway to the water.
“You know, my dad would never have done anything like this with me,” Steve states, only a small hint of bitterness in his tone. “He didn’t believe in bonding time or whatever. Thought that was for fathers and sons who didn’t have a family business to maintain.”
“My dad never did either.” Eddie says back, and Wayne’s heart stops in his chest. “Probably couldn’t have stayed sober enough to make the drive to a place like this.”
Wayne waits for Steve to say something, anything. He waits for so long, he’s tempted to look out the window and see if he can see them under the light of the moon.
“Your dad didn’t deserve you,” Steve finally says, quieter than they’d been before, like he didn’t want to disrupt the quiet night with his words. “And you deserved better than him.”
“I had Wayne eventually. I have Wayne now.” Eddie replies just as quietly. “And you do too, ya know.”
Wayne isn’t much of a crier. He’s only done it a handful of times. But Eddie’s words make his eyes well up and his throat burn.
“He barely knows me,” Steve tries to argue.
“He knows enough. You were there for the worst of my shit. You still stick around. You’re here right now even though you could’ve turned down his invitation.” Eddie sounds like he’s holding back tears now. “If you mean a lot to me, you mean a lot to Wayne. You’ll just have to get used to it.”
Wayne wishes he could be a part of this conversation, or at least be able to see them both. He’s respecting their space as much as he can, though. He’s laying in his bed and biting back tears the way any respectful uncle would.
“I’m not used to meaning so much to someone.”
Wayne isn’t sure he hears him right, his voice breaking halfway through, but Steve couldn’t have said anything else.
He should stop listening. This is turning into something else entirely, he thinks. He shouldn’t hear whatever Eddie says next.
“You mean everything to me.”
Wayne closes his eyes, holds his breath, hopes that if Steve takes it the way he knows Eddie means it, that this doesn’t turn into a real fight. He hopes that Steve’s reaction is kind, even if it’s not what Eddie wants.
Wayne’s almost grateful that he can’t hear what Steve says next. Whether it’s rude or loving, he doesn’t want to be a part of this moment like this. He can’t close his window, they’d hear it. He can’t leave his room, he’ll just be in view when they come back inside.
He waits one minute, two, three. He hears a twig snap and then quiet giggling.
He smiles to himself as he hears footsteps heading back towards the cabin.
🎸🎸🎸🎸🎸
Eddie wakes up with Steve’s arms around him and something bubbling in his chest.
Could be heartburn, or it could be the love that’s been growing inside him for months.
He remembers their conversation last night, looking up at the stars and listening to the leaves gently brushing against each other in the breeze, and he can’t help the blush on his cheeks. When Steve kissed him last night, he was pretty sure he was dreaming.
This wasn’t a dream, though.
They stayed up way too late. Eddie knew the moment he looked at the clock as they got into bed and saw 1:48 in bright red that he’d struggle today.
He could hear Wayne moving around the cabin, probably making coffee and breakfast for them since they’d need an early start for fishing. It wasn’t Eddie’s favorite thing to do, but Wayne loved it, and Eddie loved Wayne.
Steve groaned as he moved one arm above his head.
Eddie looks up at him, blushing harder when Steve’s half-lidded eyes are already looking down at him. He’s smiling, cocky if Eddie’s reading him right.
“Sleep okay?” Steve’s sleep-raspy voice asks, fingers gliding across Eddie’s upper arm in unknown patterns.
“Mhm. Not long enough,” Eddie admits. “Could stay in bed.”
Steve hums in agreement before seemingly realizing that Wayne’s already up. “Don’t think we can skip out on Wayne, though.”
This is why Eddie has a hard time pushing his feelings down for Steve. He’s done this before, whether he realizes he did or not.
In the hospital, the day after he’d woken up, Steve had stopped by to bring some clothes for Wayne since he refused to leave Eddie’s side. The kids had apparently been hounding him to take them with him, but he stood his ground and told them that Eddie needed time with just Wayne right now and that he needed rest.
A few weeks later, Steve could’ve easily taken Eddie home by himself, but insisted on waiting for Wayne to get off of work to do it.
Just a week ago, Wayne had forgotten a few things at the store, and when Steve overheard him grumbling about having to make another trip, he offered to go.
That’s just who Steve is.
Eddie loves him for it.
“Yeah. He’d be so bored without me scaring the fish away with my constant humming and leg jiggling,” Eddie agrees seriously. “Wouldn’t want him to miss me.”
Steve lets out a loud laugh, and Eddie hides his pleased smile in Steve’s chest.
He can’t believe he’s doing this right now, can’t believe Steve’s arm tightens around him, pulls him closer so all he can feel and smell is Steve.
“You could just stay quiet while we fish,” Steve suggests, as if Eddie hasn’t thought of that already. “Just for a little bit.”
“That sounds boring.”
Steve pokes Eddie’s cheek with his other hand. Eddie nips at his fingertip before Steve can pull away. They both laugh.
It’s easy.
A knock on the door interrupts the casual cuddling, but Eddie knows it’s not because Steve’s ashamed to be caught with him like that. Steve isn’t used to this being okay.
“You boys up?” Wayne’s voice is barely muffled through the door, something Eddie notes for later.
“Yeah!” Eddie calls back, though he probably didn’t need to speak more than normal volume.
Steve is tense below him. Eddie hates that.
He tries to soothe him by running his hand along his side, memorizing the bumps of his scars, keeping his breathing even so Steve would calm down. Wayne wouldn’t walk in without Eddie telling him he could, but Steve must’ve assumed he didn’t respect his space that much.
“Breakfast is done. Just made eggs and toast.” Wayne knocks once more on the door before they can hear his footsteps walking back to the kitchen.
Steve relaxes and sighs.
“You don’t have to do that.” Eddie still traces along the scar on his hip. “Wayne’s cool.”
“I know.” Steve goes to sit up, but Eddie holds him down. “Eddie, I know. It’s okay. I didn’t mean to react like that.”
“There’s a price to pay before you get up.”
Steve snorts. “And what’s that?”
“A kiss.”
Steve kisses the top of Eddie’s head.
“Unfortunately, I won’t be accepting that form of payment.”
Steve’s hand cups Eddie’s cheek, thumb rubbing slowly as he guides his face up to look at him. Eddie hopes he can’t feel the heat on his skin, but the odds aren’t great.
“One kiss.”
“Only one?” Eddie pouts.
“Don’t wanna get carried away when we’re supposed to be getting up.” Steve leans in until his breath is hot against Eddie’s lips. “So one kiss and then you let me leave so we can go fishing with your uncle.”
“Fine.” Eddie can’t help smiling into the kiss. It’s quicker than he wants, but it’s perfect. When Steve pulls away, Eddie groans and falls flat on his back. “What if we fake sick?”
“You’re ridiculous,” Steve laughs as he gets out of bed and tries to get changed into regular clothes.
Eddie watches him, can’t wipe the smile off his face as Steve nearly trips over his own pant leg. He doesn’t even care if Steve catches him looking, not anymore.
He gets to look now.
After Eddie’s confession last night, after their first kiss, and the second and third, and talking for two hours by the water, it was pretty obvious that they were skipping over that new relationship awkwardness. Eddie hadn’t quite said he loved Steve, and Steve hadn’t said it either, but actions spoke louder than words. The way they couldn’t stop touching, the way Steve looked at Eddie while he talked about his most recent adventure with Dustin, the way Eddie watched Steve throw rocks as far as he could into the depths of the lake, it was all love.
“If you keep looking at me like that, I’m never leaving this room.” Steve is looking at him as he buttons his jeans and Eddie is considering sending Wayne on his own.
He waited months for this, but now it felt like waiting another hour was too much.
“Looking at you like what?” Eddie asks innocently.
“Like you wanna eat me.”
“Well…” Eddie wiggles his eyebrows and taps the bed. “I could eat breakfast in bed if you get back in it.”
Steve walks over to the bed, leans over Eddie, gets close enough to nip at his top lip.
“Get out of bed.” He presses a quick kiss to Eddie’s lips before walking to the door. He leaves it open as he leaves the room without looking back.
Eddie curses Steve’s ability to get him to do anything, and reluctantly gets out of bed. He throws on his shorts, a tank top, and ties his bandana in his hair so he doesn’t have to worry about it sticking to his forehead.
When he gets to the kitchen, Wayne and Steve are staring out the window and whispering.
“I didn’t think we’d see a marsh hawk. Population’s been down for the last decade,” Wayne’s saying as Eddie walks up on his other side. “I’ve only seen one before and that was during a trip to Lake Michigan when I was 14 or 15.”
Eddie looks out the window, trying to see what they see. He’s not sure what a marsh hawk looks like, but he’s assuming it’s one of the birds in the nearby trees.
Steve wordlessly points it out to him.
“That’s a cool bird.” Eddie says at a normal volume. The bird spreads its wings out, acting as if it might take off. It’s beautiful, the white along its beak and chest a stunning contrast to its dark brown wings.
“It’s good luck to see one in some cases,” Wayne whispers as he turns away from the window. “Seeing one on your wedding day is supposed to lead to a long and happy marriage.”
“Too bad no one’s getting married here today,” Eddie remarks as he grabs a plate and starts to scoop eggs onto it.
“Not married. But still good luck,” Steve mutters as he follows Eddie. “So we just have to grab the cooler on our way out?”
Wayne nods. “And the bait.”
“I thought we used plastic stuff.”
“We use lures, but we put worms on there to get the fish to actually bite,” Wayne explains. “I’ve got plenty of stuff for bass, but I dunno how lucky we’ll be.”
Eddie nods along as he takes a huge bite of toast. “One time we forgot worms and had to use hot dogs.”
“Fish eat hot dogs?” Steve asks in surprise.
“Some fish settle for hot dogs. They don’t quite realize ‘til it’s too late that it ain’t their food,” Wayne shrugs. “But we got plenty of worms for this trip. Should be perfect fishing conditions.”
They all ate in silence after that, but Eddie could feel Steve’s nerves building the closer they all got to clean plates.
Steve didn’t have to say it for Eddie to know he desperately wanted to impress Wayne, especially now that they were…something. They probably needed to clarify exactly what they were at some point soon. They would. Eventually. Tonight maybe.
Or tomorrow.
“I’ll clean up if you boys wanna finish getting ready.” Wayne offered as he scraped the last of his eggs onto his fork.
Eddie took him up on his offer, jumping up to go brush his teeth and get his sneakers on.
“You comin’?” He asks Steve, who’s still slowly eating the eggs he drenched in ketchup.
“Just a second,” Steve replies with his mouth full. “You can use the bathroom first.”
Eddie nods and leaves the room.
He hears the sink in the kitchen running a few seconds later, and the hushed voices of Wayne and Steve having a whispered conversation. He could sneak back, try to listen in, but he thinks that maybe Steve needs this minute alone with him.
He finishes what he needs to do quickly, though, and admittedly sneaks back towards the kitchen quieter than he normally would, hoping to overhear something interesting.
But all he walks into is Steve laughing as Wayne smiles back.
Eddie doesn’t find that he minds much, as long as they’re both happy.
🎸🎸🎸🎸🎸
Being on the boat is different as an adult.
The last time Eddie fished with Wayne on a boat, he was barely shoulder height on him and 100 pounds soaking wet. It was a much smaller boat, though, barely fit two grown adults comfortably.
This boat, however, was built for a family of at least four adults. The awning covered half of the boat, so Eddie didn’t have to sit in direct sunlight when the sun finally rose.
Steve stood to the side, watching Wayne prep the lures and bait, casting his own line out and reeling it in until it was taut. Eddie went next, making a show of it just like he always did. Wayne doesn’t comment, just shakes his head and smiles fondly as he watches the water.
“Um,” Steve starts. “I guess it’s my turn.”
Eddie’s pretty sure Wayne knows Steve’s nervous. It’s hard not to tell with how quiet he’s been the entire ride to the middle of the lake.
Wayne sets his pole in the stand at the stern, and turns to Steve with his hands on his hips. “You saw how I cast mine?”
Steve nods, but doesn’t look sure. Eddie’s not really used to seeing Steve anything less than confident, even in the face of monsters.
It hits him the moment he thinks about monsters.
They’re on a lake. A lake very similar, though much larger, to the same lake that almost dragged Steve to his death. A lake he’d previously trusted, and no longer could.
Eddie doesn’t say anything, just subtly places his hand against Steve’s hip, offering whatever comfort he can. Steve won’t admit he’s scared, but Eddie doesn’t need him to.
Wayne sees it, Eddie knows he does. But because he’s the best uncle, he doesn’t say anything.
He raises a brow and then schools his features back to a comforting smile before showing Steve how to hold the pole so he can cast it comfortably and far enough out that movements from the boat don’t scare the fish from the hook.
Eddie watches, and he sees the nerves slowly easing from Steve’s shoulders, his forehead, and his arms. He relaxes inch by inch, and Eddie couldn’t be more in love.
Wayne steps back so Steve can cast his line.
When the bobber hits the water, Wayne smiles and pats his shoulder. “Good job, son. Now reel it in a bit so you can feel if something bites. Good. Now we just wait.”
Steve turns red at the praise and Eddie realizes that Steve probably hasn’t heard a “good job” from an adult in a very, very long time.
Eddie’s childhood was fucked, but at least Wayne was there cheering him on, showing him what it meant to be proud of your kid eventually. He’s pretty sure Steve hasn’t had that for most of his life.
“How long do we wait?” Steve asks after a few minutes.
The lake is near silent, and the water is so smooth it looks like glass. If Eddie leaned over, he’d probably be able to see his reflection. The gentle lapping of water on the side of the boat and the distant sound of birds in the trees lining the water’s edge fills the air.
“I usually give it 10 or 15 minutes before reeling it in. Check my bait, maybe change the lure if there’s no bites.” Wayne’s watching the end of Steve’s line as he speaks. “I used bass lures on all of ours, but we might change them up in a minute. See what else is out there.”
Steve nods and turns back.
Wayne doesn’t take his eyes off of Steve’s bobber.
Eddie watches Wayne curiously.
Anytime he’s fished with Wayne, he’s left Eddie to his own devices after showing him what to do. He watches his own line, and only steps in to help if Eddie catches something and doesn’t wanna touch the fish.
Wayne’s eyes widen just as Steve exclaims, “Hey! Look!”
“Reel it in!” Wayne shouts, setting his pole down again and rushing to stand next to Steve.
Eddie turns and watches as Steve reels in whatever he’s caught. Judging by the bend in the pole, it’s a decent sized fish.
“Shit, what if it breaks?” Steve asks, voice shaking with the effort of trying to reel in the fish before it escapes.
“It won’t. Keep going.”
When they manage to get the fish out of the water and into the boat, Steve is breathless.
“Look at that!” Wayne holds up the line, right above where the hook is caught in the fish’s mouth, beaming at Steve. “Our boy got himself a king salmon!”
Ignoring his mention of “our” boy, Eddie steps closer and grips Steve’s shoulder, shaking him just enough to make the boat rock.
“How can you tell?” Steve asks Wayne, reaching out to hold the fish up himself.
“You see all these black spots on his back and fins?” Wayne points at a few of the spots. “Other salmon don’t have this many spots or any at all. You keepin’ him or throwin’ him back?”
Steve looks at Eddie, smile falling as he suddenly looks unsure about what the right thing to do is. Before Eddie can say anything, Wayne wraps his arm around Steve’s shoulders.
“Either is fine with me. Could cook him up for supper if you wanna keep him or send him back to his friends with a new piercing.” Wayne looks over at Eddie. “Eddie ain’t much for seafood, but I make a mean baked salmon.”
Steve nods. “Yeah, think I’ll keep this one.”
Wayne pats his shoulder again before showing him how to unhook the fish safely. He opens up the empty cooler he brought and places the fish inside.
Wayne moves to grab the bait so Steve can set up again, and while his back is turned, Eddie takes a chance.
He leans over and kisses the corner of Steve’s mouth.
“You’re a natural,” Eddie whispers as he leans away again.
“Shut up.” Steve is blushing that same pretty pink that he was last night and earlier this morning. Eddie can’t look away. “Just lucky.”
Wayne catches two rainbow trout and Eddie manages to catch a small northern pike, which quickly gets thrown back when Eddie starts to make up a story about how it’s a teenager who got separated from its parents. Wayne shakes his head as Eddie carries on, but he’s used to it. Eddie never keeps his catch if he’s lucky enough to have one.
They relax as the day warms up, popping open cans of soda as the sun gets closer to the middle of the sky. It’s not about fishing anymore; It’s about soaking up the tranquility of their surroundings.
Eddie isn’t known for being still or quiet, but even he can let himself enjoy this. Every day since March has been about survival, and appointments, and witness statements, and lawyers, and moving, and the kids. He feels like he’s barely even had time to think.
So while he sits on this boat with two of his favorite people, he thinks.
He thinks about how different his life is now, and how different it could still be.
He thinks about how much Wayne has sacrificed for him for most of his life, but especially the last five months.
He thinks about how much he wants to tell Steve he loves him.
He thinks he’ll tell him tonight.
📼📼📼📼📼
Steve sits on the porch while Wayne cleans the fish, staying a good distance away so he doesn’t end up seeing things that’ll make him wish he left the poor salmon in the lake. Eddie’s inside doing god knows what.
He’s never been happier.
He does wish Robin could be here, but she hates the outdoors. She didn’t even like going on her family’s beach trip last month.
Plus, he’s pretty sure he wouldn’t have been able to have the alone time he needed with Eddie last night if she were here. Even though she’s been telling him to just talk to him for the last three months, she wouldn’t have caught on to his plan.
Feeling this much for Eddie isn’t new.
After the events of spring break, Steve took a long, hard look at high school and realized that at least part of the reason he was always staring at Eddie was because he was very interested. He started looking for any excuse to stick around in Eddie’s hospital room, and then offered to take him to appointments, and it continued from there.
Now, they hang out almost every day. Sometimes it’s with the kids, sometimes with Robin, sometimes alone.
Steve realizes that even before they kissed and fell asleep holding each other and flirted as much as possible all day, this was the best relationship he’s ever had. He needs to tell Eddie as soon as they’re alone.
“All done,” Wayne says as he steps onto the porch, the container of cleaned fish in his hand. “You ready to learn the secret to makin’ the best fish?”
Steve is quick to nod, excited that Wayne thinks he’s even worth the time it’ll take to show him. Wayne’s been so kind this entire trip, making sure Steve is involved and welcomed, makes him feel like he belongs in their little family.
As Wayne grabs everything they’ll need, Steve sees Eddie through their bedroom door, writing in a journal, tongue poking between his lips as he concentrates. Steve’s never seen this journal, but he can assume it’s another one of his many already filled with songs and campaign ideas.
“You done starin’ at Ed?” Wayne’s voice is quiet behind him, but still makes him jump with surprise.
“Wasn’t staring at him. Thought I saw a…um…bug?” Steve knows he’s been caught halfway through trying to lie, so he moves on. “Ready?”
“Are you?” Wayne raises a brow and smirks.
“Yes!” Steve puts his hands on his hips. “What are you implying?”
“Mostly that you’re too in love with my nephew to focus on what I’m sayin’.”
Steve feels heat in his cheeks, but he chooses to ignore it and pretend that he can distract Wayne from what he’s saying.
“So we’re frying your fish and baking my salmon?” Steve starts holding up some of the spices Wayne’s set out on the counter. He can feel Wayne’s eyes on him. “Looks like you like spice.”
“Steve.” Wayne sighs. “It’s okay to feel however you feel. I ain’t gonna judge.”
“Right. Yeah.” Steve turns to finally look at Wayne, who looks sad. He shouldn’t look sad right now.
“Eddie ever tell ya about Paul?” Wayne starts filling one pan with oil and the other with a few small pads of butter.
Steve shakes his head, watching closely.
“Paul was my boyfriend when Ed first came to live with me.”
Steve’s eyes widen as that hits him.
“Woulda been my husband had we been able to be married.” Wayne starts mixing flour, salt, and pepper in a bowl while he talks. “He was a long haul truck driver. Gone for weeks at a time. Stayed with me when he passed through. Came home one day to Eddie asleep in the bed we usually shared and asked if I’d been up to something.”
Wayne smiles fondly down at the bowl of eggs, buttermilk, lemon juice, and garlic he’d started mixing together as he spoke.
“Told him everything. Expected him to call it quits. He didn’t sign up for raising a troubled kid, especially not one who may not be okay with what we had.” Wayne stops and looks up at Steve. “But he just hugged me and said he’d follow my lead. Whatever was best for Ed was what was best for us. Ain’t sure I could ever find a love like that again.”
Steve can feel tears trying to form in his eyes, but he manages to bite them back. He’s pretty sure he knows where this is going, but he listens without interrupting.
“Ed didn’t take too well to him at first. Probably ‘cause he was in and out so much, didn’t get time to bond with him like I did. Paul was patient. Always so patient with both of us.” Wayne shakes his head and looks down at the counter before he looks up smiling again. “Ed came out to Paul first, ya know? When he was 13. He’d gone on a short haul with him over the summer and when they came back, they were thick as thieves. Paul told me that night that Ed had told him he liked boys and it changed their entire relationship. I was Uncle Wayne, but Paul was like a dad to him. Definitely more than his own dad ever was.”
Wayne looked over to check that Eddie was still in the bedroom, distracted by his writing.
“Paul started taking short hauls instead of long ones. Only gone three or four days at a time instead of 14-20. Thought it was so he could be close to Ed, since we’d kinda become our own little family.”
Steve realizes he’s holding his breath when Wayne sniffs.
“He’d gotten sick and didn’t tell us. Started out thinkin’ it was pneumonia, but it got worse. Doctor thought it was heart problems, but it was everywhere. Leukemia. Untreatable by the time they figured it out.”
Steve’s wrapping his arms around Wayne before he even realizes he’s doing it, letting the tears fall as he thinks about how much pain Wayne and Eddie must’ve gone through to lose someone so important to them.
“Ed was barely 14 when he passed. I think he took it harder than me.”
Steve can’t even imagine. Wayne lost someone he loved, but Eddie lost a father figure after losing his real father to things he should never have had to compete with. And now Eddie’s father was really dead.
All he really has is Wayne.
“Kid shaved his head in solidarity when Paul lost what little hair he had left,” Wayne huffs a wet laugh as they pull away from each other. “Couldn’t believe it when I got home from work and they were both bald as cue balls. Thought they’d lost it.”
Steve and Wayne are both laughing, and it’s probably going to draw Eddie’s attention, but he kinda hopes it does. He could use Eddie’s closeness right now. He needs to see that he’s okay, that this didn’t completely destroy him, that he went on anyway.
But all Eddie does is yell at them to keep it down, which just makes them laugh harder.
“And you never dated anyone else?” Steve asks as Wayne starts putting his fishin the egg mixture. “Not even for fun?”
“Nah. Once Paul was gone, I had to work more to pay the bills. What little time I had was spent with Ed. He was my priority, always.”
Steve wipes the tears from his cheeks as he watches Wayne drop the fish into the hot oil.
“What about now?” Eddie was busy with his own life now, and they’d received enough money from the government to cover their new trailer and have plenty leftover to cover bills. Wayne was retired and had plenty of time to start dating again.
“I got lucky with Paul. It ain’t fair to compare any future relationship to what we had and I think that’s all I’d do. I’m happy the way things are for now.”
Steve drops it for now, but he makes a note to ask Eddie about it soon. He’s surprised Eddie never mentioned Paul, or even the fact that Wayne was gay, especially when he came out to Steve and Robin while he was still in the hospital.
Wayne goes on to explain how long he keeps the fish in the oil before flipping them to make sure the cooking is even, and how putting them onto paper towels to cool drains too much of the grease.
As Steve watches him prep the salmon with a glaze he made from garlic, honey, and lemon juice, Eddie finally comes out of the bedroom.
“Smells like fish,” he says with a grin.
“That’d be the fish.” Wayne doesn’t even bother looking over at him as he leans against the counter. “Salmon is already a tender fish, so you can bake it to whatever you prefer. It should only take about 10 minutes on 400 unless you like it extra crispy, then you may wanna do it for 13 minutes.”
“Chef Wayne teaching you everything you need to know?” Eddie asks Steve, stepping close enough for Steve to feel the heat coming from his body.
“He’s pretty talented. Might need to consider opening a restaurant,” Steve teases.
“Wait ‘til you have his steak. So tender you could cut it with a spoon.”
“Don’t know what you’re after with your compliments, but I’d rather ya just ask for it.” Wayne checked the clock as he closed the oven door.
“I was just bein’ nice!” Eddie exclaims, throwing his arms up in frustration. Steve never noticed how Eddie’s accent changes the more time he spends around Wayne, but he smiles to himself when it slips now. “See if I give ya a compliment again, old man.”
Steve watches as they banter back and forth some more, both of them smiling and laughing the entire time.
It’s nothing like what Steve was used to. His parents never bantered, only fought. Anything that was big enough for discussion, was big enough to yell about. As Steve got older, he learned that staying quiet and letting them get it out would usually turn out better for him. Luckily, once he reached middle school, they didn’t bother coming home enough for him to worry about what to do when they were arguing.
He doesn’t remember a time when there was fun and laughter between them, not even when he was a young child. He can remember his mom dancing with him while his dad was gone on business trips, but the moment he arrived home, the air became thick with tension and her attitude became somber. He remembers one time when his dad let him sit on his desk while he worked, making paper airplanes and having a competition to see how far they could fly, but the moment the phone rang, he was hissing a ‘get out’ with no explanation for the abrupt stop to the fun.
Steve couldn’t imagine talking to either of his parents the way Eddie talks to Wayne, but he also couldn’t imagine receiving the love from them that Wayne so easily gives to Eddie.
And now that he knows another piece of their story, he can see how they’ve come to be like this, comfortable with each other in ways many kids never are with their parents.
Steve’s mind continues to wander throughout dinner, but no one calls him out on it. Maybe Wayne somehow communicated with Eddie that they’d had a serious conversation. Maybe it was just obvious that Steve was far away from the table. Eddie and Wayne chattered as they ate, and Steve let the constant echoes of their voices be the background noise to his thoughts.
“Stevie?” Eddie’s hand touched his cheek, shaking him out of the path he was lost on. “Wayne’s gonna take a walk. You wanna go?”
Steve smiles up at Eddie before looking down at his plate. He barely remembers eating, but he only has a few small pieces of salmon left.
“Sounds good.”
Eddie looks concerned, but Steve brushes him off. He looks around, and when he doesn’t see Wayne in the room with them, turns his face so he can kiss Eddie’s palm.
“Should we grab the bug spray?” Steve asks as he stands, pushing in his chair and grabbing his plate off the table to wash it.
“Wayne’s got it outside. Think he put enough on for all of us,” Eddie follows close behind Steve. “You sure you’re okay?”
“Yeah. Just thinking.”
“About?”
“A lot.” Steve brushes it off so they can join Wayne. “Ready?”
Eddie nods and leads the way out of the cabin.
They ate an early dinner, so the sun is still high in the sky as they make their way down a trail that follows the lake’s edge. Eddie occasionally gets distracted by colorful rocks, holding them up excitedly for Steve and Wayne to acknowledge.
Steve knows the love he has for Eddie is written all over his face.
He doesn’t care to hide it.
Wayne’s quiet as they walk, occasionally pointing out a fish splashing in the distance or a heron standing in the water. He swats a mosquito away from Steve’s face, only for the mosquito to turn around and bite his hand. Eddie’s far too busy climbing over fallen limbs and branches of trees to notice what they’re doing.
“You boys should go for a swim when we get back. Water’s cool.” Wayne makes the suggestion without looking at Steve, who suddenly feels like he’s being studied under a microscope.
“Not sure if Eddie even brought a swimsuit.” Steve laughs it off, hopes they can go back to silence or change the subject.
“I’m sure you boys could figure something out.”
Thankfully, the topic gets dropped and Steve is left wondering if Wayne knows.
Sure, he joked about Steve being in love with Eddie earlier, but that wasn’t a confirmation that he knew they were together. He thought they’d been careful today, but maybe Wayne caught them when they kissed by the truck when Eddie was grabbing his wallet from the glovebox.
He doesn’t have time to think about it more because Eddie lets out a yelp and they can only watch as he falls on his ass into a muddy spot between two large rocks.
“I hate the outdoors,” he grumbles as he stands.
Wayne is laughing, but Steve is rushing over to make sure he’s okay.
“Are you hurt?” Steve’s hands are hovering over him, trying to figure out if he sees any blood. “Did you hit your head?”
“I’m fine, sweetheart,” Eddie replies quietly, holding his arms out as if trying to show proof. “My dignity may be a bit bruised.”
They’re interrupted by the hooting of an owl. It’s loud enough that Wayne shushes them and starts looking around at the trees surrounding them, trying to locate the creature.
It hoots again before Wayne locates it, pointing to a tree only ten feet away and to their right.
“Wow.” Steve says as he gets a close look at it, the white and tan feathers blending into beautiful patterns. “It’s so small. I thought owls were bigger.”
Eddie’s looking up at it, smiling.
To Steve’s shock, he’s the one who responds, not Wayne.
“It’s a northern saw-whet owl. They’re closer to the size of a robin than an owl you may be thinking of.” Eddie reaches for Steve’s hand and squeezes it once before letting it drop. “Paul taught me about all kinds of owls.”
Steve’s head snaps towards him. “You heard us this morning, didn’t you?”
“You weren’t quiet,” Eddie shrugged. “I used to be obsessed with nocturnal animals. He bought me a book about bats and owls for Christmas and went through it page by page with me.”
“I remember that book,” Wayne looks at the owl while he talks. “Paul said it made him nervous to go out at night.”
Eddie laughs. “He was convinced we’d get attacked.”
Steve can’t blame him. The longer he looks at the owl’s impossibly large eyes and spread wings, the more he believes he’s being hunted.
“Ready to head back?” Wayne asks after another minute, drawing his attention away.
“Wish I had a camera like Byers. Probably could get a good picture.” Eddie says as he starts to walk back the way they came.
Steve takes note to ask Jonathan about his so he can get him one for Christmas.
When they make it back to the cabin, Wayne excuses himself to take a shower and do a crossword before bed, which leaves Steve and Eddie to fill their time however they want. Steve thinks back to Wayne’s suggestion about going for a swim, but he’s not sure Eddie would want to now that the sun’s almost set.
He’s not even sure he wants to get into the lake after dark.
But it does sound appealing, especially with the layer of damp sweat coating his skin from their walk. And there is a light on the dock that would make it easier to at least see each other.
“Wanna go for a swim?” Steve asks Eddie as he sips on a soda.
“Now?” Eddie looks out the window in the kitchen, frowning at the darkness looming.
“Now.”
“It’s dark.”
“We can turn on the light at the dock. C’mon. Just a quick dip,” Steve nudges his shoulder as he starts walking to the back door, fully dressed.
“You’re not gonna change?” Eddie asks in disbelief.
“Don’t plan on wearing my clothes in.” Steve winks as he leaves, knowing Eddie will follow him even if he’s hesitant to do so.
Within seconds, the back door is closing and Eddie is on his heels.
“Are we seriously skinny dipping in the lake while my uncle is here?” Eddie hisses out, hand covering Steve’s forearm.
“I’m skinny dipping. You can do whatever you want,” Steve responds. “But I wouldn’t complain if you joined me.”
Eddie huffs beside him, but still follows him the rest of the way to the water’s edge. The light has a covered power switch to their right, but now that they’re in an open area by the water, they realize the moon is pretty bright.
Steve starts stripping off his shirt, then his shoes and socks. Eddie watches, probably trying to decide if he’s gonna join him or go back inside and pretend Steve isn’t naked in the water. When Steve pulls his pants off, Eddie sighs and starts untying his boots.
“Can’t believe you have me getting into another lake. Wasn’t the first time enough?” Eddie’s grumbling loud enough for Steve to hear, but quiet enough that Steve only catches every couple of words and has to use context clues for the rest. He can’t hold back a smile when he shoves his underwear down and leaves them on top of his pile of clothes.
Eddie is still grumbling as he removes his own clothes, enough that he’s distracting himself from realizing Steve’s already naked and waiting for him.
When he looks up, his eyes widen and his jaw drops open.
“You’re gonna catch flies like that,” Steve steps closer as he speaks, feeling more nervous than he expected to. “Probably should get in so the mosquitos don’t get us.”
“Right.” Eddie shakes his head, closing his eyes so he can focus. “Yes. Let’s get in.”
Steve grabs his hand and walks them both to the water. The water is chilly, but not uncomfortably cold. He knows in the next few weeks, the temperature will drop enough at night to cause the lake to be freezing cold. But right now, it’s perfect.
Being here with Eddie is perfect.
Eddie breathes out slowly as they keep walking further in, squeezing Steve’s hand.
“All good?” Steve asks when they’re waist deep.
“Yep. All good. How uh…how far do you wanna go?” Eddie’s looking out at what little they can see of the lake, even with the moonlight glistening off the tiny waves of the lake.
“Just a little more.”
Steve doesn’t take Eddie’s trust for granted here, knows that he’s asking a lot of him.
When the water is just below his collarbone, he stops.
Eddie is tense next to him, but doesn’t seem to be panicking.
“Okay?” Steve asks.
Eddie looks around and then settles back on Steve. “I’m okay.”
Something about the way he says it makes Steve pause, though.
“You can let it out if you need to, baby,” he offers. He’s not sure what it is specifically that makes him think Eddie’s on the edge of tears, but he wants to give him the chance to cry. “I’m right here.”
Eddie doesn’t sob, or cry, or do anything for a minute. They’re both looking out at the dark lake and the moon above, listening to crickets and a gentle breeze in the leaves of the trees nearby. Eddie’s breathing just stops for a few seconds and that’s all the warning Steve gets before he’s sniffling and talking.
“My dad was a piece of shit,” he starts. Steve is gonna follow his lead, and listen, and let Eddie tell him whatever he wants to. Even if that’s all he says. “He hated me. Pretty sure he hated my mom towards the end of her life, too. Anything that put attention on someone other than him was no good. That’s why he got involved with the closest thing Hawkins had to a mafia.”
Steve rubs his thumb against the side of Eddie’s hand under the water, prompting him to continue.
“He ranked pretty high with them so he got plenty of attention. Forgot that he had a wife and a kid. When my mom died, he temporarily got more attention from everyone. Made sure he looked like the mourning husband trying to be strong for the son he barely knew. Even at four and five years old I knew he was full of shit. But at least he was taking me with him sometimes, showing me cool shit. He got arrested when I was seven for petty theft and possession of drugs. Got lucky that the judge believed his sob story of being the only one who could take care of me.” Eddie scoffed. “Paid a fine with money he stole and had to do 80 hours of community service that his boss signed off on after a few weeks. Didn’t care that the only meals I ate were at school and the neighbor’s house when she saw me alone for dinner. Didn’t care that I never had school supplies or clothes that fit. Didn’t care that I missed school anytime I missed the bus, which was often because he never gave me an alarm clock to set to get up in time.”
Steve wants to cry, hearing how shitty Eddie’s childhood was, but he refuses to right now. He doesn’t want Eddie to stop talking.
“When I was nine, he taught me how to steal a car. I could barely see over the steering wheel, but it was the first time I made him proud.” Eddie clears his throat. “He got sent to prison when I was 11. I got put in the system because everything is a mess and Wayne wasn’t even listed as my uncle anywhere. Wayne heard about it all a few weeks later and didn’t stop pushing to have me in his care until they gave in. I’m surprised they put up so much of a fight considering they don’t usually care that much about poor kids with shit parents. Wayne fought for me and I didn’t even know how much he did until I was older.”
Steve glances over to see tears falling down Eddie’s face. He let go of Eddie’s hand to wrap his arm around his waist instead, pulling him against his side.
“He didn’t have to do that. He just knew what a piece of shit my dad was and apparently checked on me a few times a year without me or him knowing. And he told you about Paul.” Steve nods. “Paul was in and out a lot at first, made me suspicious. Thought he was up to no good and just using Wayne as a place to sleep when he wasn’t in the truck. But then he took me with him a few times over the summer and we got closer. I don’t think Wayne even knows how much that man loved him. He was gonna start working more local jobs sooner until I came into the picture and Wayne was struggling to keep up with bills. Long haul makes more money, so he stayed out. Made sure I had clothes and school supplies, made sure I ate three meals a day and had whatever snacks I wanted. Sent payments to the electric company before Wayne even got the bill so I never had to worry about sleeping through alarms or not being able to take a hot shower.”
Steve didn’t realize he was crying until Eddie reached his thumb up to wipe away a tear.
“He was my father in the ways that mattered to me, just like Wayne has been. Losing him was more painful than anything I feel about my dad dying now. All I feel now is guilt that I feel anything at all.”
Steve uses the arm wrapped around Eddie’s waist and the weightlessness the water allows to lift him up and guide his legs around his waist. He’s looking up at the man he loves, holding the back of his thighs, and wishing he could take every shitty feeling away with his words of comfort.
“You can feel however you feel. I’ll love you through it all,” Steve reassures him. Eddie’s breath catches at his words, and Steve knows he chose the right thing to say at the right time. “No one who cares about you is gonna judge you for having any emotion about your dad dying. If you wanted to stand in the middle of a table in the cafeteria at the school and cheer, I’d sit at the table and cheer you on. If you want to show up at his grave and scream and cry, I’ll hold your hand the whole time. So will Wayne. And so would Paul.”
Eddie sobs as he wraps his arms around Steve’s neck and hides his face against Steve’s neck. Steve can feel the wetness of his tears, can feel his own still falling into the water below. He doesn’t care how long they stay like that, doesn’t even care if this is all they do all night.
But only a few minutes later, Eddie is pulling back and looking down at Steve, hands playing with the wet ends of his hair.
“I didn’t expect any of this this weekend,” he admits. “I should learn to stop having expectations.”
Steve’s lips turn up in a half-smile as Eddie rests his forehead against his. “Better or worse than what you expected?”
Eddie snorts. “Better. Always better with you.”
Steve’s glad it’s dark enough to hide his blush, but he’s sure Eddie knows what he does to him by now. If he doesn’t, he will soon enough.
Eddie traces a line along Steve’s neck, gently poking at his moles as he watches his own movements. Steve holds him, lets him do what he wants, feels every touch like lightning.
“I love you,” he finally says, barely more than a whisper, like he’s unsure it’s okay, even after Steve’s confession. “I think I have for a while.”
Steve wants to kiss him, but this moment still feels like a part of Eddie’s monologue. He wants Eddie to lead now, to show him how to love him. Whatever he needs, Steve will give it willingly and gladly.
“How long until Wayne comes to make sure we didn’t drown?” Eddie asks.
“Probably not unless we’re still gone by morning.”
“As lovely as being in your arms all night sounds, I don’t know if I’d wanna stay in the water that long,” Eddie laughs as his legs tighten around Steve’s waist. Their mostly soft cocks brush against each other, making them both inhale loudly. “A little longer might not be so bad, though.”
Steve’s finding it harder not to kiss him, not to let his hands wander from Eddie’s thighs, up to his waist, back to his ass. He resists, but Eddie shifts his weight again and everything gets harder.
“You’re killing me.” Steve groans, letting his head fall back so he can look up at the stars in the sky instead of the ones in Eddie’s eyes.
“Look at me.” Eddie’s tone’s shifted to something serious, still adorned with an affection Steve can’t believe he gets to hear. Steve looks at him with his lips parted and unblinking eyes. “I wanna be yours. Will you let me?”
Steve nods. That’s all he can do.
Eddie’s lips are against his, gently coaxing them apart further so he can slip his tongue inside. Steve’s not even thinking about how he hasn’t brushed his teeth or eaten a mint since supper, the warmth of Eddie’s hands circling behind his back and rubbing his shoulders enough of a distraction even without his tongue gliding against the roof of his mouth.
Eddie’s hands are slow, but on a very clear path downwards as his tongue traces Steve’s bottom lip. Steve lets his own hands slip to Eddie’s lower back, lets a finger trace up and back down his spine.
Eddie shivers in his arms.
“Cold?” Steve whispers.
Eddie shakes his head. “Feels good.”
So Steve does it again, with more pressure, hoping Eddie gets the hint.
When Eddie’s hips grind forward, he knows he did.
They’re both nearly fully hard now, lips meeting again, hungrier and biting. Their moans vibrate between their chests, every movement rippling the water around them.
Eddie’s rocking his hips back and forth, friction against their cocks not quite enough to do more than get them more worked up.
The water doesn’t feel cool anymore, Steve’s body already adjusted to the temperature the moment Eddie’s hands were on him.
“Can I touch you?” Eddie asks, bringing Steve out of his thoughts about doing this in his pool when they got home. His hand is flat against Steve’s stomach, fingertips dragging through his happy trail.
“Want you to feel good too, love,” Steve trails one of his hands to Eddie’s front, stopping for a moment on the angry scars covering his side. “Together?”
Eddie slides impossibly closer, wrapping his hand around both of their cocks at once. Steve’s legs would’ve buckled without the help of the lake holding him up.
“Together is good,” Eddie smirks as his hand works them both over, squeezing at the tip the way Steve likes.
Steve had every intention of helping, but he’s doing all he can to keep his feet on the sandy ground and Eddie’s legs wrapped around his waist. He whimpers as Eddie leans in to kiss him slowly, a contradiction to his hand speeding up around them.
“Eddie, I’m…close.” Steve pants against his lips when he pulls back for air. His toes are curling in the sand below, and the small waves around them are splashing against their necks as Eddie’s hand moves faster. Steve’s bucking up into his touch, doesn’t care how desperate he seems.
“Me too, Stevie.” Eddie reassures him, just as breathless as Steve is.
Despite the words spoken and the increasing heat coiling in his belly, Steve gasps in surprise when he comes. He’s even more surprised when Eddie is right behind him, whispering Steve’s name repeatedly as his grip around them tightens then loosens.
Chests heaving, legs shaking, they stare at each other in the glow of the moonlight.
“I normally last a lot longer,” Steve breaks the silence.
Eddie breaks into loud laughter, head falling onto Steve’s shoulder before he realizes that the water is too high to do that without getting wet. He drops his legs and stands, keeping his arms wrapped around Steve’s waist for stability.
“New record for me, too, baby.”
“Next time, we’ll take our time.” Steve promises not only Eddie, but himself. He knows he has better self control than what Eddie just witnessed.
“You wanna head inside and take our time there?” Eddie’s smirking at him, fingers playfully teasing his sides under the water.
“Not sure I can be quiet enough.”
“Even if you bite a pillow?” Eddie pouts.
“I can be pretty loud,” Steve laughs, poking his bottom lip back to normal. “Plus, I’d like to be in one of our own beds when we ma- have sex.”
“Oh my god. Were you gonna say make love?” Eddie is squeezing his arms around him, lifting Steve up so most of his chest is out of the water. Steve’s hands rest against his shoulders, fingertips pruned from being in the water for a while.
“Maybe I was.” Steve knows he’s a sap. He doesn’t care if Eddie thinks it’s silly or stupid, but he does wanna avoid blowing this before it even has a chance to begin.
Eddie must see something in his eyes to keep him from pushing it more. He lets him back down slowly, soft smile on his face.
“I love that you care that much.” Eddie kisses the corner of Steve’s mouth. “I promise we’ll hold off on making love until we’re back home.”
Steve smiles shyly back at him.
“But I wouldn’t be opposed to getting my mouth on you after we shower.”
Steve smacks Eddie’s arm and rolls his eyes.
“You’re ridiculous. I love you.”
“You really do, don’t you?” Eddie sounds awestruck, like it’s suddenly hit him that this is happening, that Steve feels this much for him.
“I really do.”
🎸🎸🎸🎸🎸🎸🎸
Waking up in Steve’s arms for the second morning in a row felt too good to be true.
Most of this trip had felt too good to be true. Last night definitely felt like a dream.
He lets his eyes track over Steve’s bare chest, his neck, his lips pouting out as he sleeps. His eyelids are fluttering, but he’s still asleep, probably coming out of a dream.
Eddie’s fingers trace what’s left of the scar around his neck, touch light enough that Steve wouldn’t feel it in his sleep. He thinks about Steve’s bravery, how he dived head first into everything, be it protecting people from monsters or falling in love. Eddie knows Steve went without medical care after most run-ins in the Upside Down, and had only gotten some last time when Wayne insisted he do so while Eddie was in surgery.
The neck scars faded after they were patched up by a nurse, but many of his other wounds were deeper and infected, leaving a permanent reminder on his back and sides much like Eddie’s.
He traced along the outer lines of one of the scars shaped like a heart on his chest. Steve insisted it was just a weird oval, but Eddie insisted that it was a heart over his heart.
His chest hair has grown back in around it, nearly covering it up if you didn’t look close enough.
Eddie is close enough now.
It’s definitely a heart.
“Not sure how I feel about you staring at my chest that close,” Steve’s raspy voice fills his ear and he looks up to see Steve’s sleepy eyes looking at him. “Max at least had the decency to look from a distance.”
“Ha.” Eddie fake laughs. “I was just admiring your bountiful chest hair and the heart you wear on your sleeve.”
“It’s not a heart,” Steve groans as he covers Eddie’s head with his arms, pulling him on top of him. “You’re just blinded by love.”
“Who knew I’d be the optimist in this relationship?” Eddie breathes against Steve’s lips.
“Probably everyone who’s ever seen me in a relationship.” Steve kisses him quick, just a peck. “Let me up.”
“You’re the one who put me here.” Eddie doesn’t move. “Take me with you if you need to go so badly.”
“Eds, c’mon. I gotta brush my teeth.”
“So do I.”
Steve sighs. Eddie smiles.
“Fine.”
As Steve stands from the bed, Eddie wraps his legs around his waist, a mirror image to their time in the lake. Eddie’s not actually expecting Steve to carry him more than a few steps, but he blushes when he makes it all the way to the bedroom door.
“Still wanna come with me?” Steve raises his eyebrows like he knows Eddie didn’t expect him to take it this far.
“Can you seriously carry me down the hall?”
Steve stares blankly back at him. “I carried you for almost a mile when we got out of the Upside Down.”
“Touché.”
Steve manages to open the door with one hand before it goes back to Eddie’s leg, hoisting him up further so he has a better grip. Eddie just stares down at Steve’s face in amazement.
“Hey Wayne,” Steve says as they pass Wayne’s room. “Sleep okay?”
“Uh huh. There a reason you’re carrying the prince?” Wayne asks, causing Eddie to turn his head and scowl. “Wake up grumpy?”
“Woke up lazy.” Steve responded as he continued on the journey to the bathroom.
Once there, Steve set Eddie down on the floor and handed him his toothbrush. They brush their teeth together, smiling when they catch each other's eye in the mirror.
“Will you kiss me for real now?” Eddie asks after they’ve finished.
“Are you gonna walk to the kitchen by yourself or will I have to carry you?” Steve retorts.
“Your kiss will give me the power to make it.”
Steve snorts a laugh and leans in, his palm resting against Eddie’s jaw to pull him the last inch or so. The kiss is nothing like their back and forth. Steve consumes him, and Eddie lets him.
He doesn’t know how long they stand there, but he thinks it must be longer than they should.
Wayne clears his throat from the doorway. “Didn’t realize this was a part of brushin’ teeth these days.”
Eddie leaps away from Steve, panicked at the thought of Wayne knowing suddenly. He’s been out to Wayne for so long, he forgets that others probably aren’t comfortable being so open. Steve especially, who’s mentioned before that he wasn’t sure if he wanted to come out to everyone until he was sure they’d be okay with it.
“Relax, Ed. I clocked Steve months ago.” Wayne pushes past them to grab his toothbrush and toothpaste. “Move your relations outta here.”
“Relations?” Eddie gags. “Way to ruin the moment.”
“Sorry to ruin your delicate sensibilities. Get out.”
Steve pushes Eddie out of the small bathroom before he can respond. Eddie decides to focus on Steve’s hands on him instead of arguing further.
“Should we make breakfast?” Steve asks as they walk back to the bedroom to get dressed.
“I shouldn’t ever touch an oven, but I’ll watch you lovingly while you make breakfast, darling,” Eddie bats his eyelashes at Steve, who throws his shirt at him. “That’s not very nice. Did I not, and I quote, suck the soul-“
Steve’s hand covers his mouth while he sputters to cover Eddie’s voice from traveling out of the room.
“Jesus, the mouth on you.”
“That’s what you said last night.” Eddie’s words are muffled under Steve’s hand, but they both laugh. “I can make toast.”
“I’ll make the rest.”
Eddie spends the morning touching Steve as much as possible.
He spends the afternoon sneaking kisses and holding him in the hammock set up on the porch thanks to Wayne’s creativity.
He spends the evening watching Wayne and Steve fish while he drinks a beer and hands them whatever they need.
This is a peace that may only last until they leave tomorrow, but something tells him that this is only the beginning of a future Eddie never could’ve pictured for himself.
🎣🎣🎣🎣🎣🎣
five years later
Wayne slams the truck door a bit harder than he means to. The rain just started coming down harder and he wanted to get his bag in the cabin before it got worse.
When he enters the front door, the scent of freshly baked cookies wafts through the air and he smiles.
“Made it, boys!” He yells, though he’s pretty sure speaking at a normal volume would’ve been enough. The cabin hasn’t changed much, but Steve insisted on opening up the front portion so it felt more welcoming.
“Wayne!” Steve exclaims as he pops up from behind the counter of the kitchen. “You just missed Eddie. He went out to the trail.”
Wayne gives Steve a tight hug. At Steve’s frown, he laughs. “Sorry ‘bout the wet clothes. Started raining the last couple miles in and got heavier just as I was leavin’ the truck.”
“Oh no.” Steve groaned.
Just as he spoke, the back door slammed open and Eddie dropped his camera bag on the floor.
Wayne and Steve both took in the sight of him, drenched from head to toe, dripping onto the tile floor, and laughed.
“I hate the outdoors.”
“You’re a nature photographer. You hate the rain.” Steve walks over to him, still laughing under his breath. He picks up the bag before leaning in to kiss his cheek.
Wayne watches the exchange, fighting tears back at the reason he was invited to their cabin this weekend.
Eddie was proposing to Steve and wanted Wayne to be there to capture it with his camera. He didn’t care that Wayne was an old man who could barely operate a camera, he just wanted someone to do it.
He knew Eddie was also a little nervous and having Wayne there would help keep him calm.
Why he was nervous, Wayne didn’t know.
They couldn’t legally get married, but they might as well be anyway.
“Wayne!” Eddie bounces over to him and throws his arms around him, forgetting for a moment that he’s soaked. “You’re here!”
“I’m here. I’d like to be less wet, though.”
Eddie backs up and Wayne pats his shoulder.
“Both of you should go get changed. Dinner’s ready in ten minutes.” Steve interrupts on his way to put Eddie’s camera bag in their room.
“Yes, dear,” Eddie replies. Steve turns and glares for a moment before continuing on his way. Once he’s out of sight, Eddie sighs. “God, I love that man.”
“That’s why I’m here, ain’t it?” Wayne playfully shoves at Eddie’s arm. “We better listen to him. I’m starvin’ and I think he’d make us fend for ourselves if we show up at the table dripping wet.”
As Wayne changes, he can hear Steve laughing in their room, Eddie talking about something he saw outside in the usual dramatic way he spoke. He thinks back to the first time he brought his boys here together, how hushed they tried to be, how hesitant.
He looked over at a photo Eddie framed for this room so Wayne had something when he came to stay.
Paul was smiling at the camera, arm wrapped around Eddie’s shoulders, Wayne looking at both of them with a smile. He remembers laughing right after the picture was taken, and giving in and buying them both cotton candy. They insisted it wouldn’t make them sick, then proceeded to both rush to the nearest garbage can after they got off the Gravitron at the fair.
“Wayne! Steve’s bullying me!” Eddie yells.
“You probably deserve it!” He yells back.
“Unbelievable!” Eddie screams.
“Ha!” Steve yells.
Wayne shakes his head as he makes his way out to the chaos he chose to be a part of this weekend.
394 notes · View notes
itz-mfkn-de · 16 days
Text
\\ALWAYS YOU//. M.R
warnings— OOC MATTHEO, Im a sucker for toxic boys but I made him extra sweet in his one idk why, uhhh not many tbh, cussing, kissing, smoking, that’s all I think.
summary— Mattheo was your best friend, always had been, but was the title of ‘friend’ enough?
-my first work for Mattheo! I will eventually get a master list going once I get more comfertable posting on here. This is a repost of one of my works on wattpad, just with some tweaks bc that work was olldddd-
Tumblr media
You sat against mattheos 𝐛𝐞𝐝, 𝐥𝐨𝐨𝐤𝐢𝐧𝐠 out of his dorm window.
"You know, some times, I'm worried for you. You just stare at things, it's weird." He snickered  as he took a drag from his cigarette.
You looked at him and scoffed, "Sometimes I'm worried about your lungs, you're bound to get some type of problem with all that's smoking you do." You half-joked, glancing at him.
He rolled his eyes, tilting his head up and blew the smoke out of his mouth.
"Seriously Mattheo, that stuff is absolute horse-shit for your body." You stated, accompanying your words with a sharp glare.
"I don't do it that often, just when I'm stressed." He muttered, taking his feet off of his desk and turning his body to face you.
"What happened to the whole 'I don't give a fuck about anything or anybody but myself' thing?" You said, mocking him to the best of your abilities.
"First of all I don't fucking sound like that," he laughed and squinted at you "second, just stressed about life, nothing in particular." 
You softly chuckled at his reaction. His eyes broke from yours, looking at some papers on his desk. Your eyes, however, never left his frame. You could stare at him for eternity, everything about his face seemed so perfect, almost as if it were meant to be admired.
You soon realized your staring and quickly averted your gaze towards the window again.
"You gonna go to the Yule ball this year?" You broke the silence, you knew Mattheo hated those things, he hated having to be around a shit ton of people and act like he enjoyed their company.
"Probably not." His demeanor changed, his tone became short, almost snappy.
"Oh, I'm probably just gonna go with Becca." You mumbled, knowing that if no guy was to ask you, Becca had your back.
"Hm." He nearly laughed at your remark.
"What? What's so funny?" You asked, looking back at him, his back still facing you.
"Just surprised you aren't going with a random slytherin guy or something." He answered, but the way he had said it has a strange undertone that you weren't sure how to feel about.
"Well I mean I don't know, I haven't been asked yet." You stated truthfully.
"Ah, I see." He murmured, soon after taking another drag of his cigarette.
You felt tension building in the room, suffocating tension. You weighed your options out, but you decided it would be better to give Mattheo some space, for what you were unsure of.
"Well, Becca and Emma told me they wanted to go dress shopping earlier so I think I'm gonna head over there so we can solidify our plans." You announced while picking up your books and putting them in your bag. 
"Bye Mattheo." You said while walking out of his dorm, expecting a response.
You shut the door when you got nothing, you mind raced with the possibilities on what could've caused mattheos strange behavior.
Maybe he'd just had an off day? No that couldnt have been it, he was fine moments before his attitude took a turn. 
Perhaps he was just having mood swings, you wouldn't be surprised with all the trash he puts in his body.
You stuck with that story and walked back to your dorm, which was on the other side of the slytherin tower. 
You reached it, setting your things down, then quickly turned around and nearly raced to your friends dorm.
The second you reached it, You waisted no time to jump on her bed, causing her to jump. 
"Yes, of course you can come into my room unannounced and lay on my bed." Becca said sarcastically. She had been digging through her closet in an attempt to find a dress. 
"Sorry, I just need to vent." You said while propping yourself up on your elbows.
"Go ahead." She sighed and laid her body weight 
"Okay so, there's this guy. He's like my best friend, but.."
She raised her eyes brows, signaling you to continue.
"But I want us to be more, or atleast I see him as more than a friend. I just feel like no matter how hard I try I can't get him to open up, he just.. won't."  You groaned.
"And everytime I get this sliver of hope that I've made progress, he just completely shuts down, leaving me in the dark confused and a little bit heartbroken!" You borderline screamed, your face shoved into her mattress.
"Okay, uh, let's calm down. If he's not showing any signs of being interested maybe you should just, move on- well attempt to at least." Becca stated ,rubbing your back.
You shut your eyes, truly taking in your friends words.  “hey Yknow what will make you feel better?” She nearly jumped with excitement. “Going to look for a dress in town.”
You knew she only had good intentions but the words kept echoing through your head. The thought of keeping Mattheo as a friend hurt, but it seemed to be all you could do at this point without ruining your friendship.
Maybe she was right.
Maybe you needed to accept Mattheo 
was just a friend.
-
All you could think about was the Yule ball. Over the next few weeks the days flew by, the anticipation growing larger with each one passing.
Of course you had been asked by some sweet guy from the Ravenclaw house, and, taking Becca's advice, you said yes.
There was nothing wrong with him, he just..he wasn't him.
You had decided to get ready alone, slipping into a beautiful green dress you and Becca had picked out. You finished your hair and makeup, looking into your vanity mirror.
You felt beautiful.
You smiled softly at how well you had dolled yourself up.
Glancing up at the clock, you rushed out of your dorm room, realizing it was the time you and your date had agreed to meet at the entrance by. 
You walked gracefully through the halls, a large smile adorning your face. Your heels tapped softly against the ground. You neared the entrance, your breath becoming shallow from the nerves. 
Then you saw Becca, she was wearing a beautiful Maroon dress. She looked absolutely breath taking.
"Hey!— oh my gosh." Becca looked at you, her jaw dropping. 
"You look stunning! Like some type of goddess...." She said barely above a whisper.
"Becca! Stop, you can't be talking, I forgot how to breathe the moment I saw you." You hugged her.
You were about to continue praising her and her beauty, but before you could comment you heard someone call your name.
"Y/n..wow.." he said, just loud enough for you to hear.
You turned around to see your date, who was wearing a very clean red and black suit. 
"Oh my gosh hi! Sorry for being a tad late, I lost track of time while getting ready!" You made your way next to your date, not before Becca gave you a sly smile and a push, leaving to go with her specimen she had chose for the night 
"It's okay.., you look amazing." He had said, taking your arm into his. He began to lead you into the ballroom.
"Thank you, I must say, you cleaned up nice." You smiled sweetly at him.
You and him entered the large room full of people, everything was elegant and royal, not a single speck of dust on anything.
You looked around the large room as your date led you down the stairs, you couldn't lie, you felt like a princess. The beautiful architecture of the room, complimented by your stunning dress, felt like something straight out of a fairy tale.
Once you had made it to the bottom of the staircase, you excused yourself away from your date in an attempt to go find Becca again. 
You stumbled past groups of people, many of them were couples having a romantic moment. 
You tried your best not to run into anybody, you dodged dancing bodies and nearly jogged across the dance floor.
You almost missed him.
You almost walked right by him.
You almost could've saved yourself the heartbreak.
But no you saw it—him with some random Hufflepuff girl. 
The way he whispered in her ear, the way she giggled a little too sweetly, everything. 
It all made you wanna cry—or throw up, which one that would be you weren't quite sure about yet. 
"Y/n?" Theodore came beside you and patted your back.
"Theo-Theodore, I thought Mattheo wasn't coming to the dance?" You struggled to get your words out as your eyes darted between the scene before you and Theodore. 
"Oh—uh yeah, he wasn't gonna originally, but some girl asked him and I guess he took a liking to her because usually he just brushes everyone off." Theo answered.
"Oh, I see, I just came to say hello. I'll be on my way now." Before Theodore could argue with your strange behavior you turned your back and walked as quickly as you could back to were your date was. 
You abandoned the idea of going to find Becca, you couldn't accidentally run into Mattheo and his.. friend again.
Instead you decided that distracting yourself with your date would be the best thing for your heart at the moment.
"Hey, sorry , I just saw a friend and got distracted." You said, out of breath.
"Oh. Don't even sweat it, I'm just glad you didn't run away and not come back." He joked, dragging you towards the dance floor. You couldn't help but laugh at his bubbly personality. It was a nice change of speed.
"I hope you like to dance." His hands fell onto your hips, yours made their way to his shoulders.
"I actually hate it." You smiled at him. 
"How unfortunate." Your smile grew when he matched your energy. You nearly forgot what you had seen a couple moments ago.
But alas, you didn't.
You could feel your chest tightening up, the tears bordering you waterline. Just thinking about him touching that girl in any way made you want to breakdown.
"Ex.—excuse me." You tried to excuse yourself as politely as you could. 
You didn't want your date too see you like this, vulnerable, heartbroken.
You urgently walked towards any door in your line of sight. When you finally found one, you ran through it. 
You just couldn't escape him, no matter how hard you tried. He was at every single corner you turned.
You nearly groaned when you saw him propped up over the balcony, smoking of course. 
He hasn't seemed to notice you, still looking out at the stars. 
You couldn't do it anymore, you couldn't spend one more fucking second acting like you weren't in love with him. 
The sad part was you'd rather be his friend than him hate you and be nothing at all. As long as he thought about you, you'd be okay. 
That's what you had been telling yourself, but you couldn't hold onto that lie anymore. 
"Mattheo." You croaked out behind him.
His head shot to the side, looking you dead in the eyes. 
"Angel… what're you doing out here."  He looked back out to the stars, unable to make eye contact. 
"I can't do it anymore."  You said shakily.
He turned his full body around this time, his eyes a dark brown. He blew the smoke out of his mouth, the wind pushing it in the opposite direction.
"I can't keep pretending I don't feel this way.., do you know how hard it was to watch you talk to that girl?" You nearly cried out.
"All the girls you fuck with and then bring them to shit like this, I cant keep lying to myself —wishing that it was me instead of her."
You were on the brink of gasping for air, your head pounded. You couldn't believe you had suppressed these emotions for so long. Every single time you went to Mattheo's dorm, you could barely restrain yourself from kissing him. 
Before you could continue on with your speech 
Mattheo had forced you against the wall. 
His lips met yours in a harsh collision. In an almost immediate reaction, your body responded to his actions, kissing him back with just as much need and hurry.
"You don't get to fucking do that."  He pulled back from your lips, still making sure to keep his face mere inches from yours.
"Every single day, I'd sit there and watch you talk to this new guy, I couldn't do shit about it— I wouldn't let myself do shit about it."
“I knew you deserved so much better than some lousy asshole like me, angel.” His hand held a firm grip on your hips, his other still had its place on the stone wall. 
"It took everything in me not to punch that fucker in the face when I saw him look at you, but I knew you wouldn't want that." You melted beneath his gaze.
His kisses trailed down your jawline.
"During second year, when I went to the dance, I saw you there with Draco, I nearly killed him right after. I couldn't bear to see you with anyone other than myself.. so I wouldn't go, I knew I wouldn't be able to handle it so I never went to another ball again." He gently caressed your cheek with his thumb.
"Until this year." He mumbled softly in between the kisses he was leaving on your neck.
He brought his face back up to yours, his eyes stormy and clouded with something darker than just simple need.
"What'd he say to you? What did he call you?" Mattheo asked with a dark shimmer in his eyes, one you were hoping was just from the moon.
You swallowed harshly, you hadn't realized how dry your mouth truly was. 
"He just said I looked nice—" 
"Nice? You look fucking ravishing. I've never met a girl as beautiful as you, never once in my life seen a girl who could compare anywhere near you...That's why I call you angel you know...,because even if an angel walked by, my eyes would still be glued on you."
His gentle voice tickled your ears, and your cheeks warmed up beneath him.
"You are my angel."
He kissed you again, only this time it was more gentle. His lips held no rush, they were soft and comforting. 
You were the one to pull back this time, smiling sweetly up at him. He pulled you from against the wall, leaving the two of you in the center of the balcony, under the sparkling stars.
"I can't believe we've been friends all these years, and neither of us made a move."
He spun you around under the moon light, the beautiful sky knocking the breath out of you.
"Hey matty..?”You whispered once he had began to hold you in his arms gently.
"Yes angel?" He matched your tone, the sweet nickname you gave him made his chest tighten up.
"I love you." You closed your eyes, shutting them slowly.
"I love you... I always thought I'd never be the type to say that so freely, guess I just needed to meet the right person." He swayed the two of you lightly, finding a rhythm in the midnight winds. 
"Of course it's you... 
It's always been you."
216 notes · View notes
nataliasquote · 7 months
Text
I Will Rescue You | n romanoff
Tumblr media
Summary: An alert from the Red Room sends Natasha, Yelena and Bucky on a last minute mission. But what they find is far from expected…
Warnings: teen pregnancy, injury, blood, guns
Pairings: natasha x adopted!daughter!reader
wc: 3.7k
note: this is just precious mama nat who holds a special place in my heart
-⧗-
"Got your six, Natasha. Approach when ready." Nat heard the crackle over her intercom and readied her gun, her elbows locked as she pressed herself against the wall.
Never did she think she'd be back in this place. The one place she vowed never to come back to. But here she was. The coldness of the stone wall was seeping through her tactical suit, which wasn't adapted to support her through Russia's freezing temperatures.
But that was the last thing Natasha was thinking about. There were girls inside. Girls that needed help. Natasha knew all too well how they felt, and she wanted to put a stop to it.
Yelena was on the opposite side of the courtyard, double ponytails swishing back and forth as she kept checking her surroundings. The sisters made eye contact and nodded, Natasha taking that as her cue to move.
Silent as the dead of night, the redheaded assassin crept through the open door, sticking to the shadows like this very place had taught her. She didn't make a sound, taking down guards with a single slice to the throat, clean and precise. Fires shot in the distance and she knew she didn't have long.
But this place was once her home. She knew it like the back of her hand, as much as she hated to admit it. She knew who she wanted to meet for the final time, but a faint rumbling told her that that plan was gone.
"черт возьми." She muttered under her breath as her once careful footing now broke into a sprint. The team had estimated about 30 minutes for extraction, but that had been cut down to 10. There were more guards than the trio expected, but they powered through.
"I'm hitting the training rooms. Nat cover the wings and Yelena-"
"Doors, yes I know. Don't need to tell me солдат."
"Buck, you know she hates being bossed around." Natasha whispered as she climbed the stairs. She heard gunshots through Bucky's comm, but carried on. They could look after themselves.
The sight of the dorm corridor made Nat sick to her stomach. But she hauled herself together and ran along the hallway, checking the rooms. They were empty.
The sight of the tiny beds empty was a relief to her. Maybe they had stopped taking so many young children.
"I've got 15 in here Nat." Bucky called over the comm.
"Take them to the jet. I've got none so far." She checked all the dorm rooms, but there wasn't a trace of life. She thought the place was deserted until a faint whimper was heard, followed by desperate attempts to console.
It sounded like a baby's cry, so Nat placed her gun in her hostler. She didn't need to have her weapons out right now. The widow bites on her wrists would do enough for now to keep her protected.
There were 5 single cells along the back wall, and only one of them was dimly lit. Nat stepped into the light so she wouldn't shock anyone who was living in there. It seemed empty at first, but upon closer inspection Nat could see a young girl curled up in the corner.
Her blue eyes were locked on Nat, muscles tense as she pressed herself into the wall.
"Я ничего не делал, клянусь!" (i didn't do anything I swear). There were bruises on her temples and a hastily tied bandage on her arm and Nat just smiled softly.
"It's okay. I'm not going to hurt you." She crouched down outside the rails and offered her hand out slowly, like you would to a frightened puppy. But the girl just stared at Nat, her eyes narrowing.
"You are Black Widow." Her english was broken and laced with a heavy Russian accent. "You disgrace him."
Nat frowned at her words but shook her head. "No, I'm here to save you. I'm gonna get you out."
"Nobody take us anywhere." As she spoke, her arms loosened to show the tiny baby wrapped in a blanket in her arms. It couldn't have been more than 2 months old, but yet the girl only looked around 15. Natasha felt sick to her stomach. What kind of sick programme had they created?
"Hey, it's okay. I'm not going to hurt you. How old are you?"
The girl stared at Nat for a few minutes before answering. "16."
"Блядь. (fuck)". Natasha sat back on her heels,
contemplating her next move. "And the baby? Ваш ребенок? (your baby?)". The girl nodded.
"Y/n." Nat raised an eyebrow. "меня зовут Y/n."
"That's a beautiful name. You want to get out of here?" The girl shook her head slowly, and Nat didn't blame here. This was all she knew. To her, it was home, as sick and twisted as it was. "You will be safe."
"Safe? You safe?"
Natasha nodded. "You're safe with me. You both are. But we need to go." As if on cue, the whole building began to shake and pieces of rubble fell from the ceiling. The girl screamed and buried her face in her daughter's blanket, holding her tightly. "Y/n, we need to go!" Nat blasted the padlock and the door swung open. "Now!"
"Can't!" The teenager gestured to her leg, which was openly bleeding. A gunshot wound was clean through her calf, and looked fairly fresh, meaning the girl struggled to walk. Nat registered it and brought her hand up to her comms, slowly to not startle the girl.
"Bucky I need backup. Quickly." After a grunt in reply, she quickly looked around the room to find something to help. But it was bare except for a bed and a sink.
Another vibration shook the building and Nat had no other option. She rushed over to the girl and helped her stand, taking the baby in her arm after reassuring the anxious teenager that she would be safe. The girl could hardly walk, but Nat couldn't carry her. Not with the baby too.
As a pair, they hobbled out onto what once was the hallway, now half broken in the middle and filled with rocks. Y/n was heavily leaning on Nat, pain shooting up her leg with every step.
A voice came yelling down the hallway, and through the dust broke Bucky, racing along trying to fit his gun back in it's holster. "What-"
"No questions. Move. Talk later. You need to carry her." Nat was clear and concise with her orders and she gestured to Y/n's leg, which was all Bucky needed.
But Y/n was wary of the new person and she grabbed Nat's arm in front of her. But the redhead turned to face her.
"Hey, it's okay. He is going to help you be safe." She looked into the girl's blue eyes, knowing they had very little time left to get out of here.
"Natasha, I don't know where you are but you better get out of here because this place is gonna blow!" Yelena yelled into her mic, cursing in Russian as she shot down guards.
"Y/n? Please?"
"если ты делаешь больно, детка, я делаю тебе больно! (If you hurt baby, I hurt you!)". Natasha nodded and carefully settled the baby in her arm. Y/n didn't take her eyes off the infant until Bucky picked her up and she felt the pain shoot through her leg. He mumbled an apology as they. began to run, dodging explosions and gunfires.
They broke through a gap in the wall and Y/n squeezed her eyes shut, not used to the blinding light of the sun on the snow.
Yelena was stood at the base of the Quinjet they had stolen from Stark, and as she saw her sister approaching she ran inside to start the engines. They lifted off the ground just as Nat managed to throw herself into a seat, the baby still safely in her arms.
They'd taken a bigger jet than the Avengers usually used, so the widow's Bucky had taken from the training room were in a separate area where they could sit comfortably together. But Nat had brought Y/n up to where she was sitting so she could look at her gunshot wound.
"мой ребенок! (my baby!)" Y/n cried out as soon as she was sitting, but Nat was already on it. She soothed the distressed girl and gently placed the baby in her outstretched arms.
The young girl may only have been 16, but she was a good mother. She calmed her child and an old Russian lullaby and gently stroked her head, kissing it softly. As she sat opposite, Nat couldn't help but feel a pang of jealousy when looking at the mother and daughter. As wrong as it was, she never had that opportunity, and she hated herself for it every day.
"Can I look at your leg?" The young girl nodded and stretched her leg out, wincing slightly. The bullet had gone straight through which made Nat's job easier. "Okay it just needs a few stitches. May I? This will hurt."
Y/n shrugged and pulled down the bandage on her arm. Bucky had to turn away at the sight of the DIY stitches that were 'holding' the wound closed. Nat took a sharp inhale of breath but kept her calm. That could be sorted out back at the compound.
Y/n didn't flinch once as the stitches were being put in. She kept her eyes glued to the baby, stroking her face softly as she hummed once more.
"Why don't you get some sleep?" Nat passed the girl a blanket and stepped back to give her some space. "I'll go check on the others." She said to Bucky, who nodded and went to sit at the controls with Yelena.
Y/n was exhausted but tried to keep her guard up. Her eyes darted around the small room, but it wasn't long before she couldn't fight sleep and her eyes began to close.
~~~
"Hey hey woah! It's okay! She's here. She's right here." Natasha was trying to defend herself against Y/n fists as the panicked teenager attacked her. Nat knew the baby wasn't safe just laying on the bed as the teenager slept, so she moved her to a makeshift cot. But Y/n woke up and freaked out.
"You touched her without my permission!" She screamed, swinging a fist at Nat who caught it just in time.
"Y/n, I was looking after her. You needed the rest." Nat held the struggling girl's fists in her hands and stood still, watching as she breathed hard. "It's okay. She's okay."
With a huff, Y/n pulled her hands away and scooped up her baby, cradling her close to her chest. "She needs feeding," she said bluntly.
"Okay. We don't have anything here but why don't you and I go out today and we can buy some supplies, including a cot for our room?" Natasha asked this more as a peace offering and the girl eyed her suspiciously before nodding.
"The other girls. Where are they?"
"Fury- our director has got new homes for them. Don't worry."
"And me? New home for me?"
Nat paused, thinking about her answer. The truth was, she didn't want to see Y/n leave. Not just yet. Something about the girl had reached out to her, and the slight possibility of having a daughter raced through her mind. Maybe this girl was her second chance, a chance to do something good again. "Well, we wanted to keep an eye on you and the baby. Seeing as she's so young."
Y/n just hummed in response before disappearing towards her room with a slight limp.
"You've got a feisty one there." Came a voice from behind Nat. She turned around to find Wanda snacking on a bowl of cereal, spoon halfway to her mouth.
"Yeah." Her reply was half hearted as she stared at where Y/n was last seen.
"Nat?" She turned to face Wanda once more. "I can hear your thoughts; they're really loud. And I'm gonna say go for it, but be careful. You know what you were like when you first came out. She's not much different than you, you know. Give her time."
Natasha smiled at her friend before grabbing a banana. "Thanks Wands."
~~~
Nat really listened to Wanda's words, which is why she called up the store before they left and asked to hire it out for the day. Stark had more than enough money to make that happen, and Nat wanted Y/n to be as comfortable as possible.
They entered through the back door, and only 2 members of staff were on each level of the huge department store. The bright lights and colourful items were enough to overwhelm Y/n anyway, as she held her baby close to her chest, still wrapped in the filthy blanket.
"You can pick whatever you want, okay?" Nat informed the teenager as they entered, but she didn't respond.
She wandered around, face stoic and eyes wide. Natasha could see the outline of a glock tucked into her jeans, but she didn't comment. Where she got it from was unclear, but it brought the girl a sense of comfort and Nat trusted her not to use it inappropriately.
Nat pointed a couple of bottles and baby clothes out, to which Y/n either shrugged or nodded. She was uncomfortable, but this trip was necessary.
"Okay, how about we look at cribs?"
"Our room?"
"Yeah if you want. But there's a nursery we can set up?"
Y/n thought for a minute. "But- no. Close to me."
"She will be close to you." Y/n looked skeptical. "Okay, how about this. We can get one for our room and one for hers, yeah?"
"Okay. But you don't leave no? No moving rooms?"
Natasha couldn't help but smile. "Honey, I'm not leaving. We can get you your own room if you want? For space?"
"No."
"Okay then."
They walked over to the cribs section and looked at the options. Y/n had relaxed a bit more as she considered the options, reaching her hand out to feel the wood. She'd never had the opportunity to make her own decisions before, and it felt foreign.
But within her focussed task, Natasha failed to notice the shop assistant approaching them, until a bright and cheery "Hi there! Can i help you?" broke through their thoughts.
Y/n immediately jumped behind Nat. Her hand would have reached for her gun if it wasn't so busy holding her baby and newly found protector.
"отойди! (stay back!)" Y/n yelled from behind Natasha, who held an arm in front of her. The assistant looked startled and held her hands up in surrender, taking a few steps back.
"Sorry. Could you give us a minute?" Nat apologised quickly and then turned to Y/n. "Hey, stop struggling." The girl unclenched her fist and placed it on her child's back. "That woman is not going to hurt you. Or your baby. You're safe."
"She stay away!" Y/n grunted through gritted teeth, chest heaving. Nat knew there was no winning this, so she placed her arm around the girl, who didn't flinch like she usually did.
"We don't need any assistance right now, thank you." The now shaken woman nodded and scurried away, not wanting to spend another moment around the assassins.
"We go? Now." Y/n stood her ground, staring Natasha directly in the eye.
"30 minutes. Then we go."
"Fine."
Nat rushed around the rest of the store, grabbing baby formula, clothes, cribs, clothes and tethers. She found a bouncer and play mat, even though the infant wasn't even sitting up yet. She grabbed some clothes for Y/n, some of which the teenager picked out, others that Nat knew she needed. The small girl was currently wearing one of Wanda's sweatshirts and a pair of jeans, both of which were too big. All of the items were sent directly to the compound, so they didn't have to carry anything home. And Natasha made sure to heftily tip the woman who had approached them before, as an apology.
Stark had restricted everyone's access except Nat and Wanda to the areas where Y/n was residing. The girl didn't trust men at all, and even with Wanda she was slightly wary.
But after the intense shopping trip, Y/N was exhausted. And her baby was restless, crying even after being fed and changed. The teenager was frustrated and tired, but she refused to hand the baby over to Nat, who offered many times.
But Natasha had another plan. She turned on a movie on the TV and let Y/n sit on the bed, shushing her child desperately.
"Why don't we try her new crib? Maybe she'll settle in there?"
Y/n looked over with heavy eyelids and reluctantly stood up. Her legs buckled slightly but she continued walking to place the baby in the crib. Nat handed her a pacifier but the teenager stared at her blankly, confused at the item she was holding.
"May I?" Nat asked, gesturing to the child.
"Careful." Y/n hissed.
Nat approached the infant and slotted the pacifier into her mouth, smiling at how her cried were instantly silenced.
"ведьма (witch)." Y/n mumbled, watching as her daughter fell asleep within the minute.
"Спасибо, дорогая. (Thank you darling.)" Nat quipped with a smirk as she watched the teenager climb back onto her bed. "Why don't you come onto mine? We can watch a movie?"
Y/N's eyes filled with fear. "Not Snow White. Please no."
Natasha pushed painful memories down and she shook her head. "Definitely not. I still can't watch it."
Y/n shrugged and hesitantly climbed onto Natasha's bed, sticking close to the edge nearest the crib. But Nat didn't comment. She was too busy trying to suppress her excitement over the improvements Y/n had made in such a short amount of time.
She put an episode of Friends on, knowing it was lighthearted and not likely to trigger any fresh memories that Y/n still had.
But she didn't need to worry. Within 10 minutes the teenager was fast asleep, her head resting on Nat's shoulder ever so slightly. The redhead didn't move. She couldn't. This girl was trusting her more and more. The improvement that had been made in a week was beyond anything Nat had ever expected. She paused the movie and switched off the main light, wrapping her arm gently around Y/n's shoulders.
~~~
(5 months later)
Y/n shot up in bed, chest heaving as she broke out of her nightmare. Her eyes automatically darted to the crib beside her bed... but it was empty.
"Mama! Mama! где мой малыш! (Where is my baby!)" She leaped out of bed and raced out of the room, looking everywhere as she ran to the corridor.
She kept yelling for Natasha, calls becoming more and more frantic the longer it went on. But Nat heard her and called back, summoning her into the kitchen.
"I can't find Talia! Someone must have taken h-" The teenager stopped in her tracks, not expecting what she saw infront of her.
Her 7 month old daughter, Talia, was sat in her high chair, eating yoghurt from the spoon that Nat was feeding her. There were berries scattered across the countertop and with every spoonful of yoghurt came a wipe to the mouth from Nat.
"Little miss over her was extra fussy this morning so I made breakfast. Thought you might want to sleep in a bit more."
Y/n breathed out a sigh of relief and leaned against the doorway for a second to catch her breath. "I thought she'd been taken!"
"Well, she just gets more Natty time, don't you little one?" Talia cooed in response, her tiny fists smushing a blackberry on her tray. "Oh you're a messy girl."
"Here Mama, I can clean her."
"Ah ah! I know what I'm doing." Wanda was sat on the other side of the counter eating a plate of pancakes, but she burst out laughing as Talia squished another berry and it squirted onto Nat's white shirt.
"Talia! No baby. Don't play with food." Y/n said, grabbing another wipe for Nat, who accepted it gracefully.
"Good morning Maximoff, Romanoff, Mini-Romanoff and.... Mini-Mini Romanoff." Tony made himself known as he entered the kitchen, Pepper not far behind him.
Over the last 5 months, Y/n had become more comfortable with the rest of the team, especially Tony who spoilt her rotten. He was forever ordering random items or adding updates to her room with Natasha, even without being asked.
"Good morning Stark." Y/n acknowledged him with a smile.
"Nice moves Grandma!" Tony teased as Nat danced around, wiggling her hips, causing her to pause. She grabbed Talia's soggy rabbit plushie that she had been chewing and hurled it at his head, which he only just managed to duck to avoid.
Talia giggled at the sight of her bunny flying through the air and everyone froze.
"Was that her first laugh?" Wanda asked, and Y/n grinned.
"My clever girl! Mama loves her clever girl!"Y/n picked her up from her high chair and held her up, peppering her face in kisses. Talia giggled even more, kicking her legs at the funny feeling.
Nat sank down onto a chair next to Wanda and watched her new daughter and granddaughter laughing together. Tony had given the child her bunny back, and was having fun playing peek-a-boo with her as Y/n held her.
"They've both done so well." Wanda commented as she watched the scene unfold.
"I'm so proud of her. I'm going to ask Fury for adoption papers today." Nat smiled as she felt Wanda's eyes on the side of her face.
"Really?" Wanda's voice was laced with excitement. "You're going to make it official?"
Nat nodded. "She will officially be Y/n Romanoff. My Y/n Romanoff."
516 notes · View notes
Y'all I have milked every Jschlatt headcannons post dry on this app and I'm hungry for more so I'm gonna put my writing skills to use and write my own. Also I might take requests in the future;)
Anyhoot!! Let's get on with some fluff!!
-This man will buy you everything you lay your eyes upon. You know that thing where you start to feel a clothing item in the store like you run your fingers along the sleeve of a sweater while you're checking something out. THIS MAN WILL BUY IT FOR YOU. "Oh this is cute!!" "Okay let's get it." Type shit. Even if you know you'll probably only wear it once.
-You will 100% be the passenger princess and you cannot convince me otherwise.
-Y'all this man YEARNS for cuddles. But he will never be caught admitting it. Like if y'all are just sitting on the couch watching a movie, he'll just put his arm around you and slowly move closer until y'all are cuddling. He will never admit he loves it though, but you know. You know damn well.
-When he blushes it's like OBVIOUS. Like his ears will go red and then it'll spread across his face and it's the cutest thing ever. And when he's extra flustered you can see him trying to hold back a smile, it's like an invisible string tugging at the corners of his mouth but he's trying so hard not to smile. So fucking cute.
-Just a little story idea thing I came up with while maladaptive daydreaming: he's doing a vlog with some friends while he's away from you on a trip where he's in a mall. He's in a perfume store where the group is just smelling around and he picks up a perfume that without realizing it is the exact perfume you wear. He smells it and is instantly reminded of you, the moments you'd share while snuggled up against one another, where life felt comfortably silent. A blush creeps on his face and his friends ask if he's okay, he brushes it off and tries to move on but he has something, or rather someone on his mind for the rest of the vlog. (Sorry if it sounds dumb or cringe lmao)
-He definitely keeps the relationship private from the internet but definitely brags about you to all his friends. (Ted almost asked about you on a chuckle sandwich episode to Schlatt. Needless to say Schlatt was pissed.)
-He will do anything to make you laugh, you're sad? He'll tell a joke. You're happy? He'll make the moment better with a joke. You're anxious? He'll try to cheer you up with a joke. Literally any opportunity he gets he'll try to make you laugh. He just finds your laugh adorable.
-He loves seeing you get along with his cats (especially Jambo) he loves seeing you petting or snuggling with his cats and will sometimes sneak pictures or videos of the moments. Over time, Jambo started to favor you over Schlatt. He hated it. (He secretly loved it)
I'm too lazy to think of any more so here ya go!! Eat up pookies!!
168 notes · View notes
spicysix · 1 year
Note
📖 + "I think... I'm in love with (Name)" || "Congrats on being the last one to find out" prompt w eddie omgomgomg💗 also congrats on 400 angel <33
thank you my loveee 💖💖💖
here comes, hope you like it! (a little dialogue heavy, sorry for that!)
join the celebration!
Tumblr media
every day for us, something new
"Gonna make some more popcorn, guys! Get the next one ready," you said, getting up from the couch where you were sitting between Eddie and Argyle.
"Get me another coke, please!" Robin, from the floor, asked.
"Oh, get me another beer, sweetums, will 'ya?" Eddie joined in.
"No one else ask me anything, I don't have hands for more!" you exclaimed before leaving for the kitchen.
Movie nights were routine at this point. After all the trauma and the babysitting and the saving the world, the least you all deserved were some fun nights chilling with your friends. Steve or Nancy would host, you'd all take turns choosing movies for the week, and you'd get together to watch and gossip and just be around each other in non-threatening ways. There was no bond like the one created between life-or-death situations.
Eddie's eyes followed you as you walked out of Steve's living room. Jonathan chuckled.
"What?" Eddie asked and Nancy and Robin groaned in unison.
"You are. So. Dense," Nancy complained.
"I don't think he's dense, I think he's just stupid," Robin completed. Eddie hated how she and Nancy came to sharing a single braincell lately.
"C'mon, let's take it easy on our brochacho. The matters of the heart aren't easy," Argyle said, words all considerate but his smirk was nothing but teasing, and Eddie wanted them all to just shut the fuck up.
There was a loud noise from the kitchen, and Eddie was up on his feet in an instant.
"Don't worry, I'm okay!" you called out before anyone could even say anything, to Eddie's relief, and he sat down again.
All of his friends were looking at him funny. What was this plot against him, honestly?
"What's going on?" he asked, waving his arms around in annoyance.
"Dude. Use a single neuron. You'll understand," Steve advised, letting out a dramatically exhausted sigh.
Eddie just stared back at them, one at a time, for several minutes. Trying to find the answers in one of his friends' eyes, or just hoping to be scary enough to make them tell him at once.
"I can't do this, he's the dumbest man alive," Jonathan said after a long while in silence.
What were you even doing in the kitchen for such a long time? Popcorn gets ready in like, five minutes.
"He's never been in love before, maybe he just doesn't recognize it," Steve pitched in, and he knew that information because Eddie had told him once.
What did it have to do with anything?
"What does being in love has anything to do with this? Who's in love here? No one's in lov-" he started, and then he stopped.
Thought about your smile, and that funny little laugh you saved only for his stupid jokes. The way you'd hug him tighter and longer than everyone else. The way you and Robin shared perfumes, a fragrance he didn't really like much, but on you he'd love - something about the way it'd interact with your natural skin smell, and it intoxicated him in the best of ways. He thought about how soft your skin was, and how he loved when you ran your fingers through his hair. He thought about how he thought about you first thing when he woke up, and he thought about you last thing before sleeping. How he thought about you even when asleep - how he'd dream of you, and him, your hands clasped together, your lips on his.
"Oh my god, I think I'm in love," he muttered.
"Congrats on being the last one to find out," Nancy answered. He just looked at her, freezing, hands trembling a little. "What are you thinking about so much, just go!" She nodded at the kitchen and, once again, Eddie was up on his feet in an instant.
He practically ran to the other room.
"Steve, your cabinets are a nightmare," you said, back turned to the door as you heard steps.
"Not Steve," he said, and you turned to face him. That smile, the one reserved just for him, on your lips.
"Eddie! Here to help me? Does anyone want something else?"
He just shook his head and walked closer to you. Took your hand on his, and your skin was just as soft as he thought about constantly.
"Is everything okay?" you asked.
He nodded, "Yeah, just came to a realization."
"Care to share with the class?" your words all teasing but your smile was nothing but sweet. He wanted to kiss you.
"I want to kiss you," he said out loud.
Your smile grew wider, "Well, do it, then."
And he did. And it was so much better than in his dreams. Yous lips were soft and tasted of whatever soda you were drinking, and your hands craddled his neck and you sure could feel his pulse going a million miles per second. But he didn't care, because you seemed eager for more, tongue poking at his lips and he let you in, and it was like fireworks exploding inside his head. He feelt fuzzy, and warm all over, and the happiest he's ever been. Because he's in love with you, he realized, and he was kissing you and you were kissing him back.
It felt like years before you separated, both panting a little.
"Oh, man, I like you so much," you mumbled, lips still almost pressed to his so he feelt every vibration in each of your words. It tingled him, head to toe, in and out.
"That's my realization," he responded, and you gave him another peck, and another one, and you were kissing him again when you heard steps behind you.
"C'mon, slow lovebirds, where's my damn popcorn? I wanna watch the sequel!" Robin showed up, picked up the popcorn bowl and her coke before leaving again.
You and Eddie laughed, and you gave him another peck, and another one, and you were kissing him again.
Neither of you got to watch much of the sequel.
1K notes · View notes
bloodyjuls-blog · 6 months
Text
Im gonna fight for both of us
P4
Tumblr media Tumblr media
So here we go with part 4, sorry it takes me too long but I'm working and hate work haha...
When Alexia entered the hospital she had no idea what she would find there, in one hand, she could find y/n awake but with some tiny injuries (it was what she wished) but what she found was a nurse informing her that they needed someone to give consent to perform an emergency surgery because y/n's accident is a serious life threatening emergency and Alexia knew well, the only person who could do that was your sister, she had the obligation to call her and inform her, she didn't bother to call your parents because she knew that you were not the most beloved daughter in that family, moreover, she knew that they wouldn't even miss you if you died, because she heard many conversations with them in which they clearly told you that you were a failure.
While Lilah, your sister, gave the authorization over the phone, the doctors explained to Alexia what had happened to y/n. First, when they arrived at the hospital y/n went into cardiac arrest due to the impact, then doing a general sweep they found cervical and spinal injuries that compromise her mobility, hence the emergency surgery. What worries them the most is the injury of her brain, apparently it has a severe inflammation and they are concerned that when she wakes up (if she does) she will have compromised her cognitive functions such as speaking, moving, remembering things, most likely she will have memory loss.
When her sister arrived at the hospital she was furious, how was it possible that y/n was drinking again and doing these things as irresponsible. Alexia got angry and said a few things to her.
"Look, I don't think that looking for blames is the solution, what I think is that we should support each other without blaming in favor of y/n not dying, because I swear that if she dies I am going with her, you don't understand the things she was going through, and being honest neither did I, and if looking for blames then blame me because I was the one insisting" Alexia said. "Insist on what, what did you say Alexia" says y/n's sister "I insisted so much on the idea of starting a family, having children, that without those things I couldn't continue with her, that all this time was lost, but I swear it's not like that, it hurts me a lot to know that probably the only thing she heard from me was that while she's always being the loveliest person she is told me that for her the family was me and she didn't need children while she was with me, you don't know how much I regret it." Says Alexia crying and Lilah just approached and hugged her. At the end of the day their relationship is very close. "Ale calm down a little and come let's sit down, I think I understand why y/n is like this with the family thing and maybe when y/n wakes up it will kill me because it's something she didn't want you to know" lilah says calmly. They settled into the waiting room chairs.
"Since she was very little, my sister has always been the black sheep, the daughter that nobody wanted, the girl that when she had the opportunity to left home she did and never came back, you know Alexia when my sister left I was very sad but as an older sister I always saw the mistreatment and never said anything, she stopped going to so many events, so many Christmas reunions, so many birthdays or things like that because she simply knew that they didn't want her, they didn't show it love of support, the only thing that accompanied her in her gray days and well not so gray, was her bottle of whiskey, what can you ask from a teenager who has social pressure for what she does and no support or family that can tuck her in and tell her that everything will be okay" says the sister between soft tears. "I didn't know that, I thought that since she was also getting along with you..." Ale said remembering the phone calls from your parents.
"Of course Ale, you more than anyone knows that she is not one of those people who scream her problems and plead for help, she didn't want you to see her as something weird, that's why she gets along so well with your family, she found love in you, to feel loved, tucked in by someone, valued, no matter what and luckily your family is just like you, if you see the relationship my parents have with me and have with her you would surely get angry because you and I know what is y/n and how important it is to have her in our lives, Ale I'm not going to lie to you, a while ago I also thought that my sister wanted to be a mother because you know mate, look at how she treats the children, they have a very special relationship, very nice, she is a pure soul, but all her life she has seen examples of how not to be parents, how my mother ignored her and her things, Alexia the fact that my parents are not here is not new, when that 17 year old girl in her peak career broke her cruciate ligament, nobody was there for her, not even to give her a bottle of water, and because of that and more things is that y/n is super strong and every thing she sets in her mind to do she achieves it. For many years it was just her against the world and she has lived many blows without saying a word, so if she gets out of here you will understand that it will be very difficult, she will need a lot of support because according to what I have been told, her injuries are serious, probably the only thing that keeps her alive is football and she won't can do that anymore" says Lilah calmer. "I swear Lilah when y/n gets out of here things will be different, I would have liked to have this same talk but with her and avoid this bump in our road but life gives some people a lot and others very little, I swear I will be in her way as long as she lets me, that girl deserves nothing but good things and I believe that all the people she has given her love have let her down in a certain way, but just like you, I also want to do well, did you know that at home I have the ring to propose to her? I swear that without it I can't live" says Alexia more calm and confident. "I'm glad to hear that Ale, you two do each other good, please don't lose that, you're all would be miserable for life and that's not what you're all deserve." Lilah said as she gave Alexia a hug.
Hours later
"Relatives of y/n y/l" says the receptionist on the OR floor. "We are" say Lilah and Alexia at the same time. "The doctor is cleaning up but he's on his way here to report his relative" says the girl stoically. "Thank you very much" they both say in unison.
Once in the study room with the doctor....
"Well, I must say that it was a very complicated surgery because we found internal injuries that we couldn't see in the x-ray and that compromised her health, I am not lying when I say that she went into cardiac arrest at least three times and that worries us a lot because it means that her heart is weak. About her cervical injuries I am afraid that only when she wakes up we will be able to know if she has sensitivity in her legs and if she will be able to walk again, but I must admit that because of the blows her spinal cord has been affected, I want to be very realistic with you, if we manage to have a satisfactory recovery it will be very difficult for her to return to her profession, because the high impact can cause definitive injuries, now my colleagues are monitoring her brain signals because in the resonance we saw very few but we can guarantee that there is no brain death, but any sequels will be determined once she wakes up, at the moment she is not in coma but she was not awake either, we have implemented a method of sedation a little strong but I insist she is not in coma, so now later when the entrance to her relatives is authorized you're all can talk to her, in this state she can listen hope so. Of course, the view that you are going to find is very strong, because she is connected to many tubes and intravenous lines, also her external injuries are a little strong and her foot has an external fixator because there was a fracture of the tibia and fibula". Says the doctor super calm but forceful.
"thank you very much doctor, the fact that she is still alive is because of your effort, let's hope that the evolution is positive, sure it is" says Lilah calm and Alexia super scared because she doesn't understand anything. "Well Ale, y/n is not well and there are strong changes coming in her life and the only thing we have left to do is be by her side to make it as bearable as possible, I am not so much worried about her physical injuries but mental then we must make sure that when she gets out of here she gets psychological attention, and have faith that she will get out of this because she is a super strong person, she always has been and this will be just a very fat bump for her, are you ready to see her" Lilah says optimistic. "I don't know, I just know that if I will always be even if she doesn't want me to, it will be hard for me to see her like this but that's okay" Alexia says forcefully. Alexia's phone starts ringing, it's Ana and Leah on joint call.
"Hi girls."
"Hi Alexia, what happened to y/n, did you find her" says Ana worried.
"Girls, y/n was involved in an accident and it's serious" says Alexia with her voice cracking remembering the anguish experienced a few hours ago.
"How???? What do you mean accident and serious????, my goodness" says Leah in dismay.
"Yes girls, apparently her car overturned at high speed on Tibidabo and her injuries are serious, she probably won't be able to play football anymore" "if you want to come I'm sure y/n would really appreciate it" says Ale sadly.
"I'm already looking at flights to Barcelona, I just can't believe it, what a downer girls, I'm so sad" says Leah in tears.
"Ale tells me which hospital you are, I'm on my way" says Ana in a hurry.
"We are in the one near Tibidabo" "now I'm sending you the location, I'm going to hang up, I'm going to go in to see my baby" and Alexia hung up.
Before entering the room Alexia calls the team managers to discuss what happened and they tell her not to worry that everything is going to be fine and that she can take all the time in the world to be with y/n.
Lilah takes Alexia's hand and asks her if she is ready to go in to which Ale nods not so sure....
When they enter the first thing they see is y/n lying on the bed with many tubes everywhere, one coming out of her mouth, IV in her arms, one in her leg and the fixator in her ankle adding the bandage on her head (because nothing can be seen from her spine but that's where her surgery was) a tube coming out of her side, Alexia's heart breaks in little pieces to see her like this, the love of her life lying on a bed fighting for her life....
"Ale, talk to her and hold her hand, so she could feel you are here, with her, while I go make some calls" "Ok" alexia says.
"Hello my love, I know that the last time I spoke to you I didn't say very nice things but I want you to know that they're not true, I was very angry with you, it is that you are a stubborn honey, why don't you tell me your things, my life you are going to be very well. You are going to recover and although everything will be very different I am going to be with your sister and you all the way, you are going to be well, healthy, strong and laughing at life as always, I am sad to see you like this, I don't like to see that you are having a bad time, I only ask you to fight and stay here with me, don't go without me, I love you so much, all the girls are worried, even Leah is coming from London later and Ana is on her way, I'm sure that when they see me they will want to tear my head off for being stubborn, and you should know that I don't mind not having children but as long as I have you, nothing happens. .. We will buy the little house on the beach that we want so much and we will be very happy my love, I cannot do without you, you are my life, you have always been my life, I love you, very much and I will not leave here and go home without you. I love you too much, you can't imagine how much..." Alexia says through tears as she comes over and gives you a little kiss on your uninjured cheek. She arranges the chair next to you and doesn't let go of your hand, trying to give you some human warmth in that cold room. And she falls asleep for a while to the sound of the monitors lulling her to sleep.
224 notes · View notes
mcflymemes · 10 months
Text
PROMPTS FROM THE HUNGER GAMES *  assorted dialogue from the 2012 film, adjust as necessary
i think it's our tradition.
it's been the way we've been able to heal.
i think it's... something that knits us all together.
you were just dreaming.
they're not going to pick you.
try to go to sleep.
i just gotta go. but i'll be back. i love you.
what are you gonna do with that when you kill it?
i was gonna sell it.
now i have nothing.
what if everyone just stopped watching?
it's as simple as that.
i'm not laughing at you.
we could do it, you know? take off. live in the woods.
we wouldn't make it five miles.
i'm never having kids.
guess the odds aren't exactly in my favor.
you keep it. it's yours.
aww, look at you. you look beautiful.
wish i looked like you.
as long as you have it, nothing bad will happen to you, okay? i promise.
freedom has a cost.
this is how we remember our past. this is how we safeguard our future.
you're stronger than they are. you are.
they just want a good show. that's all they want.
whatever you do, don't let them starve.
you know if you don't want to talk, i understand. but i just don't think there's anything wrong with getting a little bit of help.
so when do we start?
know, in your heart, that there's nothing i can do to save you.
you made me spill my drink.
i think i'll go finish this in my room.
you'll freeze to death first.
can you pass the marmalade?
you really wanna know how to stay alive? you get people to like you.
are there any surprises that we can expect this year?
i'm sorry that this happened to you, and i'm here to help you in any way i can.
you're here to make me look pretty.
i'm gonna do something that they're gonna remember.
don't be afraid.
why don't you go clean yourselves up a little before dinner?
i didn't touch your knife!
i hear you can shoot.
i hope you noticed we have a serious situation.
loosen your corset and have a drink.
i thought they hated me.
don't you know how beautiful you look?
just be yourself. i'll be there the whole time.
i'm prepared, vicious, and i'm ready to go.
do you want to tell us about it?
do i smell like roses to you?
you don't talk to me, and then you say you have a crush on me?
he made you look desirable.
we are not star crossed lovers.
look for water. water's your new best friend.
give me your arm.
we need a signal, in case one of us gets held up.
if you can't scare them, give them something to root for.
everyone likes an underdog.
i'm not gonna leave you.
nobody's gonna find you in here.
we'll just get you some medicine.
i should have gone to you.
i remember the first time i saw you.
[name], you're not gonna risk your life for me. i'm not gonna let you.
now there's no way i'm letting you go.
go on. i'm dead anyway. i always was, right? i didn't know that until now.
it's the only thing i know how to do.
there has been a slight rule change.
one of us has to die.
i'm sorry it didn't go the way they planned.
i couldn't imagine life without him.
they must be very proud of you.
so what happens when we get back?
i don't want to forget.
431 notes · View notes
spookwyrdie · 5 months
Text
Use Your Words
sub!Seungmin x dom!reader
word count: 7.8k
summary: When a secret about your former life is revealed during a game of 'Never Have I Ever' at a house party, Seungmin has a whole identity crisis in the bathroom. He's never been submissive before…but maybe you can help him out with that.
genre: smut, college AU, gentle femdom
warnings: alcohol, adult dialogue, sexual content, dom/sub dynamics, gentle femdom, a little hurt/comfort, oral (reader receiving), bathroom sex
a/n: this is my first ever fic and I'm a big nervous baby about it!
(⁄ ⁄•⁄ω⁄•⁄ ⁄)⁄
I have only posted this here and on AO3 - user: spookwyrdie
Another bottle clinks onto your kitchen counter as Seungmin finishes off his third beer of the evening. He hasn’t even been in your small apartment for an hour and he’s already three drinks in, trying to submerge his foul mood with alcohol. He stands in your small kitchen, staring blankly into your living room. It’s a postage stamp of an apartment, so the few bodies that occupy it felt overwhelming with you glowing in the middle. God, she looks good, Seungmin thinks to himself and his expression sours. He couldn’t take his eyes off you if he tried - and oh, how he has tried. 
Chan and Minho flank you during some sort of banter Seungmin can’t hear, but he’s aware of your every move. The way you place a hand on Chan’s arm, the way you swat at Minho’s shoulder, the way your face lights up when Felix joins the conversation - you’re so animated! The buzz in the room is charged with a comfortable charm you seem to bring with you everywhere you go. Watching you flit around the room, chatting and checking on everyone at your own party makes Seungmin feel so invisible standing here like a potted plant by your kitchen sink. 
“You’re gonna burn a hole in her if you keep staring like that,” a voice whispers into his ear. 
Seungmin jolts and snaps back into the present to find Changbin at his shoulder with a smirk on his face. 
“What? What are you talking about?” 
Changbin shrugs his thick shoulders, muscles straining against the material of his black shirt, “Staring daggers at someone at their own house party is considered a dick move, that’s all.” 
“Whatever,” Seungmin mutters as he opens the fridge again to grab yet another drink. The cold of the refrigerator helps soothe the strange hot sensation he’s feeling in the pit of his stomach. 
At that moment you bounce your way into the kitchen. “Everything okay? Do you guys need anything?” 
“Only your presence, y/n,” Changbin grins and flutters his eyelashes at you like a princess. 
“Aww, Binnie you’re so sweet!” You pinch his cheek and coo at him like a baby. Seungmin buries himself in the fridge, shielded from this exchange. The last thing he needs is to witness you being cute and touchy with the other guys in front of him - he hates it. He’s been aware of your talent for captivating anyone within 15 feet of you since he first laid eyes on you in your shared lecture hall.  That day the air hummed with electricity when you got up to introduce yourself - your voice, your humor, your smile, made everything light up in Seungmin when he first saw you. It was effortless and he hated that he was drawn in so easily. 
“How about you Minnie, searching for Narnia in my fridge?” 
You’re suddenly next to him, gently place your hand on his shoulder as you turn all your attention to him. The warmth of your hand through his shirt sends a zing down his spine. He grabs the first bottle he sees and turns to look at you. You’re so close to him he starts to feel crowded. Your eyes are sparkling in the low warm light and the mild herbal scent of your perfume renders him mute. The weight of your eye contact presses into him, a look of delight tinged with concern on your face. There’s no way all that attention is directed towards him, yet here he is, cemented to the floor by your eyes. 
Just then, the front door bursts open - thank god for the distraction. Seungmin doesn’t know how long that silence would’ve been otherwise.  
“The party is finally here, y’all!” Jisung’s voice rings out. He’s got his classic smug smile on his face and a huge glass bottle of amber liquid. “I brought some whiskey, so it’s time to get down to business!” 
“What sort of business did you have in mind, Ji?” you ask as you meet him at the door and drape your arm around his shoulders. Jisung beams at you, his unoccupied hand finds your waist, easily tugging you to his side. 
“Obviously the party game kind, duh. Never have I ever! Y/n, we’re gonna need all the shot glasses you own,” Jisung pecks you on the forehead and you giggle. It’s enough to make all of the muscles in Seungmin’s stomach lurch. 
~~~ 
It started off innocently enough, a couple of “never have I ever gotten a tattoo” “given a fake number to someone” “flirted with a teacher” so everyone in the room was glazed in the warmth of liquor. It had been a while since you had let yourself drink like this, and it felt nice to feel safe around everyone enough to let your guard down a little. The only sore spot was Seungmin across the room - silent, avoiding your eye contact when you refilled his glass after every time he took a drink. His cheeks were starting to get rosy under his dark hair, but he seemed a bit too sullen for your taste. You really wondered if he even enjoyed being here, maybe he was dragged along by one of the other guys. 
“This is boring, I don’t need to know if any of you have ever worn your underwear two days in a row, Jeongin,” said Hyunjin. “Gross, by the way.” 
“That was one time, and I didn’t have a choice, fuck off!” Jeongin spluttered next to you. 
“Whatever, I wanna get to the spicy shit. Never have I everrr…” Hyunjin paused, looking around the circle with the devil in his eyes, “choked someone during sex.”  
Everyone froze in place for a split second while Hyunjin scanned the room with a sly grin on his face. Damn it. You had skated by for a while now without anything kinky coming up in conversations, so it wasn’t like you needed to talk about it. Were you really about to open up about that aspect of your life with these guys? They still didn’t know you that well, you had no idea how they’d react. Taking a steadying breath, you reached for your drink - at the same time Han and Changbin grabbed theirs. All eyes were on you though as you lifted your small glass in the air to clink it with the two other degenerates taking a shot with you. Your eyes flitted nervously around the room trying to gauge the reaction. Most eyebrows were raised, Changbin smirked with his little downturned smile, Han winked at you, but the one face that you landed on was Seungmin - mouth agape, eyes glazed over, frowning off into space. Oh no… Is he judging you?  
“Well, I’ve never been the one doing the choking,” Felix says, breaking your concentration on Seungmin’s gobsmacked expression. “I never pegged you as someone who’d be into that, y/n!” 
“Speaking of pegging,” Minho interjected, “Never have I ever been pegged!” 
A groan went around the room as Chan, Felix, Hyunjin, and Han all downed another shot. 
“He always uses that one when we play, it’s unfair!” Felix pouts.  
“It’s not my fault that I can tell who’s a pervert just by looking at them.”  
“I want to know more about y/n and the choking thing though,” Han says, his eyes roam your body. “What other sort of stuff have you gotten into?” 
“Ah-ah, that’s not how the game is played,” Chan says. “You have to say a ‘never have I ever’ if you want answers.” 
“Fine! Never have I ever…gone to a BDSM club.” Han narrows his eyes as if challenging you. You cock an eyebrow at him as you grab your glass. Your old instincts kick in to emanate a cool confidence even though your heart rate skyrocketed. You may be anxious but you’re not one to back down from a silly little power play like Han was throwing out there.  
You reach for the bottle to refill it, but a hand snatches it away, tilting it into your glass to fill it for you. You find Seungmin, eyes downcast, bottle in hand.  
“You were gonna spill…” he mumbles. 
There’s that feeling of electricity running through the room again, a low buzz that vibrates under your skin and runs down to your lower belly. Seungmin and his attitude have a way of bringing out the dominant energy you used to wield - a possessive hunger bubbles through you.  
“Never have I ever done anything with rope bondage!” Hyunjin blurts out, eyes locked onto your face. 
A nervous giggle escapes you again as your old lifestyle is apparently in the spotlight right now. You’re about to move to grab the bottle from Seungmin to pour yourself yet another shot but stop - Seungmin seemed really eager to do this for you. Who are you to pass up the opportunity to mess with him a little? 
You make sure your eyes catch his, your gaze hooded yet intense - you tap your shot glass with your finger, gesturing for him to pour. His grip tightens around the bottle, cheeks redder than before as more of that amber liquid flows into your small cup. It’s like time slows down for a moment and you feel yourself entering that old headspace, exhilarated by being bossy and making someone squirm just by looking at them. His eyes flit back and forth between you and your drink, conflict tinges his features. He’s got a wrinkle between his eyebrows nearly hidden by his hair that you want to smooth out with your thumb. Your face feels hot as you raise the glass to your lips and toss back yet another shot. 
Hyunjin lunges at you after you down your shot, grabbing your shoulders and accidentally knocking over a few empty glasses on the table, “Tell me everything! Where did you learn? What sort of rope do you use? Are you a rope top or bottom? Can you show me?!” He’s so excited, he ends up shaking your shoulders as you laugh. 
“I’ve been doing it for a few years! I mostly use natural jute or hemp! And I only top!” you manage to get out between giggles.  
“Oh, do we have a domme in our midst?” Changbin says, a lecherous look in his eye. The rest of the room seems to wait on edge for your reply. 
“I mean, sort of. I haven’t done it in a long time, especially since I moved away from the old studio I would work at sometimes,” you sheepishly admit. You can feel your heartbeat in your throat at this admission. Opening up to people about this could go vastly different directions - either everyone would embrace it or they would cast you aside. Bringing up not only your kink experience but your history of dabbling in sex work wasn’t exactly conventional. The whiskey in your belly would soften the landing for you either way. 
“Work at?” 
“So like…professionally?” 
“What sort of stuff did you do?” 
“What kind of domme are you?!” 
“Can you tie me up sometime?!” 
The voices overlap and swirl around you, you’re comfortably tipsy and beaming with the new trust you feel towards this group of beautiful idiots. They’re all shouting their questions at you in rapt attention - everyone except Seungmin, who looks like he’s been slapped in the face.  You hush them all with a finger to your lips. 
“I was semi-professional, but like I said, I don’t really do it anymore. Things got a little…complicated at the end there. Emotionally, I mean.” you say. The boys are all fascinated by your revelation. The din of chatter swells up again and you do your best to answer all their questions. You get crowded as you laugh your way through explanations of safety, how you kept your professional and private lives separate, what sort of gear did you own. They’re rabid for answers. As the chat bounces around the circle, you look over to check on Seungmin. But between the noise and the kink jokes and the questions, there’s an empty spot in the circle. 
Seungmin isn’t there.  
~~~ 
Fuck. 
Seungmin grips the edge of the sink with white knuckles. What was he even doing back there? Why did he want to pour your drinks? What are these weird feelings stirring in his stomach right now? That stupid drinking game - he’s gonna kill Han for even suggesting it. The way everyone fawned over you already made him sick to his stomach but finding out that you do all those things, have all this in depth experience with choking, bondage, domming…. 
Finding out that you have done all the things that Seungmin has only ever let himself dream of late at night, all those ideas about kneeling in front of someone who takes charge, he’s never felt so exposed! The way you looked at him when he poured you that drink, he felt like he was strung up and writhing in front of you like your next meal – and he liked it. He hated that he liked it. Hot tears welled up in his eyes over the fact that it was so easy for you to just unravel him like that in a matter of seconds. He had felt his cock twitch just from sitting across from you during the game and all he did was pour you a drink and look at you in silence. 
He slides down the wall in your small bathroom, rubbing his eyes furiously. He wanted you so much in that moment while shame and desire curled around his ribs. A person having this much control over him makes him so nervous, and what was worse is he wanted to throw himself head first into it. The way you made him feel, the fierce concentration you had on him in those few seconds, was enough to toss himself at your feet and grovel. 
He feels trapped within himself, like he’s being forced to confront what he really wants. He wants to be held, told what to do, made to cry, brought to the brink over and over again until he’s delirious. He wants to fall and know that there is someone strong enough to catch him. Putting that sort of faith in someone is terrifying. 
That’s why he hates being around you. You have this way of exposing all the sensitive little things within him until he can’t ignore it anymore. Seungmin usually ignores this submissive feeling, it’s so fucking embarrassing. He knows how others would see him, so he tends to stay quiet to avoid it. Many find him intimidating given his streak for brutal honesty. The people he’s dated in the past have all been attracted to him for his sharp wit and cutting tongue. Many have wanted him to take charge and he happily obliged them at the time - at the cost of his own desires. If he didn’t bring them up then he wouldn’t feel vulnerable - problem solved, right? But all that has come tumbling down because of you and your eye contact.  It’s like you melt all his icy defenses with just your gaze. He can’t imagine what it would be like to actually have you towering over him, directing him, binding him. It’s almost too overwhelming to consider. Even thinking about this, he feels himself growing hard at the thought of you being in control.  
Watching you have the time of your life with the group has a way of making Seungmin so small.  You’re the newest addition to this dynamic and he doesn’t know how to place you yet, so he keeps you at a comfortable arm's length. His defensiveness has gotten more pronounced lately and it’s starting to fuck with his friendships with the other guys. His jokes have gotten a little meaner, his tone has come out a little too harsh. He can’t keep feeling bitter because you’re so sweet with them, but he’s filled with vivid envy any time you so much as look at one of them.  
These past few months he’s watched you seep into his solid circle of friends, naturally slotting yourself firmly in as a charmer in the group. Seungmin has been watching you as you get closer with the other guys, openly affectionate, doting on them, giving attention freely to any of them that asks. You show your care to the others so easily and Seungmin feels forgotten. To you, he’s just an afterthought. Tears prick at his eyes yet again as he buries his head in his arms. 
A knock on the door shakes him out of his spiral. 
~~~ 
The chaos of your domme confession has ebbed. You sneak out of the living room as the boys got distracted by other things - Chan and Changbin hover in the corner over the music selection, Hyunjin showing Felix and Jeongin pictures he’s saved on his phone of shibari suspensions, Han leaning on Minho’s shoulder as they bicker about who’s cuter in a drunken affection war. You tip-toe your way to the hallway and knock on the bathroom door that’s been closed for a while now. 
“You okay Minnie?” 
You don’t get an answer, but you hear some shuffling noises, so you try again. “Are you in there? Can I come in?” 
After a pause, you hear a muffled “yeah” in response. You slide into the bathroom, closing the door quietly behind you. Seungmin is sitting on the floor, knees drawn up towards his chest, staring off into the distance. You step over to him, gingerly placing your hand on his head, stroking his hair lightly. 
“Feeling alright? You look like shit.” 
He jerks his head away from your touch, his face crumpling into a frown.  
“I’m fine, thanks.”  
“You’re not fine, you’ve been in here for ages. Did you get sick?” 
“No, just needed to splash some water on my face,” he says, not looking in your direction. 
“Me and the guys miss you out there.” 
He scoffs “you and the guys? Yeah, of course. Always you and the guys.”  
“What’s that supposed to mean?” 
“Nothing! Forget it. I’m being stupid,” His voice trembles. “Just leave me alone, y/n.” 
He doesn’t move and you kneel down beside him.  
“I brought you some water.” 
“Don’t want it.” 
You sigh, annoyed by the pout that’s on his face. “Come on, baby. You can either tell me what’s wrong or drink this water. Which do you choose?”  
He says nothing, only shrugging his shoulders. 
“You’ve been crying.” 
Silence. 
“You should always drink some water after you cry. You’ll get dehydrated if you don’t.” 
He turns towards you then, defiance infused in his gaze. 
“Make me.” 
Make me.  
It’s like a trigger word for a sleeper agent. Your body reacts before your mind can catch up, fueled by the alcohol still thrumming through your system. You uncap the water bottle and cautiously grab his chin. You pause, eyes locked on his, giving him ample time to push your hand away, to deny you. Instead, he gives you the smallest nod. Your thumb grazes over his bottom lip as you lift his chin and bring the bottle to his lips. Your other hand snakes to the back of his head, gently grasping the hair at his nape. Tilting his head back, his eyes burn through you as he sips the cold water. He blinks back the tears in his wide eyes as his face tinges pink. Seungmin slowly leans into the hand cupping his jaw. He leans his head forward slightly when he’s done. Your thumb ghosts over the wet spot on his lip and he sighs. 
“You gonna tell me what’s wrong?” 
“I just…-” he starts, as a tear slips down his cheek. “I just wish you liked me like you like them. It’s fine that you don’t, I know I’m…not easy to be around.” 
Confusion sets in as you tenderly wipe the tears from his face, both hands cupping his face like handling something fragile.  
“That’s not true, I like you, Minnie.” 
“You don’t have to lie to me. I see the way you look at them.” 
You frown at that. “What way do I look at them?” 
“Like you enjoy being around them.” 
“I enjoy being around you, too. I bet you’d enjoy me more if you let me in a little.” Your hands leave his face, trailing down his arms to grasp at his hands, almost pleading. The desire to be close to him has always been there. With his soft hair, sharp eyes, his acerbic sense of humor, how could you not? But any time he looks at you, he goes blank. You’ve been in his orbit for long enough to know how to encompass him, but you don’t know how to close the distance between the two of you. 
But something happened tonight, something made him get up and leave while you were being bombarded by questions about your past. Was it all the talk about kink that made him run?  
It’s quiet for a moment. He studies your hands as you gently run your thumbs over his knuckles. You break the silence with the only question on your mind. 
 “What made you leave earlier?” 
~~~ 
He never imagined how soft your hands would be on his. The little circles you were rubbing over his knuckles could drive him insane. Holding your hands like this gives him a great excuse not to look into your eyes, because when he had done it earlier and you said all those nice things about him to his face, his brain short circuited. You have him tethered by the hands, the one thing keeping him grounded while the rest of him floats out of his body.  
“I-” he croaks out, but he couldn’t get the words to form. He doesn’t even know what to say. Images of you as a domme - his domme - spin around in his head. You just told him that you enjoyed being around him and he was supposed to be normal about that? Guilt drips into his stomach at that, knowing how he has pushed you away every chance he got to protect himself. But here you are, checking in on him, doting on him, holding his hands even when he has offered you nothing but a cold shoulder for so long. The silence stretches out the longer he lets his thoughts spiral. 
You start to move, to pull away, and panic roars to life in his chest. You are finally so close to him, he can’t let that go! He snatches your fingers, pulling you back down towards him. “Wait! Don’t go yet!” 
Your expression flows from surprise to confusion to…wary? He can’t let you leave. Your voice is a low murmur, and your eyes drop to your entwined fingers. 
“Be honest with me Minnie… Does the domme thing scare you?” 
“No!” he blurts out. “I mean, it doesn’t scare me in the way you think.” 
“How does it scare you then?” Terse and authoritative, your demeanor shifts in an instant. “Elaborate.”  
Seungmin feels like his chest is about to burst open. He has two choices. He can either cover up his desires and hide them like he’s done for so long - push you away, and continue being miserable in the familiar way he has gotten so used to. Or, he can crack his shell for you, open up, do a trust fall and hope you catch him.  
He decides to fall. 
“It scared me because it’s something I’ve wanted for so long. I’ve been scared to talk to anyone about it.” 
“Wanted what? Use your words.” 
The dam inside him finally bursts.  
“I want to… I want to let someone else be in charge. I want somebody to tell me what to do, hold me down, fuck me, make me cry, tie me up, ANYTHING! I want to be praised, I want to be punished, I want it all! Finding out you have a past with that scared me because you’re already so beautiful, it’s intimidating. I’ve been watching you for so long and knowing now that you are a domme means I can’t... I can’t-” he chokes out, squeezing his eyes shut in embarrassment. A blush stains his cheeks, this confession burning through his entire body. 
“Can’t what?” Your voice is softer now, almost a purr. He finds you so close when he opens his eyes, he’d only have to lean up a little bit to kiss you. He starts to move towards your lips, but you pull back at the last second before he’s able to connect. You place two fingers on his chin and tenderly push him back. “Use. Your. Words.” 
“I can’t ignore how you make me feel.” 
~~~ 
You want to devour him. He looks so pathetic in the exact way you love a man to look beneath you. His nose and cheeks are pink, his eyes are wet and bright, and he looks so desperate for you. If this is how riled up you can get him without even touching him, imagine what it must be like when he’s tied down and overstimulated. You want to see him messier than he is now, begging for it. You want to see if his cock gets as red as his crying face does when he’s been edged for an hour or two. Even now, he’s leaning up towards you, hungry for a kiss - you hover just out of the way. That’s something that he’ll have to earn. 
“So, you want to submit to me?” you croon at him. “You want me to take control, make all the decisions?” 
He nods with his big wet eyes. Your hand slowly slides from his chin to the back of his head, cradling for a sweet moment before you grip onto his hair and give a quick tug. The moan that drops out of his mouth when his jaw slackens from your grasp is melodic. “What did I say about using your words?” 
“Y-yes please,” he stutters out. Your eyes appraise him, slowly raking over his form. You see the outline of his cock straining against the denim of his jeans. 
Your feelings are beating around inside your chest erratically. You haven’t indulged in your dominant disposition in such a long time, it shakes through you. The way your body reacts to him as you steer his movements speeds up your heart rate. Does he know how much you want this and how nervous you are? He’s obviously turned on, sure. But you’ve both been drinking, and this is the longest direct conversation you’ve ever had with him.  
Wait…. Is he making fun of you? You’ve watched him mess with the other guys, he’s a natural at playing the long game when it comes to the way he fucks with them. Sometimes his jokes leave a sting for others that’s hard to see coming. 
Abruptly, you lean back, disconnecting your body from his completely. He whines at the loss of you and your warmth, a panic stricken look on his face. 
“I haven’t done that in a long time, Seungmin. I don’t take this lightly and I don’t do this with just anyone. If this is a joke, tell me now.” You stand and try to calm the nerves roiling through you. 
He scrambles to his knees, catching your wrist. “N-no! Y/n, I’ve wanted this for so long.” He looks up frantically at you, grasping at you fiercely. “I would do anything for you to show me what being a submissive is really like…” 
You stare down at him, on his knees in front of you, a wide eyed yearning painted on his face. You hold his cheek again, thumb grazing over his skin as his eyes flutter closed. His lips slightly parted, he sighs into the touch. Kneeling, he’s like a sinner accepting salvation merely by your hand holding his face. A silent devotion blossoms on his face in this moment of intimacy.  
You revel in him like this, trying to burn this image into your memory. Your thumb trails over his lips, barely making contact. He turns tentatively, mouth open, and envelops your thumb in the warmth of his mouth. Rooted to the very spot, a sensual weight blooms in you, settling somewhere deep in between your thighs. His hands clutch the backs of your legs as his eyes open and find yours, eager but careful. You gasp as you feel him draw your thumb further in, sucking it into the hot velvet of his mouth, rolling his tongue around it. His eyes lock on yours, molten desire jolts down your body, heating you up from the inside. You feel like a live wire, glowing. He’s open for the taking, a gift of service and sacrifice waiting for you to grasp. His eyes narrow in a wicked grin, watching how he affects you. 
Mine.  
The thought slams through you as your thumb curls into his cheek, hooking the flesh there and gently stretching his mouth open to one side, exposing the edge of his teeth. From here, your thumb slides back into his mouth further. This subtle gesture of control - a sort of test to see how you two mesh. To your delight, Seungmin is happy to oblige, taking the digit in as far as he can into his mouth, laving his tongue on the pad on your thumb. His hands start to roam around your lower body, traveling up from your thighs and around to rest directly beneath your ass. You realize in this position that his mouth is at the exact same height as your cunt, and you clench at the thought of his tongue on you. 
“Wait - before we do anything, do you know the stoplight system?” 
He nods vigorously.  
“Yeth,” he says, remembering to use his words with your thumb still in his mouth.  
“Good.” You pop your thumb from his mouth and cradle his face in your hand. You lean into him and whisper against his lips, “Do you trust me?” 
“Yes, y/n,” he pants. “I trust you.” 
You hang there, poised above him, listening to his little whine of impatience. Watching him struggle to control himself is a marvel, you feel him start to grip your legs tighter. Those big sparkling wet eyes bore into you - you almost miss what he whispers. 
“Please, y/n-” 
~~~ 
Physically, he’s on his knees, face in your hand, captivated by how your simple gestures have him on the edge so quickly. He hasn’t gotten hard this quickly in years, he can feel his heartbeat throb between his legs. You haven’t even kissed him yet! Mentally, he is on fire, all his thoughts are both screaming and silent at the same time. You are the one thing keeping him in his body, so he feels every touch tenfold, every pull, every breath. The way you’re suspended above him now has him holding his breath, anticipating your next move. He’s never been so nervous and so ready for the unknown. 
Your lips collide with his, a tidal wave of feeling, sensual, overwhelming. Your lips are soft yet demanding, your hand in his hair guiding his head to the position you want it. There’s an ebb and flow between you two. He matches your speed, your movements, your direction. He gets lost in the feeling, letting his body react to yours, falling into that trust naturally. You’re so good at coaxing the little noises out of him that normally he’d be embarrassed by - the kind of noises that would make him clamp his hand over his mouth when he’s all alone with his fantasies. He feels himself rocking his hips back and forth, rutting against nothing, seeking any sort of friction. 
The material of your jeans slips under his fingers as his hands begin to move around your form again, trying to learn your shape. They come to rest on your waistband, hooking his fingers under to drag them down. Your hands find his, pulling them together in front of him. “If you want my pants off, you have to do it with no hands.” 
Seungmin clenches his fists and places them on the tops of his thighs, determined to keep them there. You straighten above him, hands in his hair, raking your fingers against his scalp. His shudders and his head lolls back, absolutely drunk on the bliss of your fingers. He snaps forward when he realizes there’s something he wants more - he wants you on his face, in his mouth, coming undone on his tongue.  
His mouth finds the button on your jeans, teeth and tongue fumbling to undo it. After a few attempts and one savage tug, the metal button clacks against his teeth, free from its holding. He’s quick to find the zipper next, biting down and dragging slowly, grunting with effort. This is much harder than he thought, especially without the help of his hands. The zipper finally hits the bottom, and your waistband loosens.  
One of your belt loops is the best way he can think of to pull off the main obstacle separating him from what he wants. He grabs it with his teeth and tries to tug it down, but the position he sits in makes it difficult. He tries a few more times, determined to get your pants off with his teeth, growling with frustration. You chuckle above him, watching him struggle. 
“Here, let me help,” you say, and you slide your jeans down your thighs at an excruciatingly slow pace. Seungmin trembles watching you, transfixed by your black panties. After you finally step out of your jeans and toss them to the side, you stand in front of him again. He automatically leans forward, wanting nothing more than to bury his face between your thighs. 
You place a hand on his forehead, forcing him to sit still. He whines, pressing against your hand and you laugh. Your hand trails down to his chin and you lift his face up as you swoop down for another long kiss. This one is sweeter, Seungmin can feel it wash over his whole body, all the way down to his toes. When you straighten this time, he leans forward cautiously, waiting for your command. You look down at him expectantly, and he closes the distance between his face and your cunt.  
At first, he just sits there, running his nose through the arousal that’s seeped through your panties. He’s elated to find you dripping, just as turned on as he is from all of this. He feels his cock jump in his pants, and it rubs against the seam of his jeans. Mouthing over your clothed cunt is ecstasy, Seungmin’s eyes roll to the back of his head at a taste of your essence. He can’t take it anymore, his instincts take over and he hugs your thighs. His body lifts you up as he turns to press you against the bathroom wall, his face never leaving your center. You squeak at the surprise of being handled in this way so suddenly, Seungmin is worried he messed up. He flicks his eyes up to meet yours and you’ve got a tongue in cheek grin on your face. 
“I’ll allow it this time, Minnie, but you’ll pay for that,” you lovingly threaten. He smirks up at you from between your legs. 
~~~ 
You are caught between the wall and Seungmin, making a mental note of his sudden bratty turn. He looks up at you from below, pure euphoria on his face, before clawing at the elastic of your panties, yanking them down and tearing them slightly. You swat him on the arm. 
“Whoops,” he says, not a speck of apology in his voice. 
“You’re going to have to replace those, they were some of my fav- '' but your words are cut off as he dives into your bare pussy, tongue first. This man doesn’t give you a chance to finish what you were saying - you couldn’t form a coherent sentence if you tried. The sharp tongue that he has in his conversations can be put to use in other ways given the way he’s stroking over your clit with fervor.  
His hands on your hips press you back into the wall. You whimper, urging him on as your hand grips his hair again and you rest more of your weight on his face. He looks up at you, locking eyes with you as his hand reaches behind one of your legs to lift it over his shoulder. At this angle, he gets better leverage, swirling his tongue over your clit, dipping down to your entrance to gather more of your wetness, and you start to feel an orgasm build in your lower belly. You grind into his face, sliding your cunt over his mouth, bucking your hips as the coil tightens. He cants his hips up, chasing any friction that his suffocated cock can find in his jeans, and he groans into your pussy. The vibrations of his groan resonate through the very center of you.  
You cry out as your orgasm snaps through you, the electric jolt making your muscles convulse as you ride Seungmin’s face. His eyes shoot open in shock, fingers dig into the flesh of your hips as he moans into your cunt, his hips stuttering beneath you. He’s relentless as you ride out your high on his tongue, pulling your body towards him and scrunching up his eyes as his whines reverberate into you. He doesn’t stop until you’re shaking and pushing his head away, too sensitive for any more or you’ll pass out. 
Breathless, you carefully lift your leg down from his shoulder and lean back against the wall, an exhausted smile plastered on your lips. After catching your breath, you look down. 
Seungmin has his head in his hands. He looks so defeated and you drop to your knees at once, panic pounding in your chest. He’s doubled over, hands twisting up in his hair in distress.  
“Minnie, what’s happening? Talk to me,” you keep your voice level like you learned, even though you have dread creeping into your stomach. Did you go too hard on him? Is he regretting this? Oh god, did you push him to do something he didn’t want to do? A million thoughts whizz around in your head as your anxiety builds.  
“I-” he sniffles, looking up at you slowly, red in the face and eyes welling up. “I came.” 
The bathroom is filled with a silent confusion for a split second before you say, “You came? From eating me out?” 
“I came in my pants like a fucking teenager! You didn’t even touch me!” His embarrassment is crashing through him. You gently take his hands in yours and wait until he looks at you. 
“Aw, baby, that’s okay,” you push a strand of his hair out of his eyes. “Actually, I think that’s really hot to be honest.” 
“Huh?” He looks dumbfounded. “You… think it’s hot?” 
“I mean, yeah. You were so riled up that going down on me and grinding against your jeans was enough to get you off?” You grin, a flirty edge in your voice. “You must really like me.” 
“Oh my god…” he groans. 
You pull him towards you and kiss him, tasting yourself on his tongue. He melts into you, soothed a little by your response even though his face is still bright red. You are glowing with the knowledge that he was so turned on that you riding his face overwhelmed him so much that he couldn’t stop himself from cumming right in his jeans, pride swells in your chest. 
“I think you should stay the night. We’ll sleep and then talk tomorrow.”  
Seungmin nods, still sniffling a little.  
“I’m gonna go kick the other guys out. You stay here and get cleaned up.” 
After disposing of your ripped panties and putting your jeans back on, you quietly head back out to the living room. All heads turn towards you with amused looks, waiting with bated breath. 
“Hey guys, Seungmin isn’t feeling very good, so he’s going to stay the night here. Basically, the party is over,” you can’t hide your blush as you feel every gaze take in your fucked out appearance. Your hair is a mess, your cheeks are flushed, and your eyes are a little too bright for a normal conversation. 
“I don’t know, Minnie sounded like he was feeling pretty good there a few minutes ago,” Changbin says with a smug smile. 
“Yeah, and it didn’t sound like he was the only one either,” Han leers at you, looking you up and down. 
“Fucking FINALLY,” says Felix. “I couldn’t stand how mopey he was getting about you. I’m glad you banged it out in the bathroom.” 
You’ve learned over the years to keep some composure when it comes to these kinds of situations, but your jaw still drops at Felix’s blunt comment. It’s also nice to know that Seungmin’s been thinking about you for a while. You grin sheepishly at the boys, hushing them up and gesturing to leave.  
They all start to stand and gather up their stuff, quietly snickering about what they heard.  
“Y/n, you gotta tell me…” Hyunjin comes up to you to whisper, “who was it that was making the most noise in there? Someone was having the time of their life, was it you or him?” 
You smack him lightly on the arm and laugh. “Get the fuck out of my house, Hyunjin,” you say, and toss a wink at him for good measure.  
Everyone says their goodbyes and pokes a little more fun at you. They’re all good natured and maybe you’ll spill about it later, but first you have to go take care of the fragile man sitting in your bathroom. 
~~~ 
Seungmin has never felt so happy and so awful at the same time. This was a night of firsts for him - first submissive experience, first time having someone ride his face like that, first time cumming in his pants as a full grown adult. He’s never been wound that tight during any sort of sex before, which is throwing him through a loop. The strange shame bubbling in his blood right now from premature ejaculation is hard to bear right now. What’s even more confusing is your reaction to it. You look genuinely flattered by it. He was expecting you to degrade him (not in the sexy way) and kick him out. His head was still swimming with a little inebriation, but he felt solid in all the decisions he made tonight, especially making you lose control on his face like you did. The sense of pride from that swells in his chest as the shame takes a back seat. 
He focuses on cleaning himself up for the time being. Once he hears the rest of the guys shuffle out of your apartment, he sneaks out of your bathroom and into your bedroom. It, like the rest of your place, is pretty small but comfortable. You have a queen bed in the middle of the room and there’s a nice cozy vibe to your decor. 
You knock lightly on the door before coming in. 
“Hey,” you murmur. Seungmin can sense your nerves by the way you’re standing in your own doorway. 
“Hey,” he replies. 
After a moment, you close the distance between you and Seungmin, grabbing his hands and looking up into his eyes shyly. The way you’ve switched from controlling, sexy domme to bashful and quiet makes Seungmin swoon a little. It’s nice to know that he’s not the only one reeling from your encounter and he wants to stay by you as long as you’ll let him.  
You interrupt his dreamy gaze. “I have an extra pair of shorts that will probably fit you, if you’d like.” 
“Huh? Oh, yes please.” 
“I can also throw your clothes in the wash, if you wanted to stay over.”  
He nods, not able to string more than a few words together in your presence at the moment. After he changes, he sits on your bed, waiting for you to come back and the anxiety begins to creep back in. Maybe you’re just being nice, trying to let him down easy after this one-time thing. Maybe you’re trying to cover up the fact that you actually find it embarrassing that he’s so sensitive he couldn’t control himself. He doesn’t notice when you sneak back into the room, his eyes are glued to the floor while his thoughts bounce around the place. 
You sneak up on him slowly as you move to stand in front of him as he looks up at you. Subtly, you shift to stand between his legs, hands coming up to rest on his shoulders. His arms wrap around your middle gently, almost politely. You search his face, gaze darting back and forth between his eyes since he’s so close. 
“Tell me what’s on your mind,” you say in a soft voice. 
Seungmin feels warmer with you so close, wrapped up in you and your scent. He tilts his head back, revealing the smooth column of his neck as he looks away. “You made me feel so good without even touching me, but the fact that it happened so fast is still mortifying.” Fuck, he can feel tears pricking in his eyes again. 
“Sweetie, look at me.” You say it with such soft authority that he can’t help but meet your eyes. “I loved making you feel good, regardless of how and when. You made me feel amazing too. There’s nothing to be ashamed of.” Your hands travel up to card through his hair, his eyes fluttering closed. “If it’s something you’re worried about, we can always work on your stamina next time.” 
His eyes open again, a renewed hope blazing in them. “Next time? There’s gonna be a next time? 
You smile, your eyes crinkling at the corners. “We can have as many ‘next times’ as you want.” 
His heart thuds in his chest as his brain catches up to what you’re implying. He leans up and captures your lips. You deepen the kiss, tongue sliding along his as your hand grips onto the back of his neck. His back finds the mattress as you lean over him, caging him in with your arms. Seungmin’s hands roam around your body, trying to learn your shape. When his hands rest your ass with a light squeeze, you slowly roll off of him. 
“For now, let’s just sleep. We can talk tomorrow about what we need for next time.” You pull him towards your body, snuggling close, hand drifting up his shirt possessively. He shivers at your touch and melts into your embrace. He drifts off with you enveloping him, physically and emotionally, and dreams of what next time will be like. 
226 notes · View notes
mrsshabana · 29 days
Note
Hi girl, just leaving the ask for my emergency request. Tysm again 🫂💖 and don't worry no pressure
𝓖𝔂𝓾𝓽𝓪𝓻𝓸 𝔁 𝓘𝓷𝓼𝓮𝓬𝓾𝓻𝓮!𝓡𝓮𝓪𝓭𝓮𝓻
୨୧ Summary Gyutaro comes home one night to hear you crying in the bathroom. After having a breakdown due to insecurities about your appearance, your demon boyfriend tried his best to comfort you. ୨୧ Content Gyutaro x female!reader, angst, fluff, comfort ୨୧ Note I hope you find this oneshot comforting, and thank you so much for sharing with me and asking me to write this. I really enjoyed it and I hope you do too. Thanks for always being an amazing friend and I'm always here for you ♡
Tumblr media
After a long night of hunting and doing his master's bidding, Gyutaro comes home to you. Your small little house that sits on the edge of the entertainment district. He wishes you could live in the brothel with him but he would never want to put you in that kind of environment. So he settles for visiting you when he can. Usually, early morning before the sun rises.
"Y/N...?" Gyutaro whispers as he climbs in through your window. You're usually awake to greet him but this time he doesn't see you in the bedroom at all. He begins scratching his neck as his intrusive thoughts begin to fill his head.
"What if she's out with someone else tonight?" he thinks to himself.
He clenches his teeth and scratches harder, blood coating his fingertips before his wound inevitably heals. But then he hears something peculiar. Faint whimpers coming from the bathroom.
Quietly walking over to the door, Gyutaro puts his ear against it and listens closely. The sound breaks his heart, it's obviously you crying. He slowly opens the door as to not startle you and whispers, "Y/N... you ok?"
He comes into the room to see you crying in front of the mirror. His first instinct is to check you for wounds but he doesn't smell any blood. Honestly, he's stumped, what could you be so upset about?
Hearing your boyfriend's voice, you immediately begin to panic and hastily wipe your tears away. Trying to clean yourself up and hide the fact that you were just crying alone in your bathroom.
"Oh, um I'm fine Gyu. Sorry I didn't hear you come in," you feign a smile.
He's obviously not convinced as he walks up behind you and puts his arm around you.
"Something's wrong," he rasps, "What is it?"
Gyutaro's never been good with words, but seeing the genuine concern in his eyes as he looks down at you shows you just how much he loves you. And you can't help but break down.
Gyutaro's eyes widen as you cover your face and begin to sob. He's literally never seen you so upset before. He holds you in his arms and nuzzles his nose in your hair. He really doesn't know what to say, so he just comforts you and waits till you're ready to talk.
Once your sobs begin to slow down Gyutaro pulls away and wipes your tears with his thumb, "Whatever's goin' on, I'm gonna fix it. I hate seeing you upset like this."
"Aw Gyu," you sniffle and smile at his want to protect you, "It's not like that. This isn't about something that you can fix..."
"Then what is it? You're just a weak little human - I can fix anything for you," he says with determination.
"I... I hate my appearance" you whimper, "I despise the way I look, and I can't stand it anymore!"
His eyes widen, at a complete loss for words. Throughout your entire relationship, you've been the one to comfort him when he was feeling insecure and hated his appearance. He never once imagined that you may have the same insecurities.
All of the times he scratched his skin in frustration, spewed about how his ugliness ruined his life, and went on and on about how he wished he could change his appearance - you comforted him every time. You were always there for him, giving him words of assurance and making him feel loved. Somehow you managed to make him feel handsome too. You're the only person who's ever managed to do that.
And now here you are, in the same position as him. And it's his turn to return the favor. But you're so good at comforting him. He's never been good at bringing comfort to others, especially when it came to his words. He's always had a way of speaking harshly and even when he tries to be more gentle it doesn't quite work. But you're the love of his life so he's going to try his best.
"D-darling..." he says as he rubs your back, "You know I love the way you look. I think you're beautiful."
"I know you do, but I hate it. My face disgusts me..." you trail off and look at your scarred cheeks in the mirror, "I've done everything to try to get rid of these disgusting scars and make my skin better. I just want to have clear skin like all of the other girls... I don't even care about being pretty, I just want to feel normal."
He stares at you, his mouth hanging open. You just described how he's felt his entire life. From all the time you've been in a relationship with him, he never knew you felt that way.
When he looks at your skin he doesn't think twice about it, he thinks it's beautiful and always has. What you call imperfections just make him love you more. But he knows that simple words won't make it better, because he's heard it all before. How people try to convince you it's not that bad or that you're being dramatic. It's all bullshit, so Gyutaro just speaks honestly.
"I know how you feel, Y/N. I had no idea you felt the same way that I do," he trails off, scratching his neck as he tries to gather his words before speaking again, "You say you wanna be like the other girls, and I get it. But I don't wanna be with a girl that's like everyone else. I like you because you're special. Maybe you hate those bumps on your face, but I love 'em and I don't see a problem with 'em. They make you unique, even if they aren't conventionally beautiful."
You look up at him with tears in your eyes, about to say a rebuttal but he puts a finger on your lips and continues.
"I've always liked things that other people thought were gross or disgraceful. You know that. Maybe you're a little filthy, disgraceful, and pathetic, but so what? That's what I love about you," he grins, showing off those teeth you've always found so attractive, "What I'm tryna say is, all the little flaws that you hate, I love. Who wants a plain canvas with nothin' on it? It only becomes a piece of art when someone slaps some paint on it. That's how I feel about you, you're a canvas full of flaws to make something beautiful."
"Gyutaro..." his words hit you hard. Never in your entire life has someone been so unapologetically honest with you and managed to make you feel better by the end of it.
He could have just spewed compliments at you and told you you were beautiful just the way you are. But that's what everyone says and you know better than anyone that it never helps. Because deep down you know people just say that to try to appease you. They are never truly honest.
But Gyutaro was. He didn't deny the fact that you have flaws, he pointed it out and was honest about them. He didn't dismiss your feelings either by telling you that you were wrong. Instead, he told you why he thinks having flaws is ok and why he loves you more because of them. And somehow you feel like those scars on your face make you a beautiful piece of art. All because of your Gyu.
"Thank you... no one's ever been so honest with me before," you hug him tightly and cry into the crook of his neck.
"It's just the truth, Y/N," he holds you close, embracing you in his strong arms, "I love you and every single flaw on that beautiful face."
Tumblr media
132 notes · View notes
alwaysobsessed777 · 10 days
Text
SAILOR SONG PT. 2 - N.M.
Tumblr media Tumblr media Tumblr media
Words: 1267
Warnings: None other than it being sad (sorry)
Summary: Slowly falling in love with Nika. Things just seem to be going so perfectly, but nothing last forever....
I don't believe in God, but I believe that you're my savior
"Nika?" She lifted her head from my chest, a small smile on her lips.
"Yeah?"
"I love you," Her smile grew. I wanted nothing more than to be with her for as long as I possible could. I felt...happier, more myself. She made me, me.
"I love you too, y/n," She leaned in, placing a soft kiss to my lips. Her hand finding my cheek, burning and flushed red.
"I've never been so happy in my life. You make me feel like there's a reason to live," I spoke, her face dropping. Her forehead resting on mine.
"Bab-" I cut her off, "No, I mean it," I pull my face away from hers. "You're everything to me, I don't think I can lose you."
She blurted out something I hadn't expected, "I can't be."
"Why not? You already are, you mean so much to me," She started to get up, wanting to leave.
"My parents, they'd...they wouldn't approve," She paused, "But, God, do I love you more than my own life."
"It's not up to them, we make our own decisions," She sighed.
"I can't lose my parents, y/n," She moved toward me, her hands finding my waist, "But, I don't wanna lose you either."
"Do we just not tell them?"
Her face went through every emotion, almost as if she was going through every possible outcome. "As long as we keep it between us."
I was willing to do anything, anything to keep the woman that seems to save my life everyday by just being here. I shook my head, agreeing. Nika pulled me into a hug, her face cuddled into the crook of my neck. My hands found her back, rubbing slightly.
"I'll do anything for you, Niks," Instead of a word from the girl, she placed small kisses on my neck.
And when we're getting dirty, I forget all that is wrong
Our bodies intertwined, skin too skin, I almost forgot that the world would never know she was mine. The way we made each other feel, every word shared between us, it was only ever going to be between us.
"That," Nika says, her breaths becoming even, "That makes me feel like we're supposed to be together."
"Why?"
"Nahiem wouldn't have ever thought about me...you did. That's all you think about, no matter the case. Your better than any person on this planet, y/n," Her words sending chills through me, my cheeks flushing red.
"Nik-" She cut me off, "What if I was to tell my parents? Convince them we're supposed to be together. That you've been the only person to make me feel like...I care, like I matter. Y/n, if I had to come out, it would only ever be for you. Losing them would me nothing compared to losing you."
I sat there, words not wanting to escape my mouth, "Nika, you can't throw your whole family away for me."
"I will. Who knows, they might not hate that fact I found someone that makes me feel so special."
"Nika."
"I'm going to Croatia next week."
Dumbfounded again, I sat there, trying to form words, "When did you plan this?"
"Last night. I wanna talk to my parents. I wanna tell them about us, or at least that..." The words seemed to stick in her throat, "That I'm gay."
Her body shivered against mine, "Niks, you don't have too. Don't do it 'til you're ready."
"I'm never gonna be ready, I just...I just gotta do it. If I don't do it now, I'll never do it. I'll never be fully myself."
I nod, "When do you leave?"
"Tomorrow night."
I couldn't imagine being without her for a week. I couldn't imagine her being across the world and me not being there to comfort her when she decided to come out. I wanted to go with her, but it was best for me not to.
I sleep so I can see you and I hate to wait so long
She left, she went to Croatia. I worried, I hadn't been able to leave my bed. I wanted her next to me. I wanted to know she wasn't going to possible destroy her life back home. All these thoughts, they only stayed when I was awake. Only when I allowed myself away from my bed, the last place she was before she left to her home.
The thoughts would overwhelm me, the void of her not being her overwhelmed me. I wanted to see her, be with her, talk to her, do anything with her.
I couldn't.
I was here, she was there. She'd call every night, my mornings. She'd update me. She'd tell me what she had planned.
"Baby, I miss you," She pouts, a small smile spreading on my lips.
"I miss you too, Niks," She's constantly look around, hoping no one was eavesdropping.
"I haven't told them yet," Her expression changed, nervousness peaking through her happy exterior, "I think I'm gonna wait 'til it's close to time for me to leave."
I nod, "Whatever is best for you. You really don't even have to do it."
She shook her head, "No, I want to. That's just the best time."
"Who you on the phone with?" Nika's eyes darted to the door.
"Bye, y/n. Love you." She hung up.
I didn't even get to respond. I laid back in bed, hoping to fall back asleep. Then I could have dreams of her, of our future. If there even was one.
But nothing can capture the sting, Of the venom she's gonna spit out right now
I waited at the airport for her, she never came. I was worried, maybe she stayed another day. I texted her, I called her, nothing. I tried one more time, finally, she picked up.
"Did you end up staying another day?" I asked, concern laced in my tone.
"Oh, um, I forgot to tell you," She paused, "Nahiem came and picked me up. I'll tell him to drop me off at your place though."
My stomach dropped, why him? Why not me? We were together, or at least I think we are.
"Oh, okay."
"You're not mad are you?" I couldn't pinpoint the emotion that she must've felt, so I just answered.
"No."
"I'm sorry," She sounded like she meant it, I sighed.
"It's okay."
I made my way back to my place, trying to find a reason for her to pick him over me. Nothing. I couldn't think of anything.
I walked through the door, Nika meeting me there. She pulled me into a hug, whispering in my ear.
"I'm so sorry, baby. Please let me explain?" She pulled away slightly, her eyes pleading.
"Of course," She sat me down on the couch, her hands intertwining with mine.
"I told them."
I stared at her, disbelief evident on my face, "What?!? How'd it go?"
Her eyes began to tear up, "They told me...it wasn't natural. It's not supposed to happen. They think the demons are taking over my body."
I gasped, pulling her into a hug, "I'm so sorry."
"They're forcing me to get back with Nahiem. I have to break up with you," Her voice broke, my heart shattering.
"Nika," I tried, she wasn't going to listen.
"No, y/n, we're done."
"Please, you can't do that," I went to grab for her hand, her yanking it from me.
"I never loved you, my parents were right," Tears fell from her eyes, she didn't believe what she was saying.
"Nika, we could keep it secret. Please, I can't lose you," Tears falling from my own eyes. She ran up to me, pressing our lips together.
"In another life."
She opened the door, "Nika, we could say you and Nahiem are together. We'll lie to them, I know you still love me. I love you."
She looked back, shook her head, and left.
--------------------------------------------------------------------------
A/N: Sorry guys, but there's gonna be one more part. It might get better.
108 notes · View notes