#please ask me to tag if anything on the list makes you uncomfortable

[heart-of-the-morningstar]

Alr hear me out, the service top lucifer with a very insecure reading. (Fem or GN) like he has to coax the reader to like open up (God damn I'm blushing thinking abt it-). Maybe even having to like talk them into even taking thier clothes off. Just a little idea stuck in my head.

Thank you very muchly.

Ooooooohh you’re giving me IDEAS (tbh I’d be the same boat)

~~~~

✨Opening Up✨

Lucifer x f!reader

Warnings: 18+, smut, nipple play, pet names, oral (m & f receiving), p in v, service top!Lucifer

It has become evident that I am unable to write anything concise 😅

I’M SORRY THIS TOOK SO LONG I MEANT TO POST THIS DAYS AGO 😭😭

Tag list: @trashbin-nie

@yellowsubiesdance

@j-jinxee

@stevensdickrider

@airwolf92

@mrssabinecallas

@myhornybrainonlyknowsthis

@bee-sinner

@thesoccerenthusiast

@katshyperfixations

@logybearsblog

@bigfatbimbo

You sat upright on Lucifer’s king sized bed, the King of Hell straddling your lap. You don't know how you even ended up in this position, not on this bed necessarily, but how you ended up as Lucifer's beloved. You believed in your heart that you did not deserve him, but time and time again Lucifer has showered you with praise and adoration like no one ever had before. He was perfect. And you were...you. It didn't make sense.

Regardless, that didn't stop him from holding your face tenderly in his hands while he kissed you with a fiery passion. You were self conscious about being so vocal around him during intimacy, but he made it his mission to elicit as many moans and whines from you as possible. Slowly, he reached down to the hem of your sleep shirt, grabbing a fistful of fabric. Your eyes popped open, your mind racing. You pulled away from his lips and went to grab his wrist that held your clothing.

"I-I'm sorry, love," he apologized, releasing your shirt immediately. You sighed and let go of the grip you had on his hand. "I didn't mean to scare you, I should have asked. Please forgive me."

"No, no," you breathed, "it's alright. I'm not upset, I just panicked. I'm sorry."

Lucifer pressed his lips to your forehead and planted a small kiss. "Please don't ever think you need to apologize to me for how you feel, sweetheart."

"O-Ok," you stuttered.

"Do you want to stop?," Lucifer asked. You could hear the genuine concern in his voice. Hard as it was to believe, he cared about you more than anything.

You shook your head. "No."

"You're sure?," Lucifer questioned further, "because if you're uncomfortable, we can-"

You cut him of mid-sentence with a quick peck to his lips. He smiled bashfully, a cute blush spreading across his face. "Believe me, Luci, I want this. I mean I really want this, but..." you found it difficult to articulate what you wanted to say.

"Well, if that's the case darling, what if I go first then?," Lucifer proposed. You cocked your head, unsure of what he was talking about. He reached up and began to unbutton his shirt, starting from the top and working his way down. Oh...OH.

Your face instantly feels hotter and your breathing becomes staggered. You tried to say something, but the words caught in your throat. Your mouth had never felt drier. He finally reached the last button of his shirt and you finally see some of his chest. You could almost feel your brain short circuiting.

"Do you wanna do the honors, my dear?," he asked playfully. You gulped as your hands reached towards his shoulders. Gingerly, you slid his sleeves down each arm, slowly revealing more and more skin to you. Once his shirt was completely removed, you couldn’t help but stare. His chest was so smooth and toned, almost like it had been sculpted. “Like what you see?” Lucifer questioned coyly, noticing your unwavering expression of awe.

"W-Well that's hardly fair," you whispered, finally finding your voice, "you're an actual angel. Of course you're going to be gorgeous, I-" you slapped your hand over your mouth once you realized what you had said. "Please pretend you didn't hear that!," you begged through your hand.

Lucifer's face was flushed pink, he could help but smile. He chuckled as he went to remove your hand from your face. "Is that what you really think about me, sweetheart? I'm truly flattered to hear that coming from someone as exquisite as you."

"You...You really think..." you started to say but couldn't finish. Tears began to well up in your eyes, you tried to rub them away before Lucifer could see but it was too late. Lucifer cupped your face and ran his thumbs under your eyes to clear away the tears that had fallen. Your breath hitched, you tried to take in deep heavy breaths so you wouldn't start sobbing.

“Hey, hey, hey, shhhhh,” he spoke with a soothing tone. He removed himself from your lap and sat down next to you, embracing you in his arms. “It’s okay, angel, it’s ok. I upset you and I’m sorry, I never want to be the reason you cry.” He rested his head on top of yours while you clung to his chest. The scent of him hit your nostrils, it was like breathing in a warm spring day. Purely intoxicating. It calmed you down, you started to breathe normally again. You felt safe in his arms, you could have stayed there for the rest of your life.

You wrapped your arms around his torso, your tears finally drying. “Thank you, Lucifer,” you murmured. He gave you a tight squeeze before you lifted yourself back up, sitting at his hip and leaving your head on his shoulder. “You weren’t the reason I was sad, you know? You never have been.”

Lucifer turned his head to you, “Really? Then why-?”

“Because I’m afraid,” you quickly responded. “I’m afraid that I’m not good enough for you. That I never will be. You’re the all mighty Lucifer, King of Hell. You have so much strength and power and respect. And I’m…I’m just me.” You sighed and pulled your legs up to your chest to rest your head on your knees. “I’m sorry, I shouldn’t have-”

“Darling?,” Lucifer spoke at last. He brought himself in front of you on all fours and placed his hand under your chin, forcing you to look at him in his scarlet eyes. “ “Just you” is perfect. You don’t need to be anything but yourself! I understand what you’re feeling, and it’s okay to express that. But please know that I love you just the way you are. You are my true strength.”

You chuckled softly, leaning into his hand that was now pressed against your cheek. You took his words to heart; he loved you. He loved you so much. You had to show him that you felt the same way. You drew in a few quick and deep breaths before reaching for the hem of your sleep shirt.

“Wait, wait, what are you-” Lucifer tried to say, but you were too fast. Your shirt disappeared from your body and was tossed across the room. Silence filled the space, the only thing you could hear was your heart threatening to burst through your chest.

It was at that moment you noticed you couldn’t see Lucifer’s face. His hands had flown up to block his view of you.

“Lucifer?” you called to him.

“Y-You didn’t have to do that, love,” he stuttered. “I never wanted you to feel that you had to-”

“Please look at me, Luci,” you pleaded. “I love you. And I trust you. Let me show you. Please.”

You saw Lucifer’s hands slowly fall away from his hands, his eyes still screwed shut. “Are you sure?” he asked softly.

You leaned in to plant a kiss on his soft lip. Lucifer’s eyes shot open in surprise, you pulled away before he had a chance to react. Blood rushed to your cheeks when you saw him staring at you. Your first instinct was to cover yourself and shy away, but you pushed those feelings deep down. You were going to be vulnerable, you needed to be brave. Not just for him, but for yourself. You gripped the bed sheets so hard that you felt your nails digging into your skin through the silk.

After what seemed like an eternity, Lucifer had snapped out of his trance. He started to crawl towards you on his hands and knees, only stopping when his lips were inches away from your own. You felt his hot breath on you, you were finding it more and more difficult to keep your composure.

“You…are breathtaking,” he cooed, crashing his lips into yours hungrily. His tongue begged for entrance to your mouth, and you happily allowed it. You felt yourself slowly drifting down onto your back as you and Lucifer desperately devoured each other. He pulled away from your lips, trying to catch his breath, but you noticed he wasn’t looking into your eyes. His attention had drifted a little further down. He swallowed hard.

“May I?,” Lucifer asked breathlessly. Your face felt extremely hot and you couldn’t find the power to speak, so instead you nodded your head vigorously. He gave you a cheeky grin before lowering his mouth down onto one of your nipples. The noise you made sounded more high pitched than you meant it, but God, did it feel amazing! His tongue worked one nipple as his hand played with the other. You loved the sensation of him sucking and licking at your sensitive skin, the tiny bites from his teeth driving you insane. He rolled your other nipple between his two fingers, the pinches he gave sent your brain into overdrive. You never knew how sensitive you were, but Lucifer was more than happy to service you.

All of a sudden you noticed a different sensation, you felt something press against your inner thigh, dangerously close to your clothed pussy. It took your brain a few seconds to realize what was happening.

“Uhh, Lucifer, a-are you…”, you mumbled. Lucifer looked up from your chest with a puzzled face. “I can feel umm, I-I can feel your uhh…”, you didn’t know why you couldn’t say it. Maybe you were too embarrassed, which seemed silly considering what position you found yourself in. You pointed down towards your pants where Lucifer was wedged.

“Oh…OH,” Lucifer exclaimed pushing himself from you and onto his knees. “Oh my gosh, I-I’m so sorry! I didn’t realize you could uhh, feel that…please forgive me!”

Seeing him so flustered somehow calmed some of the nerves you had before. It was cute, really. Demon overlord Lucifer getting embarrassed about unintentionally pushing his hard on against your thigh. You let out a small giggle.

"It's alright, Luci," you chuckled. "I'm flattered, really!"

Lucifer smiled, placing his hand behind him to rub the back of his neck. "I'm still sorry about that, love. I'm a little embarrassed."

“Well,” you breathed, “I guess it’s only fair that I embarrass myself too then, right?” Without warning, you grabbed the waistband of your pants and ripped them off along with your panties in one fell swoop. You laid naked in front of Lucifer, whose whole face had turned a shade of red you’ve never seen before.

“Ffffuck,” was all Lucifer could muster. You watched his Adam’s apple rise and fall, attempting to regain his thoughts. Looking at you, it was plain to see how soaked you were.

“Like what you see?,” you teased. Lucifer nodded his head eagerly, still at a loss for words. You lifted your hand and curled your finger, beckoning him to you. Obediently, Lucifer crawled on the bed towards you with no reservations. “You’re not the only one that’s worked up here. Now we’re even.”

“My love, please…” Lucifer whined, “please let me taste you.”

"Don't you...wanna get more comfortable first?," you asked him, knowing the problem in his pants had probably only gotten worse for him.

"Not until I've had my fill of you, sweetheart," he smiled before forcing his head between your legs. The moan you let out was guttural, almost feral, he lapped your folds like a starving man. He took long, drawn out licks up your slit before focusing on your clit. His lips kissed and sucked on your sensitive nub, sending waves of pleasure throughout you entire body. You couldn't pull away if you tried, he had wrapped his arms under your legs so you couldn't escape his assault on your cunt.

"Sh-shit, oh-oh my God Lucifer, FUCK," you moaned. You could feel a smile form on his face as this seemed to have made him pick up the pace. You screamed from his tongue darting in and out of you, feeling so close to snapping. Your thighs started to fold in on his head and you grabbed a fistful of his hair trying to regain some assemblance of control. “Fuckfuckfuck, mmmm…gonna c-cum, aaggghh, gonnacumgonnacum!” Lucifer’s tongue relentlessly circling your clit finally caused your body to spasm, your orgasm causing you to scream out in pleasure. Lucifer didn’t stop though, he let you ride out your orgasm and hungrily devoured your release. Once you finally came down from your high, Lucifer lifted his face from between your legs and flashed you a toothy grin, seemingly quite proud of his work.

“You alright, darling?,” he asked innocently, almost pretending like he wasn’t the cause of what you had just experienced.

“Y-yeah, I’m…I’m fine,” you breathed. “Just…Jesus, that was intense! Give me a little warning before you go all in on me like that again!”

Lucifer laughed. “I’m sorry, love, I couldn’t help myself.”

You rolled your eyes at him playfully. “Oh, I’m sure you couldn’t. Now, let’s get these off you, hmm?,” you said tugging at his pants.

Lucifer stood up from the bed quickly. He undid his belt and let his pants drop to the floor. From the outlines of his briefs, you were surprised that they could contain him at all. Before he could pull at the hem, you jumped off the bed to stop him.

“Allow me,” you offered, getting on your knees in front of him. You reached up and grabbed onto his briefs, snaking them down his legs. His cock sprang free of its cage and hung in front of your face, its tip already leaking. Without thinking, your wrapped your lips around the head of his cock. Lucifer let out a moan that you’ve never heard before, filled with absolute lust and need. You took one of your hands and grabbed the base of his shaft, slowly stroking up and down while your mouth continued to work on his head. You ran small licks against the slit, tasting and lapping all of the precum that was forming. You loved the taste of him.

“Love…f-fuck,” Lucifer panted, trying to fight through his moans, “if you don’t s-stop now, I-I’m gonna cum. I wanna…wanna feel you. P-Please…”

Reluctantly, you pulled your mouth away from his cock with a *pop*, pouting slightly. Lucifer leaned down to grab your torso and tossed you onto the bed like you were made of paper mache. That angelic strength of his always caught you off guard. Lucifer crept between your legs, planting a tender kiss on your lips.

“I promise,” he whispered against your lips, “next time you can finish what you started, but right now I need you. Need to feel you.” Lucifer brought his fingers to your needy cunt, feeling the slickness of your folds. Your breath caught in your throat at the sensation. He took his other hand and lined up the tip of his cock to your entrance. “Are you ready, my angel?,” he asked softly.

You grinned and nodded your head. With that, Lucifer closed the space between you once more with a fiery kiss as his cock entered you inch by inch. Your cries mixed with his as he finally entered you completely.

“You feel…amazing, darling, fuck…” Lucifer choked out. “Are you okay?”

“Yes,” you murmured, “I-I’m okay. You can move.”

“Anything for you,” he smiled. Lucifer slowly began to rock his hips into you, his cock filling you up completely with each thrust. You could feel every inch of him ruining your pussy, hitting just the right spot every time. It didn’t take long for his pace to become erratic and uneven. He buried his cock deep inside you, both of your moans filling the room.

“Lu-Lucifer, o-oh shit, Lucifer, I-I’m so close,” you pleaded. “Please don’t stop, p-please don’t.”

“Cum for me, darling. Wanna feel you cum.” Lucifer groaned. He bit down on your should as he continued to pound into you, biting and sucking your tender skin. You were shaking, he was going too fast, you were coming undone.

“Cuminme…FUCKCUMINME,” you screamed and wrapped your legs around him as your orgasm flooded over you. You felt your walls pulsating around his cock, it was too much for Lucifer to handle. You heard him cry out and felt him twitch inside you, filling you up with his hot cum.

Coming down from your highs, you both laid there for a moment trying to catch your breath. You played with Lucifer’s hair as he laid across your chest, completely worn out. A minute or two passed before Lucifer sat up and pulled himself out of you. He laid down next to you, staring at your flushed face.

“Are you alright?,” he asked. “Did I hurt you at all?”

“No, you didn’t hurt me,” you smiled. “That felt…really good. Thank you, for everything.”

Lucifer hummed and leaned up to press a gentle kiss to your lips. “No, thank you, love.”

You chuckled returning the kiss. “Would…you mind if I held you, Luci?”

Lucifer’s eyes widened, but he smiled wide. “Of course not, I’d love nothing more.”

Lucifer rolled on his side, giving you the chance to push your body against his back and wrap your arms around him. You both didn’t move until the morning.

~~~~

Hope you enjoyed my second attempt at NSFW content lmaooooo

AND YEAH I MADE HIM THE LITTLE SPOON, IT’S WHAT HE WOULD WANT

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

[kisses4reid]

convenient pt.4 | ·˚ ༘ spencer reid ,,

pt. 3 (you cannot read this without prior reading)

summary - you don’t need help with your biology anymore, you need help understanding the chemistry that seems to be growing between you and spencer.

warnings - jealousy, dickhead guy, unwanted flirting, awkward spencer, mentions of getting run over and pouring rain, studying.

genre - college!fem!reader x earlyseasons!spencer, fluff, angst if you squint, jealousy trope

a/n - i hope you all enjoy this part. comment or put in a req to be added to the convenience taglist, if you’ve already asked and i haven’t mentioned you please message orso i can make sure you’re on my list for the next part! love you all 🫶

sat in a plush office chair, in a cool room, in a comfortable dress shirt, surrounded by the people he trusted most, spencer couldn’t seem to live in the moment.

now that’s not something you would suggest to the man when he’s sat in front of multiple gruesome photos and case files, usually he would be 100% focused, no bullshit, no wandering thoughts.

but suddenly he felt light, airy, like these cases were just another day and he would be confident either way. it wasn’t completely untrue, but it was odd. everyone else seemed to notice.

“spencer, are you okay?” aaron hotchner startled the man with his stern and concerned voice, everyone looking up at spencer as a natural reaction. spencer looked around the table, noticing a growing grin between garcia and morgan.

hotch continued, “if you need to sit this one out, by all means.”

spencer shook his head and adjusted his posture, picking up a profile to skim over. there was a small giggle from garcia that brought the attention of aaron.

“what’s going on?”

“reid’s distracted because of a certain someone…” morgan replied, biting the end of his ballpoint pen. garcia slapped his shoulder.

“don’t tease him, meanies. keep going, hotch.”

they were right. he was distracted and felt far away most of the time. he wanted to go somewhere comfortable, like a convenience store with a pretty employee to talk to.

ricky, a handsome guy a few years older than you, was annoying logan with questions he could’ve answered himself. he tagged along with logan to your weekend study session at a small cafe not far from the college. the tall man was mostly agreeable, except for his apparent obsession with straight black coffee. he had had two cups of it already.

“so, y/n. what do you study? wait don’t tell me. nursing, because you seem to be healing my broken heart. psychology, because you’re making me crazy? or is it music, because your voice is like a song?” he leaned forward from across the table, disregarding the punch in the shoulder from logan. you only glared and returned to your expensive textbooks, leaving your drink to turn cold in its abandonment.

“don’t try anything, ricky. she’s basically taken.” she warned with a smirk. you lifted your gaze and rolled your eyes,

“you’re nonsensical. you’ve had too much coffee,” you stop filling out a questionnaire, “he’s not even that… he’s… ugh, i don’t know.” you place your pen down and stretch in the stiff wooden chair.

ricky laughs, clapping his hands together, “okay so you totally have a crush on a guy.”

“i do not.”

“i guess i’ll back off with my advances, unlessss, you truly don’t have a crush on your lover boy?”

“i do not- but still please back off, you’re gross.”

logan and ricky shared a glance and went back to their work silently. like they knew something you didn’t. your brain had turned stuffy, you need to get some air, you needed to get away from the truth.

garcia and morgan appeared so suddenly spencer thought turbulence had pushed them into their seats in front of him. his gaze snapped from the airplane wing to their two giddy faces and immediately knew what this conversation was going to be about. it only made him a little bit uncomfortable, these types of conversations. girls, flirting, being happy around someone he doesn’t work with, it was all unfamiliar. it seemed he chose the best people to talk about it to though; garcia had given him a little too much information about his crush from her unwanted snooping, and in the process morgan was also given all of this information.

“yes, okay, i told derek all about your girl but i couldn’t help it! he’s very persuasive!” garcia pouted. spencer thinned his lips and nodded, expecting a surge of conversation but he was only met with silence. morgan and garcia shared a glance.

“look, spencer. we’re only doing this to distract ourselves from the case we just closed, and to help you. if you don’t want help, if you think this… thing, will die out, then tell us. but, if you do want some adviceee…” morgan spoke smoothly, quiet enough to avoid attention from anyone else.

when spencer stayed silent, thinking about how he could never use you as a distraction, morgan whispered, “if nothings happening, you gotta light the match.”

you were standing on an uneven step ladder when the doorbell rang with 10 minutes to closing. you rolled your eyes, thinking you’d have to stay even later because of this customer. but your demise quickly turned to calmness, a little bit of panic, when spencer appeared in the entry way.

you nearly fell off the ladder, dropping the pile of juice boxes in your hands onto the floor. you cursed under your breath, watching from above as spencer picked them up for you.

“thank you.”

there was no need for formalities anymore, it was like you had known each other forever. spencer was silent again, it was becoming his thing.

you clear your throat, “i changed my medication.”

he glanced at you, brown eyes observing your tired expression. he came here unconsciously. he had already had some take out, he didn’t need any coffee, and his fruit bowl was stocked to the brim. spencer walked to this convenience store, the result of the action being evident through the pain in his feet.

the phone in your back pocket caught spencer’s attention, before he promptly looked elsewhere to avoid looking like a creep.

“good, im glad.”

are we really back to this? was one awkward conversation all we needed to go back to strangers?

you stepped down, “no more bruises.”

spencer placed his fingers delicately on his healed cheek, holding back a smile that you actually remembered that.

he asked, “who’s texting you so much?” without much thought. he didn’t think about how it sounded, like he was protective or worried, or what it implied. he didn’t even have your number, why should he be so upset?

“oh it’s just logan and ricky.” you replied simply, folding up the ladder and glancing at the clock placed above the register desk, “are you getting anything?”

because it didn’t seem weird if he came here for you instead of his groceries.

“like your brother, ricky?”

there was a small match burning in his stomach at the sound of those names. he felt like taking your phone and snooping until he reached the end, until his fingers hurt. spencer felt like asking intrusive questions, before he bit his lips to stop himself.

you made notice of his hands fiddling in his pant pockets, rolling your eyes. that made his tongue slip.

“how many guys do you know?”

you looked at him with surprise, walking over to the register, “you think i’m a whore?”

spencer’s heart skipped a beat, “no not at all, i just- i didn’t word that right.”

you shook your head and laughed quietly, starting to count the change sat on your swivel chair. something was off. the street was empty. “did you walk here, spencer?”

spencer’s breath hitched. oh god, were the only words circling in his brain. when you used his name, it was different. this was weird, he needed to get out of there.

you looked so effortless. he looked so anxious.

“yeah. i did.”

you nod, “okay, you can help me lock up then.” you pass him a set of keys for the window covers, and add, “you can walk me home, to make up for the other day.”

spencer nods with a small smile and begins locking up.

you lead the way out of the store and around the corner to a set of traffic lights. the streets are silent and misty, but neither of you felt the need to jay walk in an attempt to speed up this process of awkward walking.

spencer watches you from his advantage point. at how you bite the inside on your lips, how you look at the concrete pathway.

“what’s wrong?” you don’t react, instead push the pedestrian button and sigh.

“it’s monday, spencer. you were going to ‘retry’, ‘be better’? i’m not 100% sure what you meant by that, but you said that right after you told me you were going to ask me out so.”

spencer gulps and nods, hands going back to their safe space in his pockets. “yeah, i said that. but i’m going to have to delay that again. this isn’t really,” he motioned towards the weeds, litter, and flickering street lights with his eyes, and you nod with a smirk.

“romantic?”

“romantic.”

you smile at each other, and for a second he’s utterly entranced before a wave of wind and tires pass him. before a soft hand is hard on his upper arm. his eyes trailed the car, heart beating nearly as hard as it does when he looks at you.

“jesus, are you okay?” you asked worried, and when he nods with a simple stare accompanying it, you look away.

light a match.

you hand leaves him quicker than it got there.

in front of your apartment building, you notice logan’s window alight behind white curtains, and turn to face spencer.

“thank you for walking me home. i would invite you in but it’s 1:20am and i don’t really… know you.”

spencer furrows his eyebrows slightly, looking at you expectantly. your faces turns cold, slightly sorrowful.

“spencer, i don’t know you. i know things about you but i don’t actually know you.” you yawn, wiping a hand over your eyes, “maybe i’m just tired and overworked and…” logan’s voice echoes through your head as you look over the tall, tired and handsome man in front of you, “if you’re not going to ask me out first i’m going to ask you out. so, make a decision.”

it felt wrong being so stubborn and solid with him, but with school and family stress you truly didn’t need any unknown feelings to topple on as well.

spencer was taken aback. he didn’t know one couple where the girl asked out the guy, he didn’t know someone could like him that badly. he didn’t know what to say.

“goodnight, spencer. i’ll see you.”

you turned and pushed on the pull door, before pulling on it. heart thumping in your ears, you slowly held a hand over your mouth, impressed with yourself.

but you lied, you weren’t going to ask him out. you have no idea how to ask someone out.

the convenience store wasn’t so lonely tonight.

logan was arguing with ricky over his choice in deodorant almost louder than the terrible radio music playing throughout the store.

the beating of rain was creating a calming background to this chaos, as well as keeping customers away. all but one, of course.

spencer had an excuse, he was supposed to bring food for the team tomorrow, and this was the closest store. totally. but as he stood under the cover of the stores overhead steel, he felt another match being burnt in the bottom of his stomach.

a tall and toned man with bright blonde hair was leaning over your register and talking to you, making you smile and laugh. your arms were crossed, you were leaned away and you avoided eye contact, but spencer didn’t see any of these signs as the waves of jealousy drowned him.

spencer looked out onto the street. he had no right to feel that way, this was his own fault. he felt even weirder and out of place than he usually felt.

the doorbell rang and your fake smile turned real. logan watched from the toilet spray section and smirked when she recognised the purple-sweater adorned man. ricky stopped his flirting and turned to meet spencer’s eyes, they sized each other up. the blonde man smiled and looked back at your much happier face, “so this is lover boy?”

you smacked his arm hard, receiving a squeal in return. “what? no. ricky this is spencer, spencer this is ricky.”

spencer gulped and ignored the stranger and you. he went for the fruits section. ricky glanced at your confused face, “i might be a threat.”

“in your dreams.” you rolled your eyes and pushed his elbow off your desk. logan approached the counter with a basket full and pulled her hair back into a ponytail. you noticed ricky’s change in expression when looking at her and held back a smile.

“you didn’t get anything for me?” he asked, voice teasing. logan took out a block of mint chocolate and threw it at him, which he caught perfectly with a smirk on his face.

“what’s wrong with lover boy?”

you glare at her, deciding avoiding that nickname was out of the picture. your shoulders slump as you begin scanning her items while making sure spencer wasn’t in earshot. “i mentioned you two, and then he went weird.”

“i mean, if i liked a girl and she told me about two guys- sorry, two people with guy names- i’d be pretty jealous,” ricky inputted.

“is that all? some jealousy got to his head?” logan pressed.

you seriously doubted he would be jealous over that, he seemed smarter than that. he was smarter than that.

logan paid and left, literally dragging ricky behind her, as he waved and winked at you through the windows.

the store was eerily quiet, the only noise coming from the thunderstorm brewing outside. it felt uncanny and uncomfortable. you needed someone’s cologne to wade through or something.

turning while shaking your head, you grabbed out some posters taller than you and turned to have the life scared out of you.

“jesus! i thought i told you to walk louder.”

his groceries were perfectly in line to be scanned, a small smile appearing before promptly vanishing. spencer avoided your eyes, a beating all he could hear.

“he’s your…”

you sighed, disappointed spencer even thought that dumb blonde was someone to you, “acquaintance.” you finished his sentence. “i’ve known him for two days and he a flirtatious dick. everyone named ricky is a dick.”

he pulls out his slim wallet to hand you a $20 bill, fingers skimming each other. one glance.

spencer nods and nearly leaves before you stop him, “can you help me?”

spencer is on the top of the ladder outside, barely staying dry underneath the steel overhead cover with the top corners of a food poster in his hands. you tip toe to give him a piece of double sided tape. the laminated photos wave in the wind, spencer sticks his tongue out in concentration and you smile at the innocent act. leaning against the wall, quickly glancing inside to make sure nobody wanted to check out, you begin talking.

“thank you for doing this, i totally would’ve fallen and died if it weren’t for you. what can i do to repay you?”

spencer thought for a moment, looking down at you, “nothing. you don’t have to do anything. just keep talking.”

so you did, because you didn’t know if you’d see him again after tonight.

PART 5

taglist: @jeffswh0re @hypotheticallyspeakingwitch @trashmonstersara @wannabewolf @evysian @navs-bhat @mywellspringoflife @daphnesutton @smalls155 @amortencjja @anuncalledbridge @belsreid @redmurderbaby @tatilolz @criminalmindsandhouse @forensicuntology @nomajdetective @ilikw @screechingphantommaker @c-losur3 @v1ckycheesue @ackermans-angel @scarlettssub @fictionlurker @lovelyygirl8 @momooooca @random-kimmy @leabunny @cultish-corner @doigettokeepyou @pansexualwitchwhoneedstherapy @hinataboke @wenttohogwarts @yaboohah @sarai-ibn-la-ahad @drewsandsebastianswife @hoeshissworld @flow33didontsmoke @bookworm124 @violetvsworld

[moamidzyism]

fashion killa (k.mg)

wc. 879

genre. smut

tags. model!mingyu x fem!reader, oral (fem receiving) one night stand, strangers to lovers, strength kink (if you squint) minors DNI

a/n. first thing i've written in months, are we so back???? also this is kind of so late but happy happy happy mingyu day <333

more of my work

mingyu’s lips roam your body as he pulls you into his apartment. he closes the door and pushes you up against it softly.

part of you wants to take a break and glance around his luxury one bedroom apartment that had a one of a kind view of the city. but at the same time, another part of you just wants to rip his shirt off of his back. and mingyu is so desperately feeding into that part. his nimble hands are already unzipping your dress before you can realize it.

despite your silent pleas, he breaks away from the kiss, to take you in as your little black dress slides off your body. so sexy. he mumbles before you pull him back in to devour his lips again.

you aren’t supposed to be here.

your best friend pleaded with you to come out with her – it was paris fashion week after all. and she promised you she could get you into a really good party. so you foolishly followed her out in the most uncomfortable pair of heels you owned.

you really should have known how bad the party was going to be when you saw the promoter begging slightly intoxicated young women to come into the club. nevertheless, against your better judgment, you went in to find loud music blaring through the speakers and people literally standing on the dance floor. the two of you surveyed the area for all of five minutes before deciding to find something better to do.

but it turns out there really was nothing better to do.

at least nothing you could get into. it seemed like every party was invite only and two college girls with no connections, surely were not on the guest list.

you were going to give up and call it a night. but you found a club with a line that wasn’t too long. you waited until you made it to the front of the line, where your best friend batted her lashes at the doorman asking if he could just waive the cover for two pretty girls. you mentally rolled your eyes but it worked.

from the moment you walked in, you could already tell that this place had a way better vibe than the other place. you and your friend made a beeline towards the bar and bought your little overpriced drinks before heading out to the dance floor.

you remember making eye contact with the hot model from across the room. but you’re not completely sure what happened from the time you felt strong arms wrap around your waist as mingyu came over to dance with you, but that didn’t matter now. because you were here with him gently kissing down your torso. he stops when he gets to the waistband of your underwear. you feel a shiver down your spine as he kisses you through your panties. gyu, please. you whine. you feel his teeth graze against your skin when he begins to pull it down.

he kisses up your legs until you could feel his breath inches away from your core. p-please, you stutter.

what do you want me to do? his thick fingers spread your lips apart. his eyes are laser focused on you, watching you fall apart with a sly smile on his lips. he presses his finger into your soaked hole, ketting it swallow him. you clenched around him as he added another finger. you can’t even be bothered to think straight as he curled his fingers inside of you. he thrusts them in and out, fluidly.

your whines fill the room, your hips stuttering into his palm, desperate for him. i n-need you. you whimper. you need to feel all of him. mingyu pulls his fingers out and you almost cry at the newfound emptiness you feel.

but before you can say anything, his lips find their way around your clit. his hands trail up to your back and down your legs. you throw your head back against the wooden door and your hand locks on the back of his head, with your fingers threading through his hair. but his hair is too short and it’s just not enough for you. you pull him closer to you.

he chuckles against you, the vibrations causing you to arch your back. he takes this as an opportunity to lock your leg behind his back. he continues to bury his face in your pussy. his tongue enters between your folds eagerly. his nose is angled and brushes against your clit softly.

you grind yourself against his face, desperate to feel more of him. he grabs your hips more tightly,guiding you closer to your high. his hums vibrate against your core as you inch closer to your orgasm.

the room fills up with the sounds of your moans as his tongue fucks you right through your orgasm.

mingyu’s face emerges from between your thighs. he still grips onto your legs, lifting you up as he stands. he pulls you in for a long kiss. you wrap your arms around his neck for support, as you melt into the kiss. he finally pulls away from the kiss and you feel like putty in his arms. we should go to my bedroom, no?

taglist: @dearlyjun @bunnie-hq @honglynights @isabellah29 @pluviophile-xxx @leemoonna @variety-is-the-joy-of-life @tinyelfperson @buttrry @wayvisyummy @soobieboobiedoobiedaboobie

fill out this form to join my taglist!

[geekforhorror]

Hey my could you please do Ani making you ride him and him talking you through it

guys my age

pairing: dilf!anakin skywalker x fem!reader

warnings: SMUT (DNI IF YOU'RE UNCOMFORTABLE WITH IT!), dom!anakin, sub!reader, riding, unprotected p in v sex, dirty talk, praise, age gap, modern!au, anakin is divorced!

a/n: yes i based this title off of this song 🙂‍↕️

"Fuck Anakin..." was all you could stammer out as you were constantly bouncing up and down on your employer's dick, feeling his cock brush against your sensitive folds.

You had been a babysitter for his children for about a year and there had always been a strong sense of sexual tension whenever the two of you were in the same room together. Something in him must have snapped tonight that caused him to aggressively attack your lips with his. He was consuming your mouth as if it was his only source of oxygen, which only fueled the already passionate kiss. Before you knew it, your clothes had been ripped off of your body along with his. leaving the two of you bare on his bed.

"You like this, sweetie? You like being fucked by a man more than twice your age?" Anakin asks you lustfully.

"Mhm!" you yelp out as his lips latch onto your collarbone.

"Such a sweet girl for me...making me feel so good, baby," he praises into your ear like a mantra he could repeat all night long. He continues rocking into you sensually, his pelvis meeting yours.

Sure, you knew he was experienced, but the way he was making you feel was otherworldly. You knew one other thing for sure: his ex-wife was a damn fool for divorcing him.

"I knew you would be tight baby, but shit..." you hear Anakin say with a breathy groan. "Taking me 's well..."

All of a sudden, you feel him finally bottom out inside you, making you expel pornographic moans from your mouth. Anakin gently covers your mouth with one of his large hands.

"As much as I want to hear those pretty sounds pretty girl, we wouldn't want the kids to wake up now, would we?" he tuts, pausing his movements.

"N-No" you stammer.

"Atta girl...knows exactly how to make me proud," he coos.

He resumes his thrusting with those words and your only response is to grab onto his shoulder blades so you wouldn't lose balance. Sounds of skin slapping against skin filled your ears, along with the slick sounds of your arousal smeared all over his cock. All your thoughts were thrown out the window as you became more cock drunk on top of him. You could feel the hot coil start to form deep inside your tummy and knew what was coming. Anakin knew you were close from the way your tight cunt was fluttering around his fat cock.

"Please let me cum," you plead, a glassy look forming in your eyes due to how desperate you were for a release. Anything.

"Youve got it baby, you've got it," he says to you, only making your movements more erratic and hasty. "Just like that..." he continues.

Before you know it, you feel yourself finally unravel around him, throwing your head back as he fucks you through your orgasm. He feels the warmth of your cum splash around his aching dick, which makes Anakin continue to thrust animalistically into you like his life depends on it. Suddenly, he spills his hot, sticky seed into your spent pussy and you swear its the best thing you've ever felt in your entire life. He waits a while before finally pulling out of you and lays beside you on the now ruined sheets.

"Why didn't we do that sooner?" he asks with a look of amusement on his face.

"I have no idea," you reply with a giggle.

tag list: @zapernz @mortalheartache @myheartwillgoon2022 @camiemorgan8 @demieyesore @midnight--raine

[daydreams-after-dark]

Pairing: musician!Han x reader… bartender!chan x reader … security guard!Changbin x reader.

Synopsis: Han asks you to meet him in the corridor at a bar. Chan and Changbin join in for the fun.

About a 7 minute read.

This story is moderately unhinged. Porn without plot.

Unhinged level: 🤡🤡🤡🤡

A/n: I couldn’t sleep the other night and thought to myself “what’s a naughty fantasy I could write about that isn’t realistic in the slightest?” but also not fantasy genre (one day I’ll write a non human Han story, promise).

This is what I came up with. Please be safe when having sex. The following isn’t recommended except in delululand where anything goes. 😜

CW: unprotected p in v sex with multiple strangers in a semi public space (a bar) and ppl see // voyeurism // exhibitionism // sub reader // 3Racha cum dump situation // gagging with underwear// mating press kind of// oral sex m rec// slight degradation- they talk like reader isn’t there // size, stretch kink// mild pain kink// I don’t offer a safe word option in this story but I promise reader wants it all (cos I made her up)// like I said it’s not realistic // if you are uncomfortable with any CW please don’t read.

A/n (again): Okay so now that’s out of the way… the scenario that got me hot and bothered…

Oh and by the way way if you want to be tagged in my after dark content because you’re as filthy as me, please let me know 😘

Really… let’s get started… I’m writing this 3 wines in 🤪 so who knows where we’ll end up. 🫣

You sit on a stool at the bar watching the musician on stage. His name’s Han, and he is singing a love song whilst playing his acoustic guitar. He’s fucking gorgeous and you can’t keep your eyes off him.

The bar itself is pretty empty. There’s the bartender. His name tag says “Chan”, a dozen or so patrons and a security guy pacing the entry way. You’re dressed up far more than anyone else here tonight in your short, tight, stretchy boob tube style dress and strappy stilettos.

Han finishes his song, and apparently his set list because he leaves the stage and some random music comes through the speakers. You turn back to face the bar and concentrate on your drink.

That’s when you feel a hand on your thigh. You turn to see who has the audacity, the nerve, to just come up and do that and find it’s none other than Han himself. Your breath catches in your throat. But he doesn’t actually acknowledge you. He just reaches over the bar, grabs a pen and scribbles something on the back of a coaster and pushes it in front of you. Then after a knowing, silent exchange with Chan, Han is gone.

You look down at the coaster to see a note, an invitation, just for you.

Meet me in the corridor in three minutes.

Corridor? You look around the bar.

“He means the corridor outside the bathrooms.” Chan informs you, like he’s seen this play out before. Oh? So Han does this often? You wonder for half a second, until your feel your pussy throb. You’d better listen to your pussy, you tell yourself.

…..

He’s waiting against the wall outside the bathrooms. Just like Chan said.

You take deep breath and bravely walk up to stand in front of him. He smells intoxicating.

“Hey?” You say quietly.

“Hey, baby.” He replies in a deep, husky voice.

You take a step towards him but in one swift move he turns you around and presses you against the wall.

You cry out in surprise at the forcefulness, then moan into his mouth when he crashes his lips on yours. His hands slide down your sides and then grope your ass as he presses himself against you.

You feel your body spark with arousal as he makes out with you in a rough, urgent way. His hands move down to then reach up under the hem of your dress. He slowly inches it up beginning to expose your ass. You pull away from the kiss and he moves his mouth to your neck.

“M-maybe…we should…take it to the bathroom?” You say.

Han nibbles your ear, his hands cup your bare ass cheeks. “Here’s just fine, baby.” He whispers.

“What?” You yelp.

“I’m gonna fuck you right here, not in a filthy toilet.” He grinds against you again and he’s so fucking hard it makes your cunt ache.

You see two women come out of the ladies room and glance over to where you are in the hall. They throw you an encouraging glance and throw a fist in the air to say “you go girl.”

“W-what about protection? You got something?” You pant. He’s really getting to you, and if he were to touch you right there, he’d know how ready you are for him to fill you with his cock.

His hands pull your dress up further exposing your red thong, and he hooks his hands into the sides of your underwear and peels them down your thighs.

You can hardly believe what’s happening when he’s dropped down momentarily to pick them up off the floor.

“Baby,” his voice is serious as his mouth inches closer to your cheek. “You’re asking too many questions. Just do as I say.” He shoves your panties into your mouth. Your eyes widen in surprise.

“Now listen.” He kisses your neck softly and his hands come back to squeeze at your ass. “I’m gonna fuck you raw.” Another kiss to the corner of your mouth this time. “And I’m not gonna pull out.” He yanks your panties out of your mouth. “You understand?”

Your body feels like jelly. His words are turning you on far too easily. You nod vigorously. “Yes. I understand.” You gasp. The panties are pushed back into your mouth and Han smirks at you.

“You’re such a good girl.” He caresses your body. You’re melting under his touch. “I saw you watching me.” His fingers tease the edge of your pussy. You need him to touch you so bad. You feel a thrill knowing you’re naked from the waist down and your dress up around your waist - In a public hallway for fucks sake. Anyone could stumble across you. It makes your pussy squeeze.

You wrap your arms around his neck and begin to grind yourself against his clothed crotch, trying to get him to touch you already.

He slips his fingers between your legs and slides his finger along your pussy. “Fuck baby. I gotta fuck you right now.”

His hands leave your body to undo his pants and release his cock. You don’t even get to see it because he’s lifting you up and your legs automatically wrap around him. He presses you against the wall at the same time he manages to plunge deep into your cunt. You cry out around the panties in your mouth.

He’s inside of you. Fucking you raw just like he said he was going to. He fucks you deep and slow, leaning in close against you and breathing ragged breaths. “Fuck, you feel good… knew your pussy would feel perfect around my cock.” He panted.

Your eyes roll back into your head as this man you’ve barely exchanged two words with is fucking you better than anyone has in a long time.

A few minutes pass and you’re feeling delirious from the relentless pace Han has built up to and you close your eyes, relishing the feeling of being used like this.

You open your eyes to see two men approaching, and you’re startled for a second until you realise who they are.

Chan and the security guard, Changbin is what his name tag says. Fuck you’re going to be kicked out. Banned for life.

But they’re not here to kick you out. Chan comes up to your left, Changbin on your right.

“So you’ve found Han I see.” Chan notes as he breathes on your cheek.

“She’s an eager one. Look at her with her pussy out on display.” Changbin growls.

“Does she feel good, Han?” Chan asks.

“Fuck, yeah! She’s so tight. Such good pussy.” He pants and thrusts harder causing you to whimper.

Chan and Changbin start to kiss your neck, nip your earlobes, breath hot heavy on your skin. The additional physical contact, and just the scenario itself, makes your core tighten. Your orgasm is approaching, you can feel it building rapidly.

“Fuck, look at her responding! She likes the idea of three guys huh?” Changbin notes.

“Hey Hannie, let’s help you out a bit, yeah?” Chan smirks.

Chan and Changbin hook an arm under each of your legs, holding you up and essentially pinning you to the wall behind you. Your arms automatically hold onto their shoulders, as they continue to bury their faces in your neck.

Han pulls out of you the whole way and takes in the sight before him.

“Fuck! Look at her pussy. It’s dripping.” He says.

The two others look down and moan and curse under their breath. Han runs his hands along your inner thighs, pushing them wider. Chan and Changbin pull your legs out as far as they can and then push your bent knees up higher. It’s like they’re trying to get you into as close as a mating press as possible.

“Han, you should get her tits out too.” Changbin suggests. Han obliges and yanks down your strapless dress, spilling your breasts out. It causes a commotion as their hands start to grope and knead them.

Han steps closer, ready to penetrate you again. “This is gonna be so deep, baby.” He pushes his cock back inside you and cups the underside of your ass for leverage.

It is so fucking deep that you swear you can feel him in your throat. He slams into you time and time again. It hurts, but in the most satisfying way. Tears prickle at your eyes from how good you’re being fucked and then you cry out around your panties as you orgasm.

“Shit…shit…fuck…baby…so…slippery…” Han pistons into you frantically. “Fuck I’m cumming, baby.” You feel his release deep inside you, against your cervix, leaving you both panting as you try to catch your breath.

He pulls out, removes your panties from your mouth and uses it to catch his cum that starts to seep out of your hole. Once he’s satisfied, he balls up the underwear and shoves it back in your mouth.

“My turn.” Says Changbin. He swaps places with Han. They continue to hold you in this position as Changbin lines his cock up with your entrance. He’s thicker than Han and the stretch makes you moan a deep guttural sound.

“Yeah, you like Binnie’s cock, hmm?” Chan cooes. “Didn’t know she’d be such a cockslut when I served her drinks.” He added.

“I could tell.” Han replies and licks the skin on your neck.

You’re loving the way they’re talking about you like you’re not there or can’t hear them.

Changbin sets a slow and steady pace, but the way he angles his cock at the end of each thrust sends jolts of pleasure through you. He doesn’t change pace or intensity the entire time he’s fucking you. It’s relentless, excruciating, frustrating that he won’t go faster. You can’t do anything about it because you’re pinned in place.

You sob around the panties in your mouth and your mascara is running down your face as you cry. You need to cum again.

You feel fingers encroach your asshole and start to explore you there. Please don’t tease me. You think to yourself. You don’t know whose fingers they are, but when one squeezes into your tight hole, you cum instantly.

“Fuck! She’s cum again. Such a good girl.” Han praised you.

“Shit, she clamps down hard doesn’t she?” Changbin growls. He suddenly pulls out and coats your inner thighs with his cum.

Again, your panties are removed and used to wipe up as much cum off you as possible and then it’s put back in your mouth.

They release you and help steady you on your feet. Han and Changbin continue to kiss and caress, squeeze and nip at your body.

“My turn now, babygirl.” Chan says pulling a chair into the hallway. He sits himself on the chair, holding his erect cock in his hand. It’s enormous, and you’re not sure how you’re going to manage it.

“Come, sit on my cock. I want to feel if you’re as tight as these two are saying.”

You carefully straddle Chan, facing away from him so the other two can get a full view, and lower yourself over his cock. He stretches you so wide as you slowly sink down. Once you reach halfway you stop. It’s not going to fit.

“You’ve got a bit more to go, sweetheart. Do you need help?” He grabs hold of your hips and pulls you down the rest of the way. You whimper. It’s too deep. He’s too big.

“Now babygirl, you’re gonna fuck yourself on me. Make me cum.” He growls.

You press your stilettos into the carpet and start to bounce on Chan’s cock. The impact against your cervix is brutal and you cry out each time his cock makes contact with it.

You’re not sure how much you can take, but you want to be a good girl, you want to please them. You want to show them you make Chan cum. You ride him wildly with all the enthusiasm you can. Just like in the porn you love to watch. You reach down and rub at your clit, and your other hand comes to your breast. You want to put on a show.

“Fuck, look how red and swollen her cunt is!” Changbin stares at where you and Chan are connected, dick in his hand.

“Makes me want to fuck her again.” Han declares as he pumps his own hardening cock. “Bet it’s twice as tight now.”

They’re right. You are swollen and sore, but it feels so fucking good and you can’t stop.

You reach out, ushering Han and Changbin closer. They step forward and you wrap your hands around their cocks.

Chan’s hands wrap around your front so he can grab onto both of your tits, and Han reaches down to play with your clit.

“That’s the way baby. Your hand feels so good around my cock.” Moans Han.

“How does her cunt feel, Chan?” Asks Changbin.

“Tiny. Feels like I’m gonna split her in two. Fuck, I wanna break her little cunt.”

That was enough. Those obscene words took you over the edge and you were cumming again. Harder than ever.

“Babygirl, I’m close! Fuckin’ milk me. Make me cum. Yes. Yes. Good… fucking pussy…suck it all out me… There you go. There you go.” chan groans, filling you up.

“Quick. Kneel on the floor.” He’s is quick to shove you off his cock.

You kneel on the floor as instructed, and continue to pump Han and Changbin as they stand in front of you. Han rips your panties out of your mouth only to stuff it with his cock. Changbin holds the back of your head while Han fucks your throat. He’s not gentle and you gag. It seems to spur him on, each thrust deeper into your throat. Then he pulls out to tell Changbin do the same.

They take turns like this for a while, even attempting to stick them both in your mouth at once, with Chan slouched on the chair working on getting himself hard again.

Han and Changbin release you and admire the saliva, tears and smeared mascara all over your face.

Then the the three of them stand in front of you pumping their cocks.

“Okay, baby. You ready? Keep your mouth and eyes open for us.” Chan says.

You open your mouth wide and do your best to keep your eyes open as Han, Changbin and Chan shoot ropes of cum all over your face. Some gets in your mouth, but most of it lands on your cheek, eyebrows and caught in your eyelashes.

Fuck you looked like a cum dump with a bucketload on your face, and Chan’s cum running down your leg.

“So fucking pretty.” Han smears the cum around your face.

Your panties are again used to wipe your face, but they are so wet that it can’t absorb anything else.

Chan comes behind you and scoops up some of the leaking cum and pushes it back inside you.

Then they get you to stand up and put your cum-filled panties back on. They feel so wet and dirty. You fix your dress, pulling it back down over your ass and up over your tits.

You look around to find the men are gone.

“Well fuck me!” You say out loud.

“Well I hope I can again.” Han says a he comes out of the bathroom with paper towel. He wipes your face to get the remaining cum off your skin.

“I’m hoping you’ll come back to mine. I still have one more hole to fuck, and I really want to take my time with it.”

@kangnina @noellllslut @channieandhisgoonsquad @weareapackofstrays @itshannjisung

[leighsartworks216]

Hellooooo i have a request for Astarion that like

I’m dying to see:

Gn! Druid Tav that had small petty fight with Astarion, Astarion being his stubborn self didn’t apologize ~properly~ or acknowledge he was wrong, tries to pretend the fight didnt happen and chat with Tav, Tav shapeshifts into a cat to avoid talking to him and fights sass with sass and Astarion melts at Tav being adorable😭?

I finished writing this and then was like,, I forgot it's not normal for partners to like scold each other by pinching them and stuff?? My ex used to do shit like that so I just forgot that wasn't normal. So I'm just going to clarify that in this story it's not malicious or anything like that. If it makes you uncomfortable tho I am 100% willing to rewrite it so that's not there at all

Warnings: swearing, scratching

Word Count: 759

Masterlist

AO3

Tag List Form

Astarion sits beside you as though it’s just any other day. He’s got that damn suave smirk on his face - you can just feel it radiating off of him without even needing to see. You try not to visibly bristle and turn your head further away from him. It was best to just wait it out and maybe he’d finally suck up his damn pride long enough to apologize. Maybe.

“So, darling,” he makes sure to really emphasize the word, drawing it out sweetly, “in the interest of keeping myself in peak fighting form, I’m inclined to ask if you would be ever so kind as to let me dine with - or rather - on you tonight.”

You huff a dry laugh. Sharp, short, but lacking genuine amusement. You don’t say anything. Instead, you focus on patching up one of your shirts.

He leans close to you, hovering just over your shoulder. His chest just barely grazes your arm and his breath ghosts across your ear and neck. Was this bastard really trying to seduce you? At a time like this? “Please, dear heart? I’ll be gentle, I promise.”

You glance over your shoulder, to make sure he can see the dead-pan look on your face. “No.” You pull the thread taught. Admittedly, you tug a little more than necessary, bunching up the fabric. Astarion definitely notices. He always does.

“Don’t tell me you’re still upset about earlier?” he chides.

You turn to face your back fully to him, forcing him to move back. You smooth out the bunches of fabric and roughly, messily, continue the next few stitches. He sighs dramatically.

“Come on, love, that was hours ago! All I said was your stitches aren’t even!”

You scoffed and angrily wrinkled your shirt in your lap as you whirled around to face him. “You said my stitches weren’t even and that they were ugly! I have been fixing my clothes my whole life - this is the most efficient stitch to ensure it doesn’t unravel!”

“That doesn’t mean you have to leave a mile between stitches!”

Fuck this. If he doesn’t want to apologize, the least you can do is give him a taste of his own catty fighting style.

One moment, you’re a perfectly humanoid being. The next, you’ve shrunken to less than a foot off the ground. Your back arches, your tail fluffs and sticks straight up, and you bare pointed canines at him as a scratchy hissing comes from your throat. Astarion can hardly feel threatened by a feline.

“Now you’re just being childish,” he scoffs. You jump forward to dig your claws into his leg. “Ow! Hey, that’s not fair!”

He grabs you by your middle and lifts you up. Your claws are removed from his skin, but they continue to pull on his pants.

“You’re going to rip my pants!”

You squirm from his hold, releasing his pants in the process, and land back on the ground. You sit next to your abandoned, half-fixed shirt, back turned to the vampire once more. Your tail flicks side to side in irritation.

Astarion rubs his leg and checks that there’s no lasting damage. There isn’t, of course. Even your claws were mere pinpricks compared to what damage you could do with them, and you’d never willingly destroy his belongings, no matter how pissed at him you were. And even though you are pissed at him, he still can’t help but admire you.

You’re upset, but you’re not physically assaulting him until he apologizes. You pinch him, give him a little scratch - sure. But that pain fades, at most leaving a small mark that fades in a day. You’re so utterly, bafflingly kind to him. Even when he’s being a dick.

He reaches out and scratches just behind your ear. Your ear twitches, but otherwise you show no reaction to his touch. He sighs. “I’m sorry for insulting your handiwork, my dear. You know your work better than anyone, and I shouldn’t have said anything.”

Your tail continues flicking back and forth a moment longer. But then you relent. You turn around and press your cheek into his hand, which he gladly glides along your soft fur. He’d asked once what it felt like to be pet like this. You’d said it was like a massage; like someone was scratching an itch you just couldn’t reach.

You step into his lap and plop right down, rubbing yourself into his abdomen with loud purrs. He chuckles. “Oh you sweet thing,” he coos. “What have I done to deserve you?”

---

Tag List:

@satelliteapotheosis @hypopxia @flsalazar @beverlybeav @angelofthorr @emiemiemiii @marina-and-the-memes @lynnlovesloki @aurasyn @furblrwurblr @cappsikle @mjmygd @thegirlsadventuresinwonderland @mheerdraws @kindadolly @httyd-chocolate @bloopthebat @pandimoostuff @chesb0red @black-star1472 @sessils @olitheghostboy-blog

[thesewordsareallihavetogive]

Cold Nights to Sunday Mornings - bradley "rooster" bradshaw x reader

Summary: 2.1k words. loosely inspired by "Hold My Girl" by George Ezra. (idk what to put for the summary but! pls trust that it's worth your time bc i'm proud of this :) )

Warnings: lots of angst & fluff to redeem the angst

a/n: the fall semester just started & i've been really busy so i'm just as shocked as you are that i'm actually posting a fic. enjoy & please let me know what you think <3

master list | join my tag list

“Baby, we have to get up,” she pleaded. Bradley ignored her request and wrapped his arms around her midsection tighter.

A soft displeased hum left her lips—though it was mostly in jest. She could never be anything but content in Bradley’s arms. The sound only had the aviator nuzzling his head further against her neck, peppering light kisses across the exposed skin.

---

Before y/n, Bradley never slept in. Rooster was his call sign for a reason. For better or for worse, he had a habit of being up before the sun and the rest of the sane world. 

Sleeping in meant that he was only prolonging the amount of time he spent in bed alone. The barrack beds were uncomfortable and cold. When he’d been promoted and was able to arrange for housing off-base he ran into the same issue. A thousand dollars and a new mattress later, the comfort issue was fixed. He might as well have been sleeping on a damn cloud. But his bed was still cold. And lonely.

Without an alarm clock he rose every morning no later than 5:30 a.m.. Maybe it was because of all his years in the military. Maybe it was the broken teenager inside of him that was always running—from his past, to his future, to find someplace somewhere that he could rest easy—and damn, was that exhausting. Everyone he loved and counted on died suddenly, or abandoned him, or died slowly.

As he got older, he found a little bit of peace. Bradley worked his ass off and earned his successful career. He reconnected with his estranged Godfather. He was reassigned to the same base he spent most of his early childhood at.

He slept better after that. In his mid-thirties, it was about damn time that he was able to relax a bit. Yet still, no amount of blankets warmed up the everpresent unwelcome chill.

---

One morning he had a particularly unpleasant wake-up. At just after 4 in the morning, Bradley woke up drenched in sweat. The nightmares weren’t frequent, but they weren’t uncommon. It came with the territory of being directly involved in combat. He couldn’t go back to sleep–he never could–so he got up. He cleaned his entire house. He watched a movie that he wasn’t paying attention to. He went for a run. He didn’t bother counting the miles, he just ran until he felt better; even though he never really did. When he was done showering, it was finally a socially acceptable hour to call someone.

Bradley’s thumb hovered over Pete’s phone number. Before he could talk himself out of it, he pressed harder than necessary on the screen and winced as the phone rang. After 3 rings Bradley’s tense shoulders deflated. Just before the call went to voicemail, it was picked up with haste. Shuffling could be heard on the other end of the line.

“Hi sweetie!” That’s not Maverick.

“Hey Penny…” he trailed off awkwardly. He was hardly prepared to have a conversation with his godfather, much less his godfather’s girlfriend.

“Mav is out in the hangar right now working on his plane,” Penny explained with a sarcastic air of ‘what else is new?’. There was more shuffling as Penny moved to hold the phone between her shoulder and ear. She had a splatter or two of pancake batter on her manicured hands. Pete would just have to suck it up when he saw the evidence on his phone later.

“I’m making breakfast right now, would you like to come over? I’ll make up a plate for you, hun,” Penny offered sweetly. She was so caught up in putting together her Sunday breakfast feast that she hardly realized she never asked Bradley why he called.

The younger man paused for a moment. He didn’t want to impose, but he really didn’t want to be alone right now.

Pete met Bradley at the front door with a fond smile. Bradley tried his best to return the smile but he wasn’t successful. His lips just looked like they were twisted in pain and there wasn’t much light in his eyes. Maverick’s brow furrowed. He wouldn’t push until the kid was ready to open up, and he had a feeling that wouldn’t be until after he had a plate full of Penny’s famous pancakes.

Amelia all but inhaled her breakfast before she twirled around the house like a mini tornado, grabbing her bag and keys and shouting ‘ThanksforbreakfastI’mgoingtothebeachwithsomefriendsloveyoubye!’ as the door slammed shut behind her. Maverick’s eyebrows raised and Penny just shook her head with a smile.

The older woman subtly watched Bradley clear his plate. She waited until he swallowed his last bite of food and washed it down with orange juice before she rested her soft hand over his white knuckle clenched fist on the table.

“What’s going on, Bradley?” she asked gently. She was careful–like he was a scared animal that might bolt in an instant. Pete leaned in, making sure he was within his godson’s line of sight too. Bradley couldn’t meet either of their eyes. He cleared his throat and was quiet for a moment.

He told them about the nightmare. About the cold sweat, and the cold sheets, and the cold bed, and the cold empty house. Mav’s heart broke. He was trying his best to do right by Goose; he’d just barely managed to repair his relationship with his godson, but he supposed there was only so much he could protect the younger aviator from.

Pete reached across to rest an arm on Bradley’s shoulder. He tensed then relaxed, but didn’t shake off Mav’s hand. Maybe that was a good sign. Penny’s gaze was sympathetic. Bradley rarely opened up to anyone, but he knew Penny was the person to go to when pity would make him nauseous.

“It might be helpful to get some company,” the older, wiser woman suggested and squeezed Bradley’s hand. His fist unclenched a bit. Pete had been mostly silent up until this point. He wasn’t good with emotions, that much was obvious to anyone who’d spent more than half an hour outside of work with the man.

“Company other than one night stands and the stray cats you swear you don’t feed,” Pete remarked. Rooster chuckled. It was the first genuinely positive reaction they’d seen from him this morning. The cats are lovely company, thank you very much, Bradley thought.

---

Bradley tried to get his shit together. He was mostly successful. He officially took in one of the stray cats. He brought him to the vet and made sure his vaccines were up to date and got the poor cat neutered. A cat tree tower took residence next to the backdoor Bradley left cat food out by.

He even tried his hand at gardening. He started a small vegetable garden and did a bit of landscaping. Two months ago he didn’t know which perennials were best suited for California weather, much less how to take care of them. Now he’d installed a carefully timed automatic sprinkler system and even built a tarp over part of the earthy plot to prevent too much sun exposure for some of the more delicate plants.

You have to love yourself before you can love someone else.

Bradley was convinced that phrase was absolute bullshit. Plenty of people were in happy relationships and still went through bouts of being miserable with themselves. Penny tsked Bradley’s pessimism at her bar top. She’d unofficially taken on the role of being his intermittent therapist.

“Bull shit or not, you need to work out some of your own issues before you start dating around,” she said pointedly. She was being pulled in the opposite direction by another bartender that needed her help when she shouted back to Bradley, “Don’t you dare download Tinder, mister!” The exclamation was far too loud for Bradley’s taste, especially when several heads suddenly whipped around to focus on him.

So work out his issues he did. 

He stopped throwing himself into work and ruthless workouts simply for the sake of avoiding his thoughts and being alone. He tried out sitting in silence with his thoughts in his lonely house. He hated it. But he got better at it over time. Goose the cat climbing across his lap and snuggling against his thigh made things better.

Companionship. Mav and Penny were right. He needed someone outside of work. Someone whose life didn’t center around the Navy or planes or beer.

---

y/n wasn’t who he ever imagined ending up with. She didn’t particularly care for the U.S. military-industrial complex. She wasn’t a beer girl and she wasn’t very good at driving. She was afraid of heights so she preferred not to fly when she traveled. Whenever she could drive instead of take a flight, she would—even though she’s admittedly a bad driver.

y/n loved Bradley’s cat. She was a cat and a dog person. She was also a bearded dragon person—something that Bradley did not expect to learn about anyone over the age of 20. Her eyes were filled with wonder when she first laid eyes on his thriving vegetable garden.

y/n was very outdoorsy. She loved nature and the beach, she dragged Bradley out of his cold house more times than he could count. The more time y/n spent at his house, the less cold it felt. She brought Bradley on hikes—he had no idea how many trails and reserves were within driving distance. Bradley always drove.

Their green thumbs linked well together. y/n introduced several cat-safe plants to the interior of Bradley’s home. Every once in a blue moon, the couple would spend time at y/n’s apartment. Her roommate was even less of a fan of the military-industrial complex and it showed. One morning Bradley woke up before y/n so he headed to her kitchen to make them breakfast. Her roommate, Allie, woke up early as well. A not-so-casual conversation ensued (read: scrutinizing questions) about Bradley being ‘“Property of Uncle Sam” over the sound of scrambled eggs sizzling. After that, Bradley suggested they spend more time at his house. It was roomier, he reasoned. y/n snorted. “You just don’t want Allie talking at you at the butt crack of dawn,” y/n corrected. Bradley nodded with tight lips.

Mav and Penny enthusiastically offered to help move y/n into Bradley’s home after the spunky y/h/c accepted his offer with a massive grin and a PG-13 kiss.

Now that Bradley woke up with y/n in his arms every morning, he wasn’t really eager to hop out of bed anymore. He was pretty sure the last time he habitually woke up later than 9 in the morning on weekends was when he was in high school.

---

y/n huffed and leaned back into Bradley’s warm embrace. The man was practically a space heater in bed, but he was her space heater.

She twisted around in his arms with a grin so that they were chest to chest. Bradley’s legs tensed when y/n’s cold feet assaulted his skin.

“We need to go feed Goose,” y/n reasoned, even though she knew full well that Bradley couldn’t be reasoned with when he was comfortable in bed. Comfortable and bed were two words that weren’t associated with each other for quite a long time for Bradley.

“He can starve for a bit,” he mumbled without opening his eyes. y/n gasped and swatted his arm. The corner of his lip twitched into a grin as he leaned forward to blindly press a kiss to y/n’s face. 

“You have morning breath, Brad,” she wrinkled her nose. He squinted one eye open and stuck his tongue out at y/n. She rolled her eyes but she too snuggled further into his warm embrace. 20 minutes or so passed by. y/n was falling in and out of almost asleep, and she was ready to get the day going.

She squirmed in Bradley’s arms again.

“Bradleyyy,” she groaned, feeling antsy. The aviator shook his head with a smile. For the first time all morning, he cracked his eyes open. The light streaming through the window highlighted the flecks of gold in his beautiful big brown eyes and y/n forgot what she was going to say.

“Shhh, five more minutes” he hushed softly and pressed a kiss to y/n’s nose, a content smile on his face.

“Give me a minute to hold my girl.”

to get notified about new fics, follow @thesewordsxupdates & turn on post notifications :)

[atlasnessie]

please, don’t get rid of me so soon. wings of the devil — mini series

SYNOPSIS — how about, instead of trying to send the demon back to the underworld so quickly, you invite him as your plus one to your friends wedding ?

series masterlist tag list (open) — @cheriiyaya @kuro-chi69 @sleepykolya @kissesmellow21 @lilylylalil @willywokaa @malaikachan @amvpk01 @cookiechu18 @little-miss-chaoss @phoenix-eclipses @cocodrilofeliz @almond-t0fu

OSAMU DAZAI FELT OUT of place. despite standing in his full human form, handsome and beautifully disguised, he felt tense, uncomfortable. he leaned on the wall, watching humans mindlessly dancing their heart away, laughter and cheers filling the air.

dazai was at a wedding that you had been invited to. getting two invitations by the bride (then bride-to-be), he wanted to go. so, so badly. perhaps he could make a deal with another naive human, consume their soul whole and feel ecstasy again, even if it was just for a moment. everything he would do was carefully calculated in his head a few days before the wedding, even having a plan to woo and have a dance with you. but this wasn’t how he thought of it.

you were chatting with a few co-workers that had recognized you, sharing a drink and dragging you away. osamu dazai, however, was nothing more than a plus one. he doesn’t know anyone or anything. as he watches from a distance, the party lights seem all too bright and the women that constantly come up to him with lovesick eyes slowly become nothing more than a nuisance. neon blue lights shine over his eyes and, like lightening, you’re out of his sights.

the demon hesitates for a moment before he sighs, pushing himself off the wall and rubbing the corner of his eyes. bringing himself up and brushing any debris off his most nicest suit, he slyly grabs a champagne glass and going off to find you.

“you don’t talk much in the office, so i thought you wouldn’t be coming !” people laugh in agreement, covering their lips with a hand to hide their teeth. your face feels hot as you awkwardly laugh along, biting on the edge of the champagne glass as your eyes divert away. you wanted to get away, go home and sleep and forget this day had ever happened. you shouldn’t have listened to dazai, nor should you have even brought him here.

wait …

where is dazai ?

your eyes widen slightly in realization as you stare at the ground, feeling your heart drop to your stomach. your mind wanders off to what he could be doing. perhaps charming some young lady you haven’t spoken to before or trying to clog the toilet with various items. you needed to make up an excuse, fast.

“sorry, i need to —”

“there you are, dear !”

your eyes twitch slightly at the voice. speak of the devil. quiet literally.

you slowly turn your head then followed by your body to see dazai practically skipping over to you with a smile and champagne threatening to spill on the fancy church carpets. you could hear the whispers of co-workers wondering who this ever so handsome young man was and- the most important question of them all- if he was single.

“i’ve been looking all over for you. there’s a photo booth i’ve been dying to do with you.” dazai links his arms with yours and smiles down at you, followed by a wink that complimented his charming aura.

“ah, [name],” an older women started, startled by dazai’s charming and glowing looks. “who’s your friend ?”

you blink, unable to speak for a moment. what do you say ? a roommate ? a stranger you’ve never seen in your life ? a devil straight from hell with the goal of killing himself and (or) taking your soul down to the underworld ? as soon as you open your mouth, dazai cuts you off.

“boyfriend.”

“excuse me ?”

“i’m their boyfriend.” dazai says naturally with a matter-of-fact tone, as if the question was asked multiple times before. your arms tense up and your feet are stuck to the ground, legs feeling like jelly as your eyes twitch again.

what ?

what ?!

feeling your face redden at his words, you wave your hands around to dismiss the thought, hands sweaty and your mouth dry.

“n- no ! we aren’t ! he’s just, ah, uhm— he’s just a roommate !”

“you’re breaking my heart here, babe ! i know you love me.” dazai teased, emphasizing the pet name and acting offended, poking your cheeks with a finger. you can feel eyes on you, your co-workers looking at you then at each other. how curious, they never saw you as the type to be dating someone, nonetheless, someone this handsome ..!!

“well, i bet you’re all lovely people, i’m sure of it. but [name] and i have a photo booth to be at and i really don’t wanna miss it.” charming himself out of the situation, dazai drag you along with his arms, not letting you say your goodbyes. walking down the busy church halls, you quietly scold dazai, gritting your teeth as you trip around the carpet now and then.

“are you fucking stupid ? you can’t just say that ! why did you say that ?!” if you could, you would’ve used both arms to stop the demon, give him a good slap and get your car keys out. though, the champagne glass in one hand stopped you from doing so, and … dazai was oddly quiet.

“are you listening to me ? dazai ?”

the demon stops walking, causing you to bump into his shoulder. the booth was unoccupied and empty as dazai unraveled the curtains and pushed you inside without another word.

“hey, what is up with you ?” grabbing you by the shoulders, dazai sat you down on the plush of the small bench after closing the curtains. something was off, you knew it better than anyone else.

“is it the suit ? or the food ? do you not like it ?” dazai sits beside you, not moving a muscle. his shoulders are slumped as he zones out into your words. your voice drops into a softer tone, placing a hand on his arm. “if you wanna go home, just lemme know—”

“it’s not— ” the demon cuts himself off, looking into your eyes with a expression you haven’t seen on him before. his gaze is softer than usual, and his mouth is slightly open, as if he was going to continue.

“it’s not any of that. you just, y’know.” dazai turns to the screen, reading the words and tapping things he shouldn’t. placing a hand on top of his, you set the camera ready as the demon leans back and watches you.

“i’m your demon, y’know that, right ?”

“yeah, one that’s trying to either kill himself or my soul.” you could hear dazai chuckle at your tease, nudging you with a knee before crossing them.

“sure, sure. but i can’t have a bitter soul when i do take it away. those humans were making it bitter and that wouldn’t be satisfying to take.”

you hum in response before lean back, shoulder to shoulder with dazai. you point at the camera with a smile.

“we’ll take three photos. there’s gonna be a copy for both you and me ..!” you smile at dazai as the screen counted down from five. for a moment, dazai felt his non-existent heart beat. as your head turns to the camera to put on a bright smile, the demons eyes don’t leave yours.

shit, he thinks. the flash of the first picture is bright and snaps him out of his trance. the world becomes a haze as your lips move, brows furrowed slightly as you point at dazai’s lips and the only word he follows is ‘smile.’

the screen countdowns again from five, and dazai’s stomach drops.

shit, his mind goes again. by the time the screen flashes one, dazai wraps his arms around your shoulders, laughing suddenly and the camera flashes. his cheek is pressed against yours as he smiles brightly, eyes slit into crescent smiles. the third photo counts down, and you don’t even realize. you complain to the demon not to scare you like that, and dazai lifts his hands up in surrender. the lights flash again. one more picture. dazai was sure he’d make this one count.

fixing your hair as you two wait for the next countdown, you can feel cold hands brushing smaller strands of hair behind your ear. you look up at dazai and his eyes are unusually tender, soft and radiant.

“can i kiss you ?”

“what ?”

“can i kiss you ?” dazai asks again, grinning gently as your face grows red, feeling your ears burn. your eyes are wide and you don’t respond, you can’t. speechless, your lips are cracked open as you try to say something, anything, but nothing comes out. the final countdown arises, and the demons face is closer to yours, more than ever. as the screen glows with the number one, dazai gently kisses the corner of your lips, long enough for the camera to capture and short enough to not make the situation any more awkward than it is.

his lips are tender and sweet, the opposite of what you expected it’d be. a little chapped, but less than you thought. the first thought in your mind was the question of if he was teasing you, but the way he gently pulled away with half lidded eyes and a soft smile, the back of your mind hoped he wasn’t teasing. and, oh gods, your lips tingle as you silently watch dazai pull out the pair of photos, lined up nicely and small enough to put in your phone case.

“how adorable ! you can see your red face here !” dazai looks at the photos and point at the last photo taken as his lips on the corner of yours, laughing and handing you a copy. you want to punch him, throw him on the ground and leave. but …

something bubbles inside of you as you chuckle along with the demon. the silence is filled with laughter with nothing specific as the topic. you both subconsciously think, ‘how long as it been since i’ve laughed this hard about something so stupid ?’

[captainzigo]

Welcome to me blog

My kofi is https://ko-fi.com/captainzigo if you enjoy my art, consider leaving me a tip! this is otherwise entirely a labor of love so

**i still dont take commissions currently, but if you send a request with a donation, there’s a 99% chance i’ll do it. and that remaining 1% i’ll probably just ask you for a different request.

If you are a mutual, DM me for an invite to discord server and subsequently to minecraft server

if you aren’t a mutual, you can send DMs and asks to my sideblog @snapewife-divorce-lawyer

that’s a bunch of pictures of my oc(/ponysona) Prickly Pear. she’s a cowgirl

FAQ below the break

**if you send me a request with a donation you are not sending me a commision. you are making a donation, and i might do you a favor as a result. you do not own the resulting art. and I am under no obligation to complete it or to do it in the way that you like. you do not need to make a donation in order to make a request. You can send asks and DM‘s to @snapewife-divorce-lawyer 

i do take requests. i do not currently take commissions, but don’t be shy about sending requests. i can always say no. or fuck it up really bad.

this is my art blog. you can send me asks and DMs at my other blog @snapewife-divorce-lawyer any asks you send me should be like Strongbad emails. one paragraph. no attachments. unless you are sending me refs.

i reblog most stuff at my other other blog: @3amgaypotion

you are fine to DM me, but remember i am not obligated to respond at all.

in any interactions, please keep in mind that i am a stranger on the internet and act accordingly

i am autistic. i say this because representation matters, but also because i would like to ask that you please be very frank with me. i don’t even really need your patience. just say what you mean and we will get along fine.

you most certainly can draw any of my ocs. i’d love that acually. tag me

you can redraw, dub or do whatever to my works with credit. i expect credit to include clickable links. also please try to keep the spirit of the original work. don’t add nsfw subtext for example. don’t redraw a ship art as a ship with an inappropriate age gap, and so on.

do not post my art on other platforms. do not repost my art period. I don’t really exist on other platforms since I deleted Twitter. So if you see my stuff on other platforms, it’s not me. 

i’m in my twenties. i keep my blog SFW as a strict rule. PG13 except i swear a lot more. i do not keep myself that way, and i have no aversion to that sort of content, but i keep all of my posts SFW.

in my opinion, all romance real or fictional should be between people who are not related, similar in age, doing age appropriate things, all with mutual consent. i am not interested in witnessing or interacting with anything outside of these parameters.

i am a trans woman. i am also bisexual. i am also poly and demi since im listing things. i am out online becasue i know how important it is to know that you aren’t alone.

if you follow me and you post art, regardless of frequency or perceived quality, i want to be mutuals. shoot me a message or something

do i take constructive criticism? NO 🖕👹🖕 FUCK YOU!!!!!!! GET BLOCKED IDIOT!! unless you are a marginalized person who feels i have unintentionally made you uncomfortable somehow with my art or otherwise. in that case i am sorry and you do me a great favor by calling me out. OTHERWISE FUCK YOU DUMBASS IF YOU DONT LIKE MY ART GO DRAW YOUR OWN 🖕🖕🖕🖕

i don’t have a DNI list, but i am pretty left politically so you can probably imagine what’s on there.

“i hate bronies” i don’t necessarily hate you if you self identify with that label. i like to make myself off-putting to keep creeps away. i talk about it more in this post

i don’t hold a lot of nostalgia for old brony stuff. infact it’s quite the opposite

i like all generations of mlp including the new stuff. gen 4 is just the one i grew up with

why is my header aurora, bori and alice from the best gift ever? well that would be because i hate them like a mother hates a child. like the sun hates the moon. like sickly victorian child hates the slightest morsel of bread.

i often draw stuff about cozy glow x flurry heart. this is with the understanding that cozy glow spends about a decade turned to stone. nullifying the age gap.

i am dyslexic. i spell stuff wrong all the time and i type weird. please don’t bother correcting me. wooptydoo your brain is wired normally. sending you a medal.

i’ve had the same username since i debuted on the internet. zigo is the name of an oc i made that i dont really talk about anymore. zigo is a fine enough nickname and at least one person calls me that irl

[foxgloveprincess]

Pairing: Lloyd Hansen x Female Reader [Second Person Narrator]

Summary: Without meaning to, you start toeing a very dangerous line.

Word Count: 3,441

Attic Wives Anonymous Masterlist

Warnings: UnBeta’d, Dark (Soft Dark), Dubious Consent, Surprise Side Character, Unreliable Narrator, Smut (Kissing, Fingering, Vaginal Penetration, Cunnilingus, Anilingus, brief Spanking, Face Riding, Dirty Talk/mild Degradation, unaware Exhibitionism), talk of Food/Nausea, Fantasizing, Threats/Threatening Behavior, Possessiveness, Shock Collars, Pet Names (lollipop, sucker, etc.). Minors do not interact (18+).

A/N: Ooooooh! I’m so giddy about this one! Enjoy!

I love feedback, so go ahead and reblog if you want. However, I give no permission to copy, translate, rewrite or post my work on any third party website or app. Seeing my work posted anywhere beside my blog, my library blog, or my AO3 account (FoxglovePrincess) means it’s been stolen/plagiarized.

I don’t do tag lists, so follow @foxglovefics to sign up for notifications on my fics. 

Please DO NOT click ‘Keep Reading’ if you are not 18+ years of age or if you are uncomfortable with the pairing, themes, dynamics, or warnings. You are responsible for your own media consumption. Thank you!

Your head thumps with the pounding of the hammer. Curled up on your chaise, you try to take a nap to no avail. There’s no way you’ll be able to, not with your handler’s friend fixing the bed.

Shadow curls at your feet, resting his head on your legs. You’d tried to send the dog out to run through the garden—knowing how the noise must be hurting his ears. But he’d remained stalwart, immovable. Your fingers pet his wiry hair and you sigh.

The hammering stops and footsteps approach. You lift your head.

“It shouldn’t give you problems now,” the man says, low and gruff.

You try to remember his name—Carter? Curtis? Cory? Lloyd did introduce you when he arrived, but there’s nothing now. Unable to make the name materialize in your head, you simply say, “thank you.”

He crouches beside you, the sleeves of his flannel folded up by his elbows. His fingers, dry and slightly dusty, trace along the line of your flimsy skirt as it splays over the cushion.

“Is there anything else you need?” he asks. His tone suggests something more, the rough edges of it softening with his offer.

Shadow raises his head and looks to the man beside you. A deep, rumbling growl vibrates his chest. The man moves his hand, placing it instead right where your body bends in recline. Heat radiates from him through the thin fabric of your dress. You shift and fidget at the proximity.

“I’m handy with all sorts of things. And Lloyd told me to help you out with anything that came to your mind.”

He gazes up at you, blue eyes stormy. Though he wears a beanie over his head, feeding into the intimidation of his broad shoulders and bulky muscled frame, he’s gentle—it’s in his eyes, the way he looks at you. Ever so slightly, he rocks forward on his toes, invading your space.

“I—”

Your guard dog jumps from the chaise and moves toward the stranger. Not yet biting or baring teeth, he positions himself between you. Blocking him from you. The man concedes, falling back to his heels with a chuckle.

“Time for you to go, Everett,” a voice calls from the door.

A guard stands just outside the threshold, hand on the gun at his belt. You glance over with a smile. Nick Fowler, the new head of the estate’s security. He catches your eye and tips his head in acknowledgment. Bouncing up, you pad over on bare feet, careful of your invisible, electrified boundaries.

“Hi,” you greet, happy to see the man but perplexed by his presence. “I thought Mr. Hansen was home?”

“Business called him away,” Fowler says, eyes like a hawk, watching the repair man pack away his tools and grab his jacket. All with his hand ready to whip out his gun and take aim. He does that a lot when others are around—keep himself ready to protect you—even from his own men.

“Huh,” you mutter. His statement sinks in and disappointment washes over you—Lloyd had promised a nice day together. Only a few hours spent away in his office. His time with you promising the possibility of freedom outside your room in his company.

The repair man slips between the two of you through the door and huffs a quiet goodbye. He barely warrants notice. Your guard watches him. You do not when you echo a brief farewell.

“I was told to bring you this,” Fowler says, standing still but producing a folded slip of paper from behind his back. His eyes catch yours, deep as the ocean and set in quite the handsome face.

You snatch the note away and hold it close to your chest. Determined to read it once your guard has gone to escort the stranger out.

“Mr. Hansen will be back before you know it.”

“But I already know it,” you whisper in reply. Voice warbling across the words.

A warm hand lands on your shoulder, squeezing in sympathy. “You’ll be fine.”

You look to the hand, then the man to whom it’s attached, a slow and startled consideration. Your cheeks heat. His lips twitch toward an approximation of a comforting grin before he turns on his heel and marches after the man who fixed your bed.

Mr. Hansen sprawls across your sheets, shirt unbuttoned and groomed happy trail leading to the waistband of his trousers. Button popped open and a glimpse of his underwear visible. You lay tucked under his arm, fingers trailing over the planes of his abdomen and chest.

He hums in pleasure, the sound rumbling through you, pressed close as you are.

Eyes drifting closed, you’re nearly asleep when your handler says, “why don’t you pop up on my stache and give it a ride.”

Your thighs clench as a spike of desire rolls through you. It’s not a question, you know that. But you hesitate.

“Mr. Hansen,” you start, fingers walking up his chest. His chin dips to watch them. “I don’t want to hurt—”

Before you can finish, his hand wraps around yours and squeezes. “Fuckin’ smother me, lollipop.” He catches your eyes, blown dark with wanting. His tongue runs over his bottom lip and you shift in place, entranced by the movement.

Sitting up, your eyes remain locked. He drinks you in, thirsty for every movement. The way your head tilts as you pull your panties off your legs and toss them over the side of the bed. The way you shuffle forward on the bedding. The way your fists tug at the fabric of your dress, bunching it up your thighs.

He lifts a hand, an offering to guide you like a gentleman. One leg swings over, setting yourself astride him. Still slow, still cautious, you find your place over his face. His eyes blink slowly and he inhales.

“That’s what I love to see.”

You can’t bring yourself to look down at him, knowing his eyes will be sparkling with delight. The muscles of your legs twitch, itching to close and block him from the target of his desire.

“Look at this pretty thing.” His fingers brush over your folds and you jump. His teeth click in dissatisfaction. “Come on, sucker, keep her steady for me. I want a taste.”

His arms band around your thighs, coaxing you down. His hot breath puffs against you. Your teeth sink into your lower lip. Hands with nowhere to go, they wrap around his arms, hoping to keep yourself anchored to please him.

“Jesus, you’re dripping,” is the last thing you hear spoken under his breath before he starts.

He laps at you. Tongue flat to lick up the juices that coat the apex of your thighs. Your breath hitches, anticipation torture waiting for that first full swipe.

It comes with a long, sensuous lick. His tongue swirling around your clit and meandering through your folds toward your hole. He prods at it, mustache brushing against you in a tickling prickle.

On an exhale you whine and feel the reverberations from his responding chuckle. His biceps flex, dragging you closer and burying him between your thighs.

He devours as if you’re his last feast, reveling in each of the noises plucked from your throat. He flicks your clit and sucks. Your hips begin to move, undulations that grind you closer to him.

A muffled, “that’s it. That’s my candy slut,” comes from beneath you.

One arm releases your thigh. The fingers plunging into you and stretching you with a scissoring motion. You keen and try to lift away, but the strength of one arm keeps you planted. His moans shiver up your spine. Your teeth sink into your lip at the delicious tension gripping your muscles, tighter and tighter.

Flush with lust, you rock against your handler. This is your favorite part. Where you’re with him and you know you’re the one he craves. That in all his travels, across the world, right here is where he’s satisfied.

His fingers curl inside you, massaging that most sensitive place that makes your legs shake.

Your voice hums and sobs its pleasure. “I love you, Mr. Hansen.” The words burst out of you unprompted. Like this, there’s no memory of the violence he will commit for you. No memory of the collar around your throat. Just heat and sweat and fervor.

You shatter atop him, keening your ecstasy to the ceiling. Your fingers grip his head, body bowing over him and trapping him beneath you. You ride your bliss to the very last spark of pleasure. Delighting in the brush of his mustache and the final laps of his tongue.

Chest heaving for breath and legs weak, you use your arms to help push you up from your handler’s face. Coated in a sheen of your arousal, his lips part in an ecstatic grin.

“Fuck, sugar baby,” he moans, a hand reaching behind you to palm his cock through his pants and squeeze your ass. “Nearly got me creaming in my pants.” He huffs a few more breaths before his arm circles your waist and tugs on you.

With his strength and your cautious movements, it’s not long before he has you reversed. A plentiful view of your ass pointed right in his direction.

“Time to give your sweet little rosebud just as much loving,” he says, giving your cheek a hard smack.

You jolt forward, gripping at his muscles and biting back a needy whimper. Turning over your shoulder, you meet his eye. With one wink, he spreads your cheeks and begins his second helping. How his tongue can be as insatiable as the rest of his body, you don’t know. But you bend further over, supporting yourself with his body and giving him access to all of you.

A noise catches your ear. Taking your attention away from the delectable sensations enacted by your handler. Scanning the room, you see the figure in the doorway. Backlit by the hallway light, but still visible from the lighting in your room, you recognize your guard. Nick Fowler, piercing through you with his gaze.

Nick’s hand grips the doorknob tight before it slips off. Lloyd circles your already sensitive clit with his fingers. Your cheeks heat with embarrassment as your lips part on a wanton moan.

But you don’t look away—and he stares right back. A dark look of hunger in his eyes. You clench around nothing, feeling absolutely empty. A whine works its way up your throat. Nick swallows and lets his lips part.

You don’t move and neither does he. Lloyd none the wiser about the performance he’s putting on, the exhibition he’s making of you. Not that Nick can see anything. Your dress still covers your figure, only your missing panties allowing Lloyd access to your puckered hole and dripping cunt.

You gasp. Your handler fingering your ass, ready to stretch another hole open. Nick’s jaw ticks, fist clenched at his side. Never blinking, never looking away.

None of the others kept their eyes on you. Whenever Lloyd chose to display you, they always averted their gaze. Lloyd’s exhibitionism a power-play, exerting his control over his staff. Making them cower from him and hide their lust or envy or rage. Not Nick. He’s steady, unrepentant.

And doesn’t that set you alight. A titillating, tingling pleasure that shoots straight to your core and overwhelms.

Your breath catches in your throat, voice pitching higher and higher on each new moan. Eyelids fluttering, threatening to close, you keep them locked on the guard at your door. Even as you cum again, oversensitive and weak, shouting Lloyd’s name, you keep your eyes on Nick until he withdraws on swift, stilted steps.

“I have your breakfast.”

The guard leaves the tray at the foot of your bed. You watch him from the corner of your eye, Shadow sitting beside you. He leaves without a care—rookie mistake. And it’s eggs, too.

You sigh and tilt your head back on your neck. It’s not like you want him to get in trouble, but you absolutely cannot eat right now. Your stomach clenches and flips with nausea.

The smell of the food wafts toward you and you recoil. At least it spurs you to get up from your bed. You stand and saunter toward the French doors leading to your balcony.

Fresh air greets you. A cool breeze nipping at your skin. A quick jaunt back into your room finds the right blanket to bundle you up and keep you warm in the morning air. It nips at your cheeks and ears, but you watch the horizon. The soft sun rises in the distance splashing the sky in pastels. You wonder how warm it will be as it keeps on its path.

Thoughts drift on lazy tangents. A bird flits by. You watch it disappear around the corner of the mansion. You fix Shadow’s collar with a few small tugs until the tag hangs directly in the center of his chest.

“Off to the garden,” you bid him, using a finger to point over the balcony rail. Shadow woofs in reply, his stubby tail wagging vigorously. “Go,” you prompt in encouragement.

He darts away, out your door and mere moments later, he’s running through the grass.

You push yourself from the chair and lean against the railing. Watching your guard dog play. From a basket off to the side, you grab a ball—small and orange, one of Shadow’s. You finger it, turning it over and over in your grip. Preparing to shout his name, your lips part before you’re interrupted.

“You should eat.”

You spin on your heel like a child caught with their hand in the cookie jar. “What do you mean?”

Nick stands beside your bed, hands crossed and head nodding toward the full tray of food.

“He’s the one that just left it there. They’re probably cold by now,” you say with a vague gesture of your hand.

“So he deserves what Lloyd will do to him?” Nick asks. He steps forward, hands falling to his sides. “He’s a good guy.”

This time, your head tilts. Contemplating the statement. The absurdity, the hypocrisy.

“Eat your damn food before I have to find another guy to replace him,” Nick commands, a pointed stab of his finger toward the tray. His jaw ticks in irritation, the frustration growing every second you don’t move.

“I’m not hungry,” you say, returning to the room and dropping the blanket on your chaise. Your lip curls at the smell as you approach. Your scheduled breakfast for the day—bacon, eggs, pancakes, orange juice. You swallow and turn away. “I’m not eating that.”

“Then is there something else you’d prefer?” His tacked on, “you goddamn brat,” at the end hidden under his breath.

“No,” you reply, stinging from his gibe. The bubbles of your own vexation start to roil in your stomach.

Nick turns away, jaw clenched and brow furrowed. His fingers twitch toward his holster, ready, you suppose, to point it at you in a threat. Your own anger cools. The lengths he will go to keep his men safe. Both of you knowing how exacting Lloyd can be—the consequences of his displeasure.

“I woke up nauseous,” you explain, voice soft, “I didn’t want to throw up.”

The tension seeps away from the set of Fowler’s jaw and shoulders. A slow loosening of his stance until he can look over at you again. And he pins you in place with his stare—hard on the surface with the shadow of something gentle beneath. That one look flooding you with a wave of contrition.

“It’s my fault for not saying something earlier. I’ll explain it to Lloyd,” you offer.

“No,” Nick says with a swift shake of his head, a step taken in your direction, “let me.”

You nod, hands folded before your waist. His heel lifts to take another step forward, but he turns instead, grabbing the breakfast and walking from the room.

Only a few minutes later, a new tray with a plate of saltine crackers and ginger beer arrive at your door. Carried by the same rookie as the first.

“Thank you,” you say, grasping the handles and taking it to your small table to nibble.

Your fingers tug at the pillow beneath your head. Hips canting up to meet Lloyd’s voracious tongue. Lips plump and tingling from how hard you’ve bitten them, keeping salacious moans at bay.

Lloyd’s eyes lock with yours from between your thighs. His brow furrows in frustration. Needing to hear your ruin dribble from you as you melt. You’re denying him and he won’t have it.

Smack. The slap to your thigh jolts you, a gasp finally pushing past your defenses. Your head lolls to the side, catching Lloyd’s eye again before, satisfied, he returns to your cunt. Knowing he’ll only fuck you when you’re a sloppy, soaked mess, you wrap a leg over his shoulder.

He groans against you, hand running along the skin of your thigh. His hips buck against the bed beneath him, easing the tension of his own arousal. His salacious display, rocking against the covers of your bed, smearing them with his precum, has a wisp of a moan slipping past your lips.

Until movement catches your eye. A glance to your ajar door sees Nick passing by, gaze locked forward and purpose to his steps. All your restraint frays to nothing. Lips gaping around sounds ripped from your chest.

“That’s more like it,” Lloyd chuckles against your sex, raising himself to his elbows and crawling over you.

You blink up at him and accept his kiss when he leans down. Your taste floods your mouth with his tongue. Tickled by his groomed mustache, it fills your nose. Your arms wrap around him, submitting to the filthy play of his kiss.

Yet at the very precipice of penetration, he becomes impatience at its finest. Lloyd lines himself up, thrusting into you in one swift stroke. You gasp and whimper against your handler’s lips and let your eyelids flutter shut.

In the darkness, your thoughts run wild without your permission. Lloyd’s hips burying his cock in you, and catapulting you toward fantasies of the stalwart, stoic guard and his unrelenting gaze. Your handler’s touch turns to Nick’s. His hands, his skin, his cock. And it feels too good to stop yourself.

You cry out on a particularly exquisite thrust and Lloyd pulls out, flipping you to your hands and knees. His head tucks against your neck, kissing along your throat. Caught up in your fantasy world, your head drops toward your chest on a low moan. Fists gripping the sheets beneath you.

“Please, more,” you pant. Feeling Nick’s hands grasping at your flesh and moulding your body to his.

“You like this, lolli?” Mr. Hansen asks, voice gritty and growling. “You should feel the way you’re squeezing me. Like you never wanna let go.”

Your head bobs in a nod, distracted by imaginings of what Nick would say, how he’d praise you, how he’d fuck you. The thought of him saying, “good girl,” has your arms buckling and your body falling to the bed, your hips supported by Lloyd’s strength. A constant humming moan rolls in your throat, filled to your limit by Lloyd’s cock and figments of Nick.

Your orgasm rushes over you like river rapids. A sudden flood of sensation breaking over your head and dragging you under.

But it all stops in an instant. Lloyd’s body still. His grip a harsh vice on your hips.

“What did you say?”

You swallow hard and blink your eyes open before turning over your shoulder, meeting Lloyd’s fiery gaze. Your stomach drops to your toes, throat suddenly dry. You can’t answer his question, you didn’t catch it yourself. Mouth run away with your thoughts…your thoughts.

Eyes widening, you say, “I don’t know, Mr. Hansen.” Hoping for some measure of pity.

“Nick,” he bites, “you called me Nick.” His hand wraps about your throat and drags you up against him. Right in your ear he whispers, “does that sound about right?” Teeth nipping against your ear, you squeak. But that doesn’t stop your handler. A sinister chuckle rising from his chest. “Nick fuckin’ Fowler.”

All at once, you’re free of him. Shoved into the bed as Lloyd stands at the foot. He takes one long, lingering look. Expression hard and unreadable. You reach out to him but he turns on his heel. Stalking out of the room, shoulders set, a predator after its prey.

[doodlebeeberry]

It's that time of year folks!!!

Very very excited to host the gift exchange once again! Past two years have been a ton of fun, so lets hope the third is even better!

if you wanna join, just reblog/reply to this post or dm me with what you'd like. full rules, dates, and details are under the cut, please read those fully first before joining!!! :]

Entries close midnight (est) November 27th!!

For the uninitiated, the osc gift exchange is exactly what it sounds like! you let me know via reblog/reply/dm what you'd like as part of your gift--whether that's a certain show, character, ship, oc, anything! Then, you'll be randomly assigned a giftee and will make a gift based on their request. Finally, once the day comes, you post your gift and @ the person its for!

the timeline looks like this:

Nov. 11-27: enter by letting me know what you'd like! as with previous years, I ask that you keep your gift requests sfw, and to please send me references for any ocs you may want as part of your gift. As well, if there's anything you cant do (ie, a character or paring that makes you uncomfortable) please let me know when you join!

Dec. 1: I'll let you know who you've been assigned! please be sure you have dms (or at the very least asks) open for this bit!

Dec. 1-30: Make your gift! this can be anything from art to writing to music to needlepoint--so long as you include the giftee's request, the possibilities are endless!

Dec. 31: post your gift, and be sure to @ who its for in the post! Please do not post your gift before this date!!! if for whatever reason this date does not work for you please let me know and we'll work something out!!

Assorted other things to note:

please make sure your gift requests are osc/ object show related! if you dont know what that is then this likely isnt the gift exchange for you lol

you dont have to do everything your giftee requests if you dont wanna. If they give you a list of 20 characters, you can pick 1, 5, 10, all 20, the choice is up to you!

if you need to drop out for any reason please let me know as soon as possible so I can reassign your giftee

not a hard and fast rule but if you could shoot me a message when you get your giftee letting me know you saw the message, itd be much appreciated!!!

you can not join anonymously! It wouldnt be fair to your giftee, in my mind, if you did :]

on a related note, while i try to make the exchange as open to everyone as possible, if i deem it necessary i can and will bar you from participating if your inclusion would be detrimental to other giftees. while i dont anticipate needing to do so (so there isnt really a reason for you to worry about it) this was an issue last year. In the very unlikely event that I dont let you join, please dont yell at me about it. just accept it and move on.

as per usual, ill be using the tag #osc gift exchange for the event, so feel free to tag your posts so i can find them! :D

And that's it! if youve got any other questions or comments, feel free to ask and ill do my best to answer them! Thank you! ^-^

[do-you-know-this-adhd-character]

SUBMIT THROUGH THE FORM IN THIS POST, NOT MY ASKBOX, FOR YOUR BLORBO'S SAKE. I WILL LOSE SUBMISSIONS IF THEY AREN'T ALL IN ONE PLACE!

Hi! I've never run a poll blog before, but I like the "do you know this character" type blogs and I searched and didn't find one for ADHD characters so I decided I'd make one!

Submission Guidelines

Both canon and non-canon ADHD characters are allowed, but YOU MUST PROVIDE EVIDENCE FOR NON-CANON ADHD CHARACTERS! I completely understand just looking at a character and going "oh they have the Vibes" but it's not enough to be posted on this blog. Even just "they exhibit a lot of impulsiveness and distractability" is enough for me to go on - just give me SOMETHING to work with. However I reserve the right to not post a character if I don't think the evidence is compelling enough, i.e., if you don't list any traits that are specific to ADHD.

You may not submit real people, only fictional characters. I find it disrespectful and uncomfortable to speculate on the mental health of real people, and will not be posting those for my own comfort, even if those people will likely never see it. Also, the point of this is characters, not real people, so even people who have said they're ADHD won't be posted.

YOU MUST SUBMIT THROUGH THE FORM, NOT MY ASKBOX. I am, of course, ADHD myself, and I need all the submissions in one place or I'll lose them.

Got it? Here's the link to the form.

About the Mod/Blog

You can call me Mudkip if you'd like, or my name, Réka. She/her only please, do not use any other pronouns for me including they/them. I am an adult. I was diagnosed with ADHD at a very young age and have it bad enough that I consider myself disabled. So ADHD rep is very important to me! And I'd like to both learn about ADHD rep I might not have heard of, and spread awareness of what ADHD people are like through the characters that people might not even realize are like us.

My icon is the character 707/Seven from Mystic Messenger, I chose him because although it's a bit hidden he is canonically ADHD! There's a call where he talks about how he talks to himself, and if you say "I heard people with adhd talk to themselves a lot..." he agrees with you, as well as displaying other ADHD traits through the whole game.

...is this entire blog partially part of my agenda to spread the word of canon ADHD Seven? Maybe.

Header is Zack Fair from Final Fantasy VII; he's not canonically ADHD but there's strong evidence for it and I couldn't resist using the "Me? Gongaga." meme.

I often can't resist making non-poll posts on this blog, although I swear I try. If you're just here for the polls you might want to filter the tag "not a poll"!

My main is @hungarianmudkip69 .

Tagging System, for your searching or filtering convenience

#poll - the polls. this only includes "do you know this character" polls, not any other polls I might do.

#not a poll - anything that doesn't get the above tag. Including other types of polls. You know what I mean.

#canon adhd character - polls for characters that are canonically ADHD.

#noncanon adhd character - polls for characters that aren't canonically ADHD, but have solid evidence behind the headcanon.

#poll results - a reblog of an ended poll with calculations of how many people know the character and what percentage of those people know/see the character as ADHD.

#poll reblog - any reblog of a poll that isn't poll results.

#other polls - polls from other blogs.

#blog management - anything about the running of the blog.

#ask - asks. I don't know what else to tell you.

#approval inquiry - asks asking if a character has been approved for posting.

#submission inquiry - asks asking if a character has been submitted.

this was part of the original pinned and I always like seeing this part of poll blog pinneds so I'm leaving it

I'm supposed to tag other polls for visibility, right? This was largely inspired by @who-do-i-know-this-man and @doyouknowthisdisabledcharacter as well as @do-you-know-this-queer-character !

If you want to know if someone's been posted, check below:

Polls in progress:

707/Saeyoung Choi from Mystic Messenger (canon)

Kyle Klimson from The InBESTigators (noncanon)

SpongeBob SquarePants from SpongeBob SquarePants (noncanon)

Sherlock Holmes from the original Sherlock Holmes stories (noncanon)

Evan "Buck" Buckley, from 9-1-1 (canon)

Meg Murry, from A Wrinkle in Time (noncanon)

Bokuto Koutarou, from Haikyuu!! (noncanon)

Finished polls (under the cut):

Quicksilver/Pietro Maximoff from the X-Men movies (noncanon)

Rumpleteazer from Cats the Musical (noncanon)

Bobby Drake/Iceman from DC Comics (noncanon)

Karlach Cliffgate from Baldur's Gate 3 (noncanon)

Evelyn Wang from Everything Everywhere All at Once (canon)

Osana Najimi from Komi Can't Communicate (noncanon)

Barbara Gordon/Batgirl/Oracle from DC Comics (noncanon)

Sora from Kingdom Hearts (noncanon)

Dr. Coomer from Half Life VR but the AI is Self Aware/HLVRAI (noncanon)

Johnny Gat from Saints Row (noncanon)

Bart Allen/Impulse from DC Comics (noncanon)

Michael Tate from Greater Boston (canon)

Uraraka Ochako from My Hero Academia (noncanon)

Etcetera from Cats the Musical (noncanon)

Richie Tozier from IT (noncanon)

Gary Smith from Bully/Canis Canem Edit (canon)

Leslie Knope from Parks and Recreation (noncanon)

Leonardo from Rise of the Teenage Mutant Ninja Turtles (noncanon)

Mungojerrie from Cats the Musical (noncanon)

Achilles from the Iliad (noncanon)

Tajima Yuuichirou from Ookiku Furikabutte/Oofuri/Big Windup (noncanon)

Benrey from Half Life VR but the AI is Self Aware/HLVRAI (noncanon)

Crowven Corvuson from Cemetery Mary (canon)

Martlet from Undertale Yellow (noncanon)

Zell Dincht from Final Fantasy 8 (noncanon)

Skimbleshanks from Cats the Musical (noncanon)

Goku from Dragonball (noncanon)

Yuma Tsukumo from Yu-Gi-Oh Zexal (noncanon)

Moritz Stiefel from Spring Awakening (noncanon)

Sydney 'Syd' Novak from I Am Not Okay With This (noncanon)

Yuki Takeya from Gakkou Gurashi/School-Live! (noncanon)

Annabeth Chase from the Percy Jackson series (canon)

Maria von Trapp from The Sound of Music (noncanon)

Lift from The Stormlight Archive (noncanon)

Tim Drake from DC Comics (noncanon)

Monkey D. Luffy from One Piece (noncanon)

Apollo Justice from the Ace Attorney games (noncanon)

Stella from Winx Club (noncanon)

Roy Harper from DC Comics (canon)

Michelangelo from Rise of the Teenage Mutant Ninja Turtles (canon)

Tony Stark from the Marvel Cinematic Universe (noncanon)

Aiden Clark from School Bus Graveyard (canon)

Serpaz Helilo from Vast Error (canon)

The Doctor from Doctor Who (noncanon)

Ronan Lynch from The Raven Cycle (noncanon)

Leo Valdez from the Percy Jackson books (canon)

Moth Flight from Warrior Cats (canon)

Ramona Quimby from the Ramona books (noncanon)

Joey Pigza from the Joey Pigza books (canon)

Anne Shirley from Anne of Green Gables (noncanon)

Spinner Mason from Degrassi: The Next Generation (canon)

Lupin III from Lupin the Third (noncanon)

Rainbow Dash from My Little Pony: Friendship is Magic (noncanon)

George Beard and Harold Hutchins from Captain Underpants (canon)

Alex Woodroe from All the Feels (canon)

Agent Curt Mega from Spies are Forever (noncanon)

TG from Castle of Nations (canon)

Shawn Spencer from Psych (canon)

Sydney Scoville Jr. from Grrl Power (canon)

Marinette Dupain-Cheng from Miraculous Ladybug (noncanon)

Zagreus from Hades (noncanon)

Sherlock Holmes from Sherlock & Co. (canon)

Ash Ketchum from Pokémon (noncanon)

Misfire from Transformers (canon)

Herlock Sholmes from The Great Ace Attorney Chronicles (noncanon)

Christine Canigula from Be More Chill (canon)

Aubrey Little from The Adventure Zone: Amnesty (canon)

Lt. Columbo from Columbo (noncanon)

Billie from Billie Bust Up (canon)

Wei Wuxian from Mo Dao Zu Shi (noncanon)

Jimmy Casket from VenturianTale (noncanon)

Sara Eriksson from Young Royals (canon)

Magnus Burnsides from The Adventure Zone: Balance (noncanon)

Scout from Team Fortress 2 (noncanon)

Luz Noceda from The Owl House (canon)

Zack Fair from Final Fantasy VII (noncanon)

Percy Jackson from Percy Jackson and the Olympians (canon)

April Polls' Day posts, for posterity - ran polls on non-ADHD characters:

Twilight Sparkle from My Little Pony: Friendship is Magic

Zenos yae Galvus from Final Fantasy XIV

P.I.X.A.L. from Lego Ninjago

Brutus the Ducky from Real Life and also Rubber Ducky Hell (our only canonically non-ADHD poll subject)

Sophia from Stranger of Paradise: Final Fantasy Origin (please play it)

[reversal-au-asks]

ASK KASPER AND LAMPERT FROM REVERSAL ANYTHING YOU’D LIKE!

The rules, regulations and information for this ask blog are listed below.

above is the logo for this AU. Ask before using!

A bit of background before we get into rules and all of that,

This ask blog is for the Reversal AU. If you don’t know what that is or you’ve never seen it before, please look at this website for more information, or read below!

THE STORY:

Reversal (or Reversal Au) is an alternate universe inspired by Regretevator and SCP-3008, and it follows the characters Kasper and Lampert. But, instead of Kasper becoming the infected one who forgets his best friend, the roles are reversed. Essentially, Lampert becomes the one who forgets his best friend instead. So, this entire story and universe is centered around that and how the two acted back then versus now.

How did he forget?

Lampert, unfortunately, forgot his best friend, Kasper, because he was brainwashed. He was in the wrong place at the wrong time, and was almost killed before the employees of SCP-3008 realized that his abilities could be useful.

So, instead of leaving him to die, they took him and brainwashed him to use him as a valuable asset for their ever growing hive mind army, in hopes that they can one day be able to possibly achieve more than what they currently have now.

(please view the website that I also linked above for all of the links to the creators who inspired this AU!)

RULES/BEFORE YOU ASK..

This ask blog is ran and created by one person. ( @n3ptun1cal , they/them or ask!) With that being said, please be patient when it comes to possible slow response times or anything of that sort. This is a one man project!

You are welcome to ask the author things and/or you are able to ask Kasper 🎮 and Lampert 🛋️ things directly as well! Out of character responses, or responses from the author, will be tagged accordingly with “ooc response” beforehand to make it less confusing. Also, please specify who you’re directing your question(s) towards! For example, putting “for Lampert-” or “for Kasper-” at the beginning of your asks, (you can even ask both of them if you’d like) Specifying these things helps me know who to draw responding to the ask though so it’s really helpful!!

This story is dependent on the audience to find out and piece together themselves. There’s so much more you are all able to find out just through asks! You never know what things you might uncover with just a simple ask..

Do NOT ask or say anything suggestive or sexual about these two. They are both aroace, and the owner of this blog is aroace as well. Please respect that!

This AU is not a ship, at all. They will never love each other, they were just really close friends who even could be considered brothers.

I have the right to delete any ask or refuse to answer any ask that I may deem against the listed rules and regulations, and I have the right to block anyone who makes me uncomfortable. Please contact me directly and privately if you have any issues!

Please ask questions in our inbox on this blog only, questions in the comments will most likely not receive answers!

All ask blog posts will use the #reversalasks tag.

THE CURRENT DESIGNS FOR REVERSAL KASPER AND LAMPERT:

[chronicbeans]

Let's Make a Deal! (Yandere Queerplatonic Alastor x Fallen Angel Reader)

Part 3: Deal, dear?

Part 1, Part 2

Tag List: @repostingmyfavs

TW: Invasions of Personal Space, Shady Deals

As much as you hoped having that conversation would stop Alastor from staring at you, it only seemed to make things worse. Now that he knows you are open to talking to him, he's gotten into the habit of walking over to you, asking you invasive questions, then walking away. Usually something along the lines of "Do you miss your family? Did you have any family in Heaven? Have you had a relationship before? If not, why not?" Then, he'd end the conversation with something more lightheaded, such as "What's your favorite color? Do you prefer coffee, or tea?". After that, he'd just leave. You feel way too unnerved and uncomfortable to say no to answering, most of the time...

A lot of his questioning seems to revolve around family, for some reason. You've also noticed Alastor becoming much more touchy with you. Not necessarily in an inappropriate manner, though. More like a sudden arm around your shoulder that lasts much longer than before, a hug, or him suddenly holding your hand. You don't really mind. It's definitely a lot better than you expected from somebody in Hell, but it's still noticable.

Today is one of those days, as you're sitting on the couch in the main lobby, watching some television, when you suddenly feel Alastor sling an arm around your shoulder. "Dear, what are you doing, looking at that picture box? I'm sure that there couldn't possibly be anything of interest on it."

You look up to him, raising an eyebrow. "Well, there's a nice show on. So I want to watch it-" You're cut off by him shutting off the television. "Well, I must speak with you about something. I want to make a deal with you, dear. Deals are much more important than a dumb little picture box." He then stands up, pointing to you. "You fell out of Heaven due to someone convincing them that you deserved such damnation, correct?"

You stare up at him, surprised by how forward he is being. You raise an eyebrow at him, crossing your arms. "Yes... but what-" "I want you to convince them to drop someone else from Heaven's grace, down here, into Hell." "What?!"

You then stand up, confused and dismayed. "You must be joking, Alastor- this joke isn't funny! Why would you possibly believe I'd be willing to do such a thing? Nobody deserves to be cast out due to an over exaggeration or lie!" You glare up at him, only to be surprised once you notice his ever present grin looking extremely strained.

His voice fills with static as he points to you, his eyes seeming to glow with either irritation, or desperation. "Dear, you're my friend. I promise you, whatever you want in return for this favor, I'll give it to you." You instantly lean away, continuing to glare. "I never agreed to be your friend." "That doesn't matter. You're my friend whether you like it or not. Please. At least consider it. Consider all of the things you could get out of this deal!"

You think, genuinely... At first, you are going to say no, but... what if he can get you to Heaven? Or, at least, find a way to increase your chances of getting to Heaven? "... Fine, but you have to try to find a way to get me into Heaven... Not just so I can get whoever you want to damn down here, but also so that I can return there. For good." Alastor pauses, before nodding, though you can tell he is upset. "Fine, dear. I suppose that is fair."

He then walks over to him, smiling. "The person I want you to get damned, is... actually, come over here. I don't want anyone else to hear." You nod, walking over to him. He quietly whispers a name into your ear, alongside a few of their negative traits, before pulling away. "I'm sure Lucifer may be able to help you set up an appointment with Heaven... it might just take some convincing on my end to get him to agree..."

"Well, why do you want this person damned, Alastor...?" You stare up at him, flinching as his smile turns cold, for a brief moment. He then looks away from you, before his eyes snap back towards you.

"You'll understand once they get here, my dearest friend. Now, shake my hand, and the deal is sealed. I'll get this person into Hell, and you'll get your precious home in Heaven back."

Without hesitation, you grab his hand and shake on it. Alastor's grin widens as you do so, but you barely even notice it. Your thoughts are trained on getting the poor sap he mentioned into Hell, even if you'll feel guilty in the end... you don't know how much longer you can stand being in Hell with him constantly looking over you.

[mx-werebat]

Hey! This is a tag list I'm making both for here (mx-werebat) and my nonhuman blog, batsbolts-andfangs.

This is going to be a list of things that I respectfully ask my mutuals to filter tag, whether it be in respective tags, or in tags that mutuals made for me to filter things out. Those tags are #batty please ignore this, and #tagging for vamp.

// pt: This is going to be a list of things that I respectfully ask my mutuals to filter tag, whether it be in respective tags, or in tags that mutuals made for me to filter things out. Those tags are #batty please ignore this, and #tagging for vamp. //

None of this is forced, but absolutely encouraged.

// pt: None of this is forced, but absolutely encouraged. //

Last edited [mm/dd/yy/]: 06/24/24

// pt and without abbreviations: last edited in a month / day / year format: June 24th, 2024 //

Reblog bait - Posts along the lines of "reblog if you support [insert thing]", "reblog if you're not [insert horrible thing]", etc. Essentially anything that makes you feel pressured to reblog. Can't tell? Maybe put one just in case.

Fatphobia - Any posts delving into the topic of fatphobia, or with someone actually being fatphobic in it. I am fat and this can trigger my body dysmorphia, which isn't good in the slightest.

Syscourse. Self explanatory, anything to do with system discourse.

Dra/cul/aura x Reader posts - Self explanatory, basically any posts that pertain to Dra/cul/aura in a x reader type post, whether it be an actual story, headcanons, or whatnot. It makes me uncomfortable as fictionkin and I would rather not being thought of as dating someone.

Demonic art (i.e. art of demons, demonic entities, evil spirits, anything that's related to demon-esque horror) - I get paranoid easily and could be sent into paranoia fits from shit like this.

Anything that could cause body dysmorphia - This is a more personalized thing, however I do also ask mutuals to use their best judgement.

The things I've noticed that cause body dysmorphia for me are: furry art of plus-sized cows and plus-sized anthropomorphic cows in general, suggestive things about fat people, and fatphobic things that were talked about above. There could be more, and if there is, I'll definitely add them.

Omegaverse - Anything that is tagged omegaverse or its other terms, anything that talks about it, or things like omegaverse flags. Basically omegaverse content in general.

Alluding to romance with vampires - Posts where OP, or someone reblogging the posts, talks about wanting to have a romantic relationship with a vampire. This does not include OCs and fictional characters talking about such, just actual individuals. I am a very romance repulsed vampire.

Monsterfucker content - anything that pertains to that subject or even mentions it. As a vampire it makes me uncomfortable and disgusted.

Mentions of Count Dracula - This is on due to Ula. She does not take well to Dracula, at all. He was her creator, and as her I hold great trauma about him. This pertains to Bela Lugosi's Dracula and Monster High's Dracula, not any other variants (i.e. the book one, Gary Oldman one, Hotel Transylvania, etc.)

Dead bats - This includes (but is not limited to): bat carcasses, dead bats in frames, bat taxidermy, skulls, skeletons, wet specimens, and anything alluding to the death of a bat. Dull reminder that bat taxidermy is unethical and I will block you if you own bat taxidermy and constantly post about it.

// pt: dull reminder that bat taxidermy is unethical and I will block you if you own bat taxidermy and constantly post about it. //

Vampire hate - essentially anything that hates on vampires. I feel this is self explanatory.

Trolls / anon hate - also self explanatory. Essentially when you reblog or answer to anon hate or trolls.

Belly rubbing - any posts that talk about wanting belly rubs, or even images of it happening (to a human body. Animals are exempt from this.) This is due to my hypersexuality.

Discourse and Infighting - essentially anything related to discourse and infighting within these communities listed;

Non/alterhuman identities

Monster High fandom

An example of discourse would be discussions around if a certain identity is valid, as well as the current (as of the edit date) misanthropy discourse.

This is to prevent me feeling pressured to state my opinion. I simply cannot do such anymore, it's ruined my mental health.

This list is always subject to change. If you're unsure of what to filter tag, feel free to check on this post every so often. It will be linked on the introduction posts for both this blog and my nonhuman blog.

// pt: This list is always subject to change. If you're unsure of what to filter tag, feel free to check on this post every so often. It will be linked on the introduction posts for both this blog and my nonhuman blog. //

Please like this post to let me know you've read it.

// pt: Please like this post to let me know you've read it. //