#snake faqs

[is-the-snake-video-cute]

Snake FAQs: Eating Questions

Some of the most common concerns I get are "hey, is it normal for my snake to do x while eating?" I wanted to make a quick cheat sheet for new snake keepers who might be concerned about their snake's behavior while eating!

Is it okay if my snake tries to eat their rodent backwards/sideways? Yes! This is a very common mistake young snakes make. They will figure it out!

My snake is a constrictor, but they didn't wrap their meal. Are they okay? Yes, most constrictors will wrap most of the time but some won't. As long as your snake is eating, there's no concern!

My snake dropped their rodent and can't find it! What should I do? The best thing you can do is leave them alone for a bit! If a snake is actively looking for their meal, they're very likely going to find it again and finish it. Taking it out and re-offering can break their concentration or frustrate them, so just give them space to figure it out on their own!

Should I be worried if my snake swallows some substrate? Not at all. Impaction caused by substrate ingestion in healthy snakes is a myth. Your snake will be fine!

I heard a noise while my snake was eating! It's not unusual to hear pops or squeaks as your snake eats, especially for larger snakes eating bigger meals. Sometimes you will hear gas being released from the dead rodent as your snake eats. If you hear the noise only while your snake is eating, it's nothing to be concerned about.

Is it normal for eating to take a while? Yes! Constrictors can take their sweet time. Don't be concerned if you check back in half an hour and your snake hasn't finished their food yet.

Is it normal for my snake's head to shake as they eat? Yes, actually. As your snake eats, they'll often pick up the rodent and lift it so they can use gravity to help slide it down. It can be a heavy weight to lift with their little necks, so a bit of shaking is normal. If you notice shaking at other times, that's concerning, but it's normal during eating.

My snake's jaw looks crooked after eating, are they okay? Again, perfectly normal! The bones in snakes' jaws can move independently of each other, and they will need to stretch their jaws and re-align them after eating. It's perfectly normal for them to look a bit funky after finishing a meal!

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[mrghostrat]

Can we get a look at your arm tatto? Is a lil snake right?

YEAAA that’s my lil guy! he’s a bit blown out now but i still adore him. he keeps his bee friend safe.

[yamujiburo]

HANAMUSA (JESSIExDELIA) MASTER POST

I probably should have started doing this forever ago but I wasn’t sure how long I was gonna stick with drawing these comics. But I guess we’re in it now! This will be continually updated~ EVERYTHING UNDER THE CUT

BEFORE YOU START:

This post is required reading about Team Rocket’s ages since that’s usually a question that comes up a lot LOL. As for Delia’s age, she is said to be 29 in Takeshi Shudo’s (original writer on Pokémon) novel that built out the world and characters of the anime.

Next, I feel like this chart helps give the vibe of what these characters relationship is (all just headcanons except for their names and ages)!

WHERE TO START:

Here’s a post I made detailing how Jessie, James and Meowth initially start living with Delia. It also goes into what each character does in this AU. Before going into the post, you might enjoy this fanfic my girlfriend commissioned! It’s based off of said post and is a more enjoyable read.

Here’s also a list of headcanons!

COMICS:

Here’s all the comics I’ve done! The order of most of them are pretty ambiguous and up in the air but I put them in the order I kinda see in my head! There are some that do take place before Jessie and Delia start dating though! Also a few comics that have several parts but the “next” and “prev” links will be in each comic. So I’ll only link the first part of those ones in this masterpost.

Pre-Relationship

Fast Food

Ophidiophobia

Boss 🌟NEW🌟

Whipped

Making Eyes

Hairbrush

Inquiries

Separated

First Kiss

Dating

Big Bed

Tattoo

Crumbs

Pet Clown

I’d Like To

Jessica

Lipstick (not a comic but some fun extra dialogue for this)

Glow

Sleeptalking

Official

Early Relationship

Stare Down

Shovel Talk

Invisible Walls

Date Help

Date Night

Face Blind

One Motto Away

Babygirl

Snowgasboard

Delia’s Got a Cold

Mr. Jessie Ketchum

Peek-At-Chu

Hands Off Pikachu!

Wine Nights with James

Beauty and the Beach

Turning Point Arc

Sunscreen

Where Do Babies Come From

Head Scritches

Love Life

Ugly

Ace Trainers

Pikasitting

During Relationship

Mother’s Day

Father’s Day

Gift for Delia

Gift for Jessie

Jessilina Fan

Crossdressing

Type

Hickeys

Journey Arc

Tone

Cooking Twerp

Son

Cooking Advice

Serperior Facts

Cassidy’s Cabin Arc

Father/Son Bonding

Worry 🌟NEW🌟

Later in Relationship

Uniform

Paparazzi

One Upping 🌟NEW🌟

Hand-Me-Downs

Glasses

Study Help

Happy Valentine’s Day

Wrapped

Daddy Daughter Double Battle

Splinter

Married Life

Wedding

Arbok/Weezing Reunion

Snake Eyes

FAQ:

There's a hanamusa section in my FAQ!

[toxicanonymity]

busted (jailbird one shot)

2.5k WORDS, JOEL "JOJO" MILLER x f!READER SUMMARY: You roleplay as cop and sex worker. WARNINGS: I8+, no plot just smut, roleplay, manhandling, handcuffs, bj, unsafe PIV, creampie, fluff. writer chooses not to warn in further detail, read at your own risk. Read alone or see jailbird masterlist for relationship & reader history. NOTES: On hiatus, but this has been in my tumblr drafts since 3/20. Ty for the ask. They've both served time. This happens while Joel's aunt/your former cellmate is still locked up. Ty again to everyone who made me write cellmate's nephew (history) 💀. Divider by @saradika-graphics. @toxicfics for notifications.

Masterlist | Blog FAQs

You sit on Joel’s bed alone, wearing a short skirt, a lace bra, and fishnet stockings he already ripped wide open the last time you wore them. You finish lacing up your boots, tuck a wad of cash into your bra, and get a tictac mint from your purse. Then you put on the bag and close the bedroom door behind you as you leave. 

As you walk into the living room, the front door opens. You realize you’re holding your breath and feel silly. Your heart skips a beat when he steps through the door. 

He pauses long enough for you to take in his whole form. . .tattooed arms swelling out from the sleeves of his slutty, blue uniform. Your eyes fall to his crotch as he turns to face you. The tight polyester pants leave little to the imagination. The whole, massive outline is visible atop his thigh, straining the fabric. He smooths his mustache and tilts his head, checking you out. Then he keeps a straight face as he steps toward you and says,

“‘S’cuse me, miss. Can I see some ID?”

Your heart flutters. You’ve played the part so many times. Played lots of parts. You're used to being who the client needs. But here you are with a little stage fright in front of your boo. And Jesus Christ, there’s something about his prison tattoos bursting out of that uniform. 

You stand still in the middle of the room and he slowly paces around you. A few feet away, but close enough to smell the cigarette he must have enjoyed outside and the cologne he reserves for date nights. The sight and smell of him makes you tingle. His touch might make you physically swoon. He clears his throat, and your face heats up. You lock eyes with him, and there’s a sparkle in his gaze, but he manages to hold firm, not breaking. 

“I, um – I have it somewhere.” You rifle through your bag.

“What’s that in your brassiere, ma’am?” He takes a baton off his hip and gestures to your bra cup. Your chest is lightly dusted in a caramel flavored shimmer powder.  

“Oh,” you stammer, looking away.  “I dunno why I put this here when I have a purse,” you mutter, half out of character.

“Just what I was thinkin’,” he cocks an eyebrow at you. He begins to stalk around you again, getting a little closer with each step, closing in on you. Then, he holsters his baton and stands behind your back, close enough to feel his body heat. You turn your face to the side and his scent wraps around you. 

His hardness lightly grazes you, and you push your ass back instinctively. His left hand comes to your hip as his right hand snakes around your torso.  His voice is deep and gruff.

“I’m thinkin’ this is dirty money.”

He trails his fingers slowly up your sternum, then over the curve of your left breast to your black push-up bra. You watch the faded barbed wire flex on his hand as he slides two fingers into the bra cup, retrieving the cash. He lowers his volume and his lips brush the shell of our ear. “Real dirty, honey.” 

“It’s nothing,” you shake your head, getting into a better rhythm. 

“Lemme take this off your hands,” he offers and lifts the strap of your purse off your shoulder. He stuffs the cash in it and tosses the purse to Mabel’s easychair. The tictacs rattle as it lands. He returns behind you, and this time, both hands go to your hips.

“I’m thinkin’ we can work somethin’ out,” he murmurs. His hands meander up your sides, then back down. He holds onto your hips and pulls you back against him, lightly grinding his hard length against your skirt, making you throb. 

“Fuck, Jo,” you whine in a whisper, pushing back on him like you shouldn't be. He exhales what you're pretty sure is a laugh. You can picture his smile. You're not ready to throw in the towel on this scene. You compose yourself and ask, “What are you doing?” You step forward, away from him, then turn around with a glare. 

He slowly rubs his arousal and adjusts himself. Then he puts his hands on his hips and shifts his weight. He looks you up and down, slowly shakes his head, and clucks his tongue.  

“Y’know, I didn’t wanna have to do this.”  He reaches behind his back for his cuffs, and you head for the door. 

He grabs you by the arm, and you continue to pull away. 

“No,” you protest emptily, tingling at the thought of him getting rougher.

He wraps a strong arm around you and you keep squirming. He lets you pull away toward the door until you’re up against it. He presses his weight against you with a forearm on your upper back and warns, “Resisting arrest?” 

He wrangles your arms behind your back, and the cold metal edge makes you shiver as your first wrist is cuffed. The second cuff clicks into place and he tightens them. Your cuffed hands desperately feel around the front of his pants, and he shifts his hips to help you find what you're looking for. You softly moan when your palm meets the hard length in his pants. 

“So now ya wanna be good,” he taunts, then lets out a barely audible grunt, pressing his hips forward, arousal swelling against your palm.

“Yeah.”

“Yeah?”

“Yes, officer.” He takes your hands and puts them on your mid back, and you keep them there. He yanks the whole skirt up over your ass in one go, watching your ass drop, fishnet diamonds stretched over it. His hips push forward and his hardness makes you throb. 

“Spread’em,” he commands. 

You widen your stance. 

“Good girl,” he murmurs, then wedges a hand between you and the door. Your palms rest on his tummy as he shoves his hand between your legs and feels how wet you are through the pre-ruined fishnets. 

“Alright, let’s make a deal,” he growls, then cruelly takes his hand away without so much as putting half a finger in you. 

He grabs you by one arm and pulls you over to the sofa. “Knees,” he murmurs, and helps you down onto the carpet. He pats your head then sits down on the sofa with a sigh, manspreading. He splays his arms out on the back of the couch and looks at you affectionately for a moment before his face hardens again. He takes off his fake utility belt in a hurry. 

“Got five minutes to convince me not to take ya in,” he warns, "If ya can handle it." He lifts his hips, giving you a rush of arousal. He pulls at his uniform pants, and they snap open at the side. This must have been quite a hit all those years ago on stage. For you, he's not wearing anything under them. You glance at his hip tattoo. Yeah.

He frees his massive cock and wraps his hand around the clean shaven base. He squeezes it as he looks at you darkly. "Such a bad girl." He scoots toward the edge of the sofa. Your hands are still handcuffed behind your back, skirt still sitting up above your ass.

You lean forward, dip your head, and he feeds you his cock. You slurp the fat head into your mouth and he sighs, watching you with a softening scowl. "Fuck yeah," he breathes. His knees bracket you and help you balance with no use of your hands as you bob your head. He moans as you suck him. You stretch your jaw, sucking at the smooth, salty tip, then take a few inches into your mouth and hold it, feeling him throb. "God damn," he curses softly. You suck with the back of your throat and carefully take as much as you can, expertly swallowing his length. You take him so deep that your lips brush his shaved pubic skin, and your eyes prickle with tears.

“Fuck,” he mutters. “Get up here.” 

You slowly let his cock out of your mouth, and a string of slobber falls away with it.

He grabs your arms and helps you stand. He could stand to be rougher about it. But he's all but abandoning character, overtaken by the way you make him feel. The real you.

He helps you balance as you kneel onto the sofa, straddling him with your thighs spread wide. His breaths are heavy and getting heavier as he eyes your tits and the front closure of your bra. 

He sits up straight. He wraps an arm around you and interlaces his fingers with one of your cuffed hands. "Doin' so good, baby." With his other hand, he swiftly unhooks the front clasp of your bra, and the cups break apart, letting your tits fall out.  He takes a nipple into his mouth, then passionately licks and kisses his way up to your mouth. He palms one breast as he sucks the other and holds your hand behind your back. He pulls you right against him so your clit presses against his warm, hard cock and it makes him moan against your breast as he throbs against you.

He moves you, grinding his cock on your clit. He kisses your breast again, then drags his nose up your chest and feverishy kisses you everywhere on his way to your neck, where he sucks you long and slow. He lets go of your hand and slides his hand down, reaching under your ass to your cunt, where he slides his fingers through your slick then spreads you open for him.

He maneuvers you up to get clearance for his cock. He runs the tip through your slick, then massages your clit with it before notching at your entrance. You twitch at the contact, then begin to sink onto him and he pulls you down with a grunt.

"That's my girl," he breathes.

His lips find yours, and the kiss is long and slow with him seated fully inside you. He moves you on his cock, and his hips roll under you at a slow rhythm, stretching you with his girth, making you twitch already. You break the kiss with a moan.

You look down between your bodies, then purr, “is it hot in here, officer?” 

“God you're fuckin’ hot,” he gushes with urgency.  He reaches in his shirt pocket for the key to the handcuffs and wraps his arms around you. His cock twitches and he fumbles around as he uncuffs you. You rip open his snap button uniform top, then cradle his face and your lips smash back together and his tongue finds yours. He pulls you close. Your tits press into his chest and you moan into his mouth as you roll your hips.

You sigh and curse and moan against each other's mouths as you ride him.

“Fuck, baby,” he breathes. “I coulda came soon as ya—fuck–the way you were clawin’ around for my cock just to feel it—ohhhh.”

He playfully plucks at the fishnets then kneads your ass as you fuck. He lets you take the lead, sliding his hands down to your legs, then your boots. He sighs, "Ohh, baby," as you ride him.

“Yeah,” you breathe, feeling sharply on the edge already, with his cock inside you and the ghost of it pressed up against you through those pants. 

“Ohh, fuck,” he pants, “yeah.” His flesh fills yours so perfectly, stretching you around him. Your body wetly hugs his length as he smoothly thrusts up into you. He growls into your neck, “I can't get enough’a ya.” You card your fingers through his hair. 

“God you feel good,” you gush. “So fucking good. He’s kissing your neck wet and sloppy now. You both breathe audibly. "God, I love this cock," you pant. Your breath is shallow with your pending peak. You grind against him, then let it overtake you. “Fuck,” you breathe as your walls flutter around him. 

He groans as you come on his cock.  As you finish your peak, he’s clearly holding back. You look down at his inked torso glistening. 

You both watch where your bodies meet, and you tell him, “i want you to come.”

“c'mere” he takes your jaw in one hand, and brings your lips back to his. He holds you tight, kissing you for a few thrusts, then his lips fall apart to moan and breathe vocally as he fucks you.

He pulses inside, pinching his eyes shut. He groans into your cheek, and you finger his curls as he pumps you full. Then you relax into his arms.

-

You share a long moment without words, and he holds your head. Then he uses his chest to push you slightly off him. He looks you in the eyes, then does a double take down to your tits and dips his head to kiss one before returning his attention to your face. 

You're still on his cock, and the stretch persists even as he slowly softens.

He looks back and forth between your eyes and blurts out, “you should move in.” 

You laugh in shock. 

“‘m’serious, baby,” he says with a smile. You bite away another laugh and his smile fades. He whispers, “Dead serious.”

He pulls you in for a kiss, then breaks away to await your answer. 

You haven't thought about it, really. Not yet, anyway. But it doesn't feel out of the question. You glance over to Mabel’s chair. 

“She knows,” he assures you. It doesn't make a difference right now, but you pray she'll get paroled sooner rather than later. 

“Just think about it,” he offers. 

You nod and bite your lip, running your hand through his hair affectionately, still plugged by his cock. "Tempting," you smile.

“I'm a lucky man either way,” he says.

Your face heats up, and you reflexively lighten the conversation. “Why’d ya cuff me if ya wanted me on top,” you laugh.

“Hell if I know what I want,” he admits. He kisses your neck then murmurs, “Just want ya every which way all the time.”

thank you for reading, and thank you for your support. love you guys <333. my tag list is gone for real this time, sorry. I'm also on a break from writing & reading but had this in my drafts.

[inprogresspokemon]

Gorazi Snivy (Снайви)

Goraz Pokédex #019 Grass Snake Pokémon Type: Grass Size: 2'00" | 17.9lbs Ability: Contrary or Friend Guard (Hidden Ability: Opportunist)

Pokédex Entry: Native to the birch forests of northern Goraz, this regional form, sometimes called the "Birch Snivy" or "Autumn Snivy", is known for its fearless curiosity. They frequently explore the nests and territories of other Pokémon, and while this often results in them being chased away, this never perturbs them.

Gorazi Servine (Сервайн)

Goraz Pokédex #020 Grass Snake Pokémon Type: Grass/Dragon Size: 2'07" | 35.3lbs Ability: Contrary or Friend Guard (Hidden Ability: Opportunist)

Pokédex Entry: As they mature, Gorazi Servine naturally develop a sense of diplomacy, which they seek to hone as they gain in confidence and experience. Bargaining and brokering are often used within colonies both to settle disputes, and as a form of pack-bonding. Due to their typing, the species experiences something of a rivalry with Applin.

Serperlative (Серперлатив)

Goraz Pokédex #021 Charming Pokémon Type: Grass/Dragon Size: 6'00" | 138.9lbs Ability: Contrary or Serene Grace (Hidden Ability: Opportunist)

Pokédex Entry: Unlike their Unovan counterparts, Serperlative are naturally inclined towards pacifism. They use their charismatic disposition to negotiate with other Pokémon, often sharing territory and resources with social groups comprising three or four other species in addition to their own colony, with multiple individuals sharing the duties of parriarch.

The Gorazi Snivy line was commissioned by and belongs to @tesshex. They designed Snivy and Servine, and I designed Serperlative based on their notes and feedback - thanks!

- - - - - - - - - -

Follow for more Fakemon designs and regional forms!

FAQ | Social Media | Pokemon Index | Commission Information

[darqx]

Snakes on a post

Another particularly long answer dump since i, once again, have a backlog of things to potentially answer |D

❗️For commonly asked qs please see my BTD FAQ

Got jumpscared with my own old art for a hot minute there LAUGHS.

(For those wondering, the naga doodle from here was attached to the ask)

That is every other Royal that exists in the Nether and also at least some of the demons that challenged him for his Royal title lol.

Believe me, no one was or is more surprised then me XD;

So, the thing about where Rire's ichor manifests is that it kinda exists and doesn't exist at the same time. Meaning that his upper back is where the manifestation point is anchored, BUT it can still manifest with a bit of space in between it and his back hence why it will manifest over his clothes and not through them.

So if you touch where the manifestation point is sans the ichor, than you are just straight up touching his back. With the ichor, he still gets sensory input from the tentacles to his back but it's a lot more soft and muted esp the further away it gets from him. As you've seen implied though, he would feel a very sharp pain if a great deal of damage was done to the ichor where it clusters at the manifestation point, since he'd DEF be feeling that straight in his back lol.

He is definitely a top and the only way he would bottom for anybody is if they somehow forced him to.

Ah i knew i'd answered this a long time ago [finally found it]! Holy crosses (those that have been blessed) can also burn him but they would need to be in contact with him the entire time. Being a Royal he also has more of a tolerance to these than normal demons.

Well, unless said person actually has the undeniable ability to make good on their words, Rire would just stand there rather genially with that little smile he sometimes has and let them finish.

And then he might use them as reverse suggestions for dealing with said person (why would you give him any ideas!!?)

both

In BTD canon it is quite possible that they actually haven't in person. But we are using creative license here haha.

Rire heals a lot faster than a human. Cain is not my character so I don't know how his stacks up.

I've grouped these asks cos they kind of have similar answers - 360° (jk sorry sorry to the second q that is just a very common spelling mistake and I couldn't resist XD; )

Now, even though we mashed all the characs together in BTD, they all actually come from different storylines and so their canons outside the "BTD canon" may differ. This tends to bleed in. With this in mind:

The rules of Rire's canon (eg the concept of Battle Royales and how to become a Royal) don't apply to Cain. Anyway, they don't live in the same place either.

Cain is canonically the oldest and most OP character in BTD lol so yes he is stronger than Rire - you might've noticed, but Rire is never in the same drawing as Cain voluntarily. I play with this along with the "natural weakness" aspect - which I've also referred to as scissors-paper-rock rules XD Basically; demons beat humans, angels beat demons (purely because demons have weakness against holiness).

It would (be insane) but I hope you are not looking at me to fulfil this :d

Not really

His coronation day is a public holiday in his sector so yes XD

Aww thank you very much for your interest! ≧(´▽｀)≦ It's really cool that some of you guys want to actually fund such a thing - I'd have thought you'd have enough of him killing you in BTD1 XD Unfortunately, I have no plans for a Rire game at the moment as I'm working on a webcomic which looks like it will take up all my free time (that being said, he will be in the webcomic at some point).

Nope! Although i can kinda see why you might think that lol.

Whatever that one is where he doesn't particularly care what someone else identifies as. It really makes no difference to him or how he will act.

There are viruses in the Nether that if contracted could potentially kill you, yes. Part of being a Royal is becoming a lot more robust than normal Demons though. As for if/when Rire dies, I dunno maybe either in a Battle Royale somewhere thousands of years down the line or by old age (which is rare for a Royal but not impossible if you play your cards right).

If you are asking if he has a heat/rut of some sort, he does not |D

[magussanctorium-if]

The Magus Sanctorium. Pentagiim's elite and esteemed school for mages across the continent. Hard to get into with an advanced curriculum and hands-on experience, many would kill to be accepted into the fray. But behind shiny spells and gilded bookcases belies a lit powder keg of pent up tensions and small slights that threaten the whole continent with all out war. A single slip up will light the fuse, so be careful. And don't forget your 7 page essay is due next week!

The Magus Sanctorium is a highly ambitious WIP and new interactive CYOA pair of games. The focus is heavily on romance, relationships, and fantasy adventure with high-replayability value. It is inspired by JRPGs, romance visual novels, any media with a magical boarding school, and Dungeons and Dragons, among others. It will lean more towards a story-based focus, but will have stat-based mechanics.

You play as a new transfer student, having transferred to The Magus Sanctorium after moving continents. Being homeschooled to suddenly thrust into an elite boarding school is a culture shock. As you go about going to classes and making friends, your schooling is abruptly upheaved as war breaks out across the continent. Which house you decided to join determines how the war will affect you and how you can help or hinder your former classmates or lovers.

Note: Because this is still a WIP, some names of characters or places may change during development.

Genre: Fantasy, Romance, Adventure

Rating: 18+

Tracked Tag: #the magus sanctorium

Status: In Development (Outlining)

Demo || Character Introductions || House Introductions || FAQ || Ask Guidelines || Tag Navigation || World Lore || Current Anonymous Survey Form || Dev's Main Blog ||

Create and customize your character. Select their gender, pronouns, appearance, their proficiencies and deficits, and personality among others.

Choose between 5 different houses each with their own cast of characters. Each student is divided into houses by which nation they come from, not by arbitrary traits.

Decide how to build your stats by choosing which classes to attend and which skills to train in. Influence your house members to train or attend certain classes to boost group skills.

Romance any of the 15 romance options (5 male, 5 female, 5 nonbinary), or select any of the 10 poly routes instead. Choose for a softer romance by picking one of your house members or go for an angsty romance by romancing someone outside of your house.

Build your relationships with your classmates before you're turned against each other and get to know what makes them tick. It pays to have friends across house lines.

Explore and learn about a high fantasy world steeped in magic and years and years of conflict. Perhaps it takes an outsider's perspective to bring about peace...

Participate in a war and potentially reveal long kept secrets that could change the fate of Pentagiim.

Thalen Oakdane (they/them) - The proud and rigid Leader of the Fern Bears, the house from the Rasuaides Empire. They are strict with their rules.

Sumiel Tidewood (she/her) - The graceful and shy Leader of the Cobalt Snakes, the house from the Espersland Republic. She just wants the best for everyone.

Casithar Seedcloud (he/him) - The young but earnest Leader of the Maroon Rams, the house from the Iseadesh Alliance. He's trying his best.

Ariela Wyvernhair (she/her) - The prickly but well-meaning Leader of the Violet Foxes, the house from the Lupuv Caelait Territory. A rose wrapped in thorns.

Zanis Ironforce (he/him) - The charismatic and cunning Leader of the Sun Eagles, the house from the Quailax Kingdom. He is always 5 steps ahead.

Drelyth Hollymoon (she/her) - The vice-leader of the Fern Bears. She is kind and confident, always pushing herself to aim higher and higher.

Afthel Scalesun (they/them) - A member of the Cobalt Snakes. Quiet and introverted, they prefer the comfort of their books than that of their house members.

Anwyn Greenspear (he/him) - A member of the Maroon Rams. He is a known flirt and playboy, often earning him the ire of his house members.

Lamatri Glowillow (they/them) - The enigmatic and mysterious vice-leader of the Violet Foxes. You barely see them, but they seem to know everything about you.

Traki Goldreaver (they/them) - A member of the Sun Eagles. It's also their first year enrolling. Enthusiastic and energetic, but a work-in-progress.

Azaha Elmbasher (he/him) - A member of the Fern Bears. An idealistic and daydreamer artist who enjoys making life hard for his house leader.

Rumik Gullcaller (he/him) - A member of the Cobalt Snakes. Sumiel's childhood friend, he is protective and intimidating often scaring away most classmates.

Daeri Silkdream (she/her) - A member of the Maroon Rams. A bit ditzy and arrogant, her exaggerated personality belies her true strength.

Saevain Sageblossom (she/her) - A member of the Violet Foxes. Stuck-up and arrogant, she has a family legacy to fulfill as a Prime Magus. But is that what she wants?

Cyian Stonepelt (they/them) - The vice-leader of the Sun Eagles. Gloomy and apathetic, they'd much rather be doing anything else but this.

Poly Romance Options: Thalen & Azaha, Sumiel & Rumik, Casithar & Daeri, Ariela & Saevain, Zanis & Cyian, Drelyth & Saevain, Afthel & Traki, Daeri & Afthel, Ariela & Casithar, Traki & Drelyth

[neil-gaiman]

i haven’t seen anyone address this yet but crowleys snake tattoo is a lil lower on his face in s2! Is there any specific reason?

It's in the pinned FAQs.

[meowzfordayz]

staying in

Author’s Note: feeling cheesy and silly and lazy. ☺️😝🥱

staying in

Hashira x Reader, Kamaboko x Reader

Word Count: ~900

CW: mild sexual content

Song Inspo: Low Key by Russell Dickerson

~faqs~

An evening in consists of…

… almost getting scammed by an astrology website with Zenitsu, before finally agreeing that the free version is fine, and who believes in astrology anyway? Clearly, you’re made for each other (despite there being some ~areas of conflict between your charts). 

… board games with Inosuke until one of you rage quits, and the other has to convince them to: stop sulking in the bathroom, and play again. Who rage quits usually depends on the game, and you’re much better at goading him into another round than he is at bribing you.

… a quiet stroll out with Gyomei, so not exactly staying in, but still more peaceful and mindful than going to a bar or attending an event. He compares your presence to the radiant fullness of the moon, and you tuck a fallen flower behind his ear. “How do you know what the moon feels like?” He doesn’t quite know how to explain gentle, mystical tug of moonrise, so he settles for, “I can feel you, and that is more than enough.”

… cleaning and redecorating Kaburamura’s cage with Obanai. It’s a little gross, and a lot of a fun. From teasing him for his obvious doting, “Does Kaburamura really need six donut cozies?” to being flat out rejected, “Sooo that’s a no to body painting? It’s safe for humans! How could it not be safe for snakes?” You end up falling asleep as he dutifully photographs Kaburamura curled up on your shoulder #guess I’ll finish cleaning by myself.

… doing Tanjirou’s make up, and him doing yours. If you don’t own any make up, then you go on a field trip (minimal budget). You randomly pick themes (old fashioned via “from a hat” or modern via “app for raffle draw”), set a time limit, and then send photos of your final looks to your Hashira + Kamaboko group chat to decide on a winner.

… making the most outlandish cocktails (or mocktails) you can think of with Mitsuri. They have to be intricate, original, AND taste delicious (~just okay suffices too), or you put on a pair of socks. By the end of the evening, you’re drunk (or sugar high) as heck, and have at least four pairs of socks on.

… a project with Shinobu. Whether that’s tackling a Lego set, making candles, or deep cleaning a specific room (likely the kitchen or bathroom), the laughter is ever constant, frustration to be expected, and resulting pride and excitement at the final product a worthy reward — not to mention the way she kisses you afterward! *happy sigh*

… cooking with Kyojuro #bet you didn’t see that coming #sarcasm intended teehee. Sometimes it’s complicated, hours long endeavors; other times it’s spaghetti; and there’s always take out if your fancy Huntsman pie doesn’t go to plan. He’s almost unbearably efficient when it comes to cooking tidily, and chops vegetables so quickly that you just marvel at how his fingers are intact.

… watching a movie with Sanemi. This includes: ~arguing over which movie to watch for a solid hour (give or take), another twenty minutes for snack prep, and another half an hour to spontaneously design and build a pillow fort (for the optimal movie watching experience, of course). Even when it’s a movie he swears he despises, he’ll still stay awake through the whole damn thing because it matters to you, and you matter to him.

… creating scavenger hunts for each other with Muichiro. You roll dice to determine who gets to claim which room(s) and in what order, set up your hunts, and then hunt (duh)! Winner gets to choose dinner (or dessert if you already ate dinner), and loser gets to cook aforementioned dinner (or dessert). You usually win, but he notices when you begin making his clues easier, and promptly informs you that he’d rather lose honestly than win on Easy Mode. “Your happy noises whenever I feed you are prize enough for me.”

… planning your future with Giyuu. It’s easy to get caught up in the mayhem of Life™, so evenings in are a grounding, intimate opportunity to reconnect and recenter with him. From cuddling on the couch to dancing in the kitchen to watching the moon’s traverse through your favorite window, you discuss current stressors, recent successes, and your gratitude for each other. It may seem simple, but it’s the little things that fit most snugly in your hearts. “Where do you see us in a year? Five years? A decade?” you ask. His answer remains constant: “Together.”

… reading with Tengen. He’ll read to you, or you to him; you’ll share a book, or the couch, or the bed; and you alternate who gets up to brew more tea. If you prefer audio books, then he’ll occasionally eavesdrop, and when it’s your turn to be on tea duty, you more often than not return to a cute sticky note (with dramatic commentary regarding the chapter you’re on) bookmarking your page.

[draconym]

About Draconym

Hey tumblr, I’m Mel. I’m an old millennial who works in public parks. In the past I’ve been a ranger and a technician. Sometimes I post pictures of the animals that I get to work with. I also post art, comics, and weird dreams. Here's some FAQ.

Common Tags

art, comic, dreams, nature center, park ranger, poll, ripley parrot, snake, cockatiel, video, me, music, bug, bird, dragon

Links

Website: cyaneus.com

Redbubble: tillery

Patreon: cyaneus

Art Reblogs/Inspiration: @insectivus

Fanfiction: @ironbeaks-journal

Mastodon: art.vulture, social.cyaneus

Featured Creatures

Ripley, 15 year old African grey parrot. Dinosaur toddler and menace to household objects.

Enyo: 20 year old cockatiel. Grumpy old man.

Cheese: ??? year old cockatiel. Weird little guy.

Mousetrap: Eastern rat snake rescued from a glue trap in 2016. Frequent animal ambassador at park programs.

Galaga: Western hognose. Less skilled at being an animal ambassador due to being kind of an asshole.

Elvira: Curly hair tarantula.

Content Warnings

I try to tag for common phobias such as snakes, spiders, bugs, and animal death.

Art Usage

If you’d like to use my art as an icon or a blog header, I’m honored, and please do! Please credit either my blog (this one, @draconym) or my website (cyaneus.com). Please don’t edit my art except to crop or resize it for icons. I don’t mind if you share my tumblr posts to non-tumblr social media as long as you link back to me, but within tumblr please reblog instead of reposting my content. Don’t use my art for any commercial purpose.

Donation Reblog Requests

I get a lot of requests to reblog donation posts. I don’t mind if you privately send me a link to a fundraiser, though I don’t always have the means to donate. I only reblog fundraisers for people I know personally.

Askbox

Usually open. Messages welcome, though I don't usually answer them quickly. Not really available for commissions at the moment.

[markscherz]

FAQ

I get a lot of asks on tumblr, and I of course cannot expect you to scroll through my erratic post history on tumblr before you ask anything (though you can browse my tag #Answers by Mark, if you want). So instead, I have pinned this post that has an FAQ, which you can refer to before submitting a question, to check if it has been asked before.

Personal Questions:

What is your favourite frog/lizard/…?

How old are you? Where do you live? Where are you from? What languages do you speak?

What do/did you study?

Are you going to [insert meeting here] conference?

How did you get into Malagasy herpetology?

What is your relationship status?

How did you get where you are today?

That bread you make looks really fucking incredible, where do I get a recipe so I can get it in my FACE?

Science-related Questions:

How do I become a herpetologist/any advice for someone interested in a career in herpetology?

What is it like being a taxonomist?

How do I learn about the taxonomy of reptiles or amphibians?

I’m travelling to Madagascar; can you give me some advice?

How can I get into field research in Madagascar?

What is the best part about field work?

What is Zoology like as a career path?

Should I be a zoologist if I’m not good at school/not passionate about it?

How much money will I earn as a zoologist?

Will I struggle in herpetology/zoology as a female?

Can you recommend American colleges to me to study Zoology?

Can you identify this herp for me?

Can snakes hear?

I want to be a vet, can you give me some advice?

Is the distinction between poisonous and venomous really that important?

Are you a lumper or a splitter?

Can you help with my homework?

[screampied]

★ FAQ ★

𝒑𝒆𝒓𝒔𝒐𝒏𝒂𝒍𝒔.

is your name actually vegas?

nope! i was gonna change it but it has a nice ring heh

do you have any other socials?

i have discord. mutuals are free to ask for it in case i ever go mia on here. i have twitter but its a personal spam

how long have you been writing?

about ten years! i joined tumblr last year, ‘round oct + nov.

do you have any pets?

i have dogs and a pet king snake named clementine.

𝒘𝒓𝒊𝒕𝒊𝒏𝒈..

do you have a posting schedule?

not really. sometimes i post daily, sometimes its every few days. i’m very busy irl so i usually post fics around [ night ] and requests such as thirsts / drabbles around the daytime

who are your favorite characters to write for?

toji, choso, and sukuna!

do you allow spam liking?

i do not! please refrain from doing that, i appreciate it though! spam liking can detect to tumblr that im a bot and shadowban / hide my entire blog. i block spamlikers. spam reblogging is entirely okay! :)

did you get my request?

i see every request i get! if it’s been a while and i haven’t replied, i apologize. i get tons of ask and i try not to overwhelm myself. you can politely ask if ive seen it + remind me what it was because sometimes tumblr eats my asks.

favorite kinks to write?

dumbification, praise, spit, edging / overstim, manhandling, p*ssyspanking, squırting

what times are you most active?

it depends! my time zone is (GMT - 4). im usually active during the evenings, sometimes during the afternoon.

[cyanocoraxx]

spider/centipede/snake keeping FAQs

"aren't you scared it will bite you" hello job. no i can't come in today. i'm being bitten by my poecilotheria metallica. yeah i'll be off work for 3 weeks. yay

"does it still have its venom" yes that's what makes it more fun

"it can't love you" neither could my dad but we move

"why keep centipedes eughghgh gross" i don't have room in my house for an actual dragon so the smaller land ones will do instead

"what do you feed them" small children and occasionally adults if they annoy me enough

"what do you do with them" we vibe. my spiders know my deepest darkest secrets and they will never tell you. on account of being incapable of human speech.

[cantstoptheimagines]

How They Fuck

Summary — Preferences for Coriolanus Snow, Lucy Gray Baird, Sejanus Plinth, and Tigris Snow from The Ballad of Songbirds and Snakes!

Warnings & Other Tags ➳ Smut (like, literally, that’s all this is).

Notes ➳ Word Count is 425. ➳ Reader is gender neutral (they/them). ➳ I wrote this as a birthday gift for my best friend, Yoshino! Send her some love @multifandomsimagine!

FAQ | Masterlist | Fandoms | Requests | Coming Soon | Schedule 

coriolanus snow

it took coriolanus a long time to give into his urges, so drunk on the thought of power that he had almost forgotten he would need someone by his side to solidify his claim. he wasn’t entirely sure if he actually loved you, or anyone really, but you knew how to make him feel good, so what did love matter? he’s rough, animalistic, and even mean at times. nothing you couldn’t handle though. at least, that’s the impression he got. then again, maybe you were just too consumed by your moans, constantly crying into his ear, to tell him to let up a little. he’ll flood you with his cum, grunting deep in his chest, as his balls pulse with every new rope of white that enters your body, “fuck, could stay inside you forever, i swear.”

lucy gray baird

she’s clearly a scandalous figure in and of herself, especially after returning from the capitol. she’d perform at the hob with the covey before disappearing from sight, though her older friends, like barb azure and tam amber, seemed to know what she was up to. based on the sounds that came from the music shed out back, at least. her tongue runs over your most sensitive parts without hesitation. and the sugar sweet moans that come from your throat sound like another one of her famous songs. your pleasured whimpers sparked an idea inside her head. “maybe i’ll write a song about you someday soon,” she says, her chin dripping with your release. “one that sounds as nice as you.”

sejanus plinth

“god, i love—! mmph! so much, love you!” he praises without fail, without the expectation of gaining something in return. what else could he possibly want but you? he’s got you caged beneath him, your legs around his waist, as he slowly ruts into you. you’re covered in a layer of sweat, moans and pants falling uncontrollably from your lips. you’re digging your fingertips so hard into his back that he’s sure bruises will be left behind. “i love you too—! oh! oh, sejanus, please!”

tigris snow

she likes gentle people who aren’t afraid to lay their hearts open. your lips running slowly over her neck, whispering sweet phrases into her ear while your fingers dip into her with a softness no one else can provide. sometimes you’ll tease her a little too much just to pull a few whines from her lips. quickly though, you smother them with your own, only content once she finally gives in to her release. “quiet now, tigris. don’t want coryo to hear us.”

[rosekillermicrofic]

June Prompts!

Sorry they're a bit late! Time got away from me!

Here are the prompts for June! Make sure to check out the rules and FAQs if you have questions!

Here are May's prompts if you still need them!

I know a couple of you have asked about an ao3 collection - I will look into that when school gets out- I don't want to take on too much! <3 My goal this month is to start using the banners.

Also, we are gonna need more prompt suggestions for next month, so feel free to send them in!

Happy writing and reading and HAPPY PRIDE!

Prompt list below the cut!

Pride

Die

Lips

Love

Garden

Pierce

Crimson

Illuminate

Pool

Hurt

Memory

Seventeen

Snake

Tied

Thorn

Murder

Evil

Smirk

Pendant

Cleanse

Grow

Window

Wicked

Scratch

Stab

Drink

Bruise

Best

Always

Fake