#(the reason tong is with may):

[vegaseatsass]

Rewatched My Stand-In eps 2 and 3 tonight, and I'm definitely newly fascinated with Ming POV/Ming's internal concept of what was happening between him and Joe that entire time. I forgot just how much we got of Ming's home life and family in episode 2, and my brain is abuzz trying to connect all the dots. His relationship with May is so interesting. She clocks that he and Joe are together on Christmas, and is immediately careful to conceal it not just from their parents but from Tong. May and Ming have this "us against the world" vibe where they protect and cover for each other, going back to May giving herself pneumonia saving Ming from drowning. I absolutely believe there's more going on in their family than mom pressuring Ming to marry women any time he goes home - I actually suspect things about his family are being obscured for future painful reveals - but May is a safe space for him. Until Tong is added into the picture, and Ming has to flee the country for four years to get away from his big feelings. It's just kind of bonkers to me that he had this intense, safe and presumably very grounding relationship with his sister, but made his obsession with a random movie star the centerpiece of his world instead. Why did he imprint on Tong? Is it really just Joe's sexy back muscles that drew him in? Did he think if he could land a famous movie star his parents would accept him being with a man? Was it subconscious self-sabotage of his only safe relationship lol? I genuinely have no idea!! What I am stuck on though is when he told May he was working through something, and would tell her when he was ready, but he promised he'd get through it. On rewatch, it seems very obvious that what he's talking about is the torch he's carrying for Tong, so to me that's a reveal that he's deliberately trying to move on with Joe - not using him as a sex doll replacement, but throwing himself into something real. (What's messy obviously is that Ming started this for the proxyfucking, but I think overhearing Joe confess his love for Ming to Sol is when Ming started making a determined effort to choose Joe.) There's also his reaction to Joe's Christmas gift where the watch becomes a metaphor for Joe himself (vs. Tong): Ming doesn't need the "top" one, why can't he want the "normal" one?

The first time I was watching this, I assumed that Ming just has no internal awareness of how important Joe is to him, he just feels pure need and acts very very normal when his emotional support stand-in is ripped away. I assumed Ming believes he's in love with Tong and thinks he's just passing some time with Joe. It doesn't help that every time Joe presses him on anything emotional Ming shuts him down or outright negs him lolllll

But like for example, in the scene where they're shopping together and Joe gets excited about the couple mugs, first Ming snaps "What makes you think we're a couple?", then he tries to mitigate his slip by playing it off: "after living with me, you'll realize you don't want me as a boyfriend." His kneejerk impulse to shut Joe down and say cruel things is imo a defense mechanism, a really maladaptive one that helps convince Joe later on that there was never any love there, but I'm starting to think it's triggered in response to actually wanting the intimacy and primacy that Joe is pushing for, and being terrified of that.

It would make so much sense for somebody who is terrified of needing anybody else, of being vulnerable or feeling anything real, to decide they're in love with a complete asshole movie star who uses their family for money and them personally for favors, and shape their life around that. Especially now that I understand how young Ming was when he first fixated on Tong (17ish??), I just feel like that entire imprinting is your classic teenager-who-is-not-ready-to-be-in-a-real-relationship parasocial spiral. I used to do it with male celebrities too!!! (I am a lesbian. lmfaooo)

It's interesting because while there's something conceptually romantic about the back Ming first got obsessed with being Joe's all along, it ultimately doesn't really matter to me WHO the onscreen person that he fixated upon was. What matters is how ill-equipped Ming has proven to handle real feelings for a real person in front of him, and the journey he has from here to learn how to human. I can't wait. P.S. Other thing I forgot happened in episode 2: - Ming made drunk!Joe sleep on the floor of Joe's own home - BEFORE Ming moved in or had any claim to the space - AFTER Ming told Sol he would take "really really good care of Joe" as a way of trying to claim Joe in front of the competition His journey to human is going to be a loooooooooooooooooong one, methinks... 😈

[im-captain-basch]

In the Dark of the Night from Anastasia came on my playlist and my brain immediately said "how can I connect this to Donkey Kong."

Well, uh, @swanksidelimbo had a headcanon that DK's bloodline was cursed by Tiki Tong due to his ancestor having started a rebellion that lead to the Tikis being overthrown and my brain said "Yeah we'll go with that" and well this is what happened.

I would have liked to do a full video to it, but I know how I get when I get started on something like this so I just did what I could.

I've got a few notes down below (I love to ramble <3):

This specific version of the song in the video is the cover by Jonathan Young, both because I feel like it fits Tiki Tong better than the original and also it's the one that came on and gave me the idea

I used my humanoid Tiki Tong design because for whatever reason I always have a problem drawing his canon design (also I just like drawing it)

The last couple of silhouettes are supposed to be Cranky (both younger and older) and DK, but Cranky's beard makes his look weird

"My curse made each of them pay, but one [...] got away" is supposed to reference another part of their headcanon in that pretty much everyone in DK and Cranky's bloodline dies young as a result of the curse, but Cranky is definitely the oldest surviving one (IIRC, he's not quite 70 in her headcanon)

In a hypothetical full version of the video (which to be fair is more like a PMV than an animatic), I'd imagine at the end is when the beginning of DKCR takes place

The reddish smoke in a couple of the frames is meant to reference whatever had been used to seal the Tikis, while the black smoke emitting from Tiki Tong when talking about "the betrayal" is meant to represent the curse, unlike in the later parts where it's more a result of him expressing anger.

...you can definitely tell what parts were done when I was losing steam and I'm sorry for that

[hellsitegenetics]

hello!

i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).

i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.

my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.

bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.

okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt

Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)

[najia-cooks]

[ID: Two plates of cookies, one oval and topped with powdered sugar, and the others shaped in rings; one cookie is broken in half to show a date filling; two glasses of coffee on a silver tray are in the background. End ID]

معمول فلسطيني / Ma’moul falastini (Palestinian semolina cookies)

Ma’moul (also transliterated “ma’amoul,” “maamoul” and “mamoul”) are sweet pastries made with semolina flour and stuffed with a date, walnut, or pistachio filling. The cookies are made tender and crumbly with the addition of fat in the form of olive oil, butter, or clarified butter (سمن, “samn”); delicate aromatics are added by some combination of fennel, aniseed, mahlab (محلب: ground cherry pits), mastic gum (مستكه, “mistīka”), and cinnamon.

“مَعْمُول” means  “made,” “done,” “worked by hand,” or “excellently made” (it is the passive participle of the verb “عَمِلَ” “‘amila,” "to do, make, perform"). Presumably this is because each cookie is individually filled, sealed, and shaped by hand. Though patterned molds known as طوابع (“ṭawābi’,” “stamps”; singular طابع, “ṭābi’”) are sometimes used, the decorations on the surface of the cookies may also be applied by hand with the aid of a pair of small, specialized tongs (ملقط, “milqaṭ”).

Because of their laborious nature, ma’moul are usually made for feast days: they are served and shared for Eid, Easter, and Purim, a welcome reward after the Ramadan or Lenten fasts. For this reason, ma’moul are sometimes called “كَعْك العيد” (“ka’k al-’īd,” “holiday cakes”). Plates of the cookies, whether homemade or store-bought, are passed out and traded between neighbors in a practice that is part community-maintenance, part continuity of tradition, and part friendly competition. This indispensable symbol of celebration will be prepared by the women of a family even if a holiday falls around the time of a death, disaster, or war: Palestinian food writer Laila El-Haddad explains that "For years, we endured our situation by immersing ourselves in cooking, in our routines and the things we could control."

Other names for these cakes exist as well. Date ma’moul–the most common variety in Palestine–may be called كَعْك بعَجْوَة (“ka'k b'ajwa”), “cakes with date paste.” And one particular Palestinian variety of ma’moul, studded with sesame and nigella seeds and formed into a ring, are known as كَعْك أَسَاوِر‎ (“ka'k 'asāwir”), “bracelet cakes.” The thinner dough leads to a cookie that is crisp and brown on the outside, but gives way to a soft, chewy, sweet filling.

[ID: An extreme close-up on one ka'k al-aswar, broken open to show the date filling; ma'moul and a silver teapot are very out-of-focus in the background. End ID]

History

Various sources claim that ma’moul originated in Egypt, with their ancestor, كحك (kaḥk), appearing in illustrations on Pharaonic-era tombs and temples. The more specific of these claims usually refer to “temples in ancient Thebes and Memphis,” or more particularly to the vizier Rekhmire’s tomb in Thebes, as evidencing the creation of a pastry that is related to modern kahk. One writer attests that this tomb depicts “the servants mix[ing] pure honey with butter on the fire,” then “adding the flour by mixing until obtaining a dough easy to transform into forms” before the shaped cookies were “stuffed with raisins or dried dates and honey.” Another does not mention Rekhmire, but asserts that “18th-dynasty tombs” show “how honey is mixed with butter on fire, after which flour is added, turning the substance into an easily-molded dough. These pieces are then put on slate sheets and put in the oven; others are fried in oil and butter.”

Most of these details seem to be unfounded. Hilary Wilson, summarizing the state of current research on Rekhmire’s tomb, writes that the depicted pastries were delivered as an offering to the Treasury of the Temple of Amun; that they certainly contained ground tiger nuts; that they presumably contained wheat or durum flour, since ground tiger nuts alone would not produce the moldable dough illustrated; that the liquid added to this mixture to form the dough cannot be determined, since the inscription is damaged; that the cakes produced “are clearly triangular and, when cooked are flat enough to be stacked” (any appearance that they are pyramidal or conical being a quirk of ancient Egyptian drawing); that they were shallow-fried, not cooked in an oven; and that honey and dates are depicted at the far left of the scene, but their relationship to the pastries is unclear. There is no evidence of the honey being included in the dough, or the cookies being stuffed with dates; instead, Wilson speculates that “It appears that the cooks are preparing a syrup or puree of dates and honey. It is tempting to think that the cakes or pastries were served [...] with a generous portion of syrup poured over them.” Whether there is any direct lineage between these flat, fried pastries and the stuffed, molded, and baked kahk must also be a matter of speculation. [1]

Another origin claim points to ancient Mesopotamia. James David Audlin speculates that ma’moul are "possibly" the cousins of hamantaschen, both being descended from the molded "kamānu cakes that bore the image of [YHWH’s] goddess wife Inanna [also known as Ishtar or Astarte]" that were made in modern-day Syria. Other claims for Mesopotamia cite qullupu as the inspiration: these cakes are described in the contemporary record as wheat pastries filled with dates or raisins and baked. (Food historian Nawal Nasrallah writes that these cookies, which were offered to Ishtar for the new year festival in spring, may also be an origin point for modern Iraqi كليچة, "kleicha.")

The word "määmoul" had entered the English language as a type of Syrian farina cake by 1896.

In Palestine

From its earliest instantiations, Zionist settlement in Palestine was focused on building farming infrastructure from which Palestinians could be excluded: settlers, incentivized by foreign capital, aimed at creating a separate economy based around farms, agricultural schools, communal settlements, and research institutions that did not employ Arabs (though Arab labor and goods were never entirely cut out in practice).

Zionist agricultural institutes in Palestine had targeted the date as a desirable crop to be self-sufficient in, and a potentially profitable fruit for export, by the 1930s. Ben-Zion Israeli (בנציון ישראלי), Zionist settler and founder of the Kinneret training farm, spoke at a 1939 meeting of the Organization of Fruit Growers (ארגון מגדלי פירות) in the Nahalel (נהלל) agricultural settlement to discuss the future of date palms in the “land of Israel.” He discussed the different climate requirements of Egyptian, Iraqi, and Tunisian cultivars—and which among them seemed “destined” (נועדים) for the Jordan Valley and coastal plains—and laid out his plan to collect saplings from surrounding countries for planting despite their prohibitions against such exports.

In the typical mode of Zionist agriculture discourse, this speech dealt in concepts of cultivation as a means of coming into a predestined ownership over the land; eating food suited for the climate as a means of belonging in the land; and a return to Biblical history as a triumphant reclamation of the land from its supposed neglect and/or over-cultivation by Palestinian Arabs over the past 2,000 years. Israeli opened:

נסתכל לעברה של הארץ, אשר אנו רוצים להחיותה ולחדשה. היא השתבחה ב"שבעה מינים" ואלה עשוה אינטנסיבית וצפופת אוכלוסין. לא רק חיטה ושעורה, כי אם גם עצים הנותנים יבול גדול בעל ערך מזוני רב. בין העצים -- הזית [...] הגפן, התאנה והתמר. לשלושה מהם, לזית, לתאנה ולתמר חטאה התישבותנו שאין היא נאחזת בהם אחיזה ציםכר של ממש ואינה מפתחת אותם דים.

We will look to the past of the land [of Israel], which we want to revive and renew. It excelled in "seven species," and these flourished and became densely populated. Not only wheat and barley, but also trees that give a large and nutritious crop. Among the trees: the olive, [...] the vine, the fig and the date. For three of them, the olive, the fig and the date, it is the sin of our settlement that it does not hold on to them with a strong grip and does not develop them.

He continued to discuss the benefits of adopting the date—not then part of the diet of Jewish settlers—to “health and economy” (בריאות וכלכלה). Not only should the “land of Israel” become self-sufficient (no longer importing dates from Egypt and Iraq), but dates should be grown for export to Europe.

A beginning had already been made in the importation of about 8,000 date palm saplings over the past two decades, of which ¾ (according to Israeli) had been brought by Kibbutz Kinneret, and the remaining ¼ by the settlement department of the Zionist Commission for Palestine (ועד הצירים), by the Mandate government's agriculture department, and by people from Degania Bet kibbutz ('דגניה ב). The majority of these imports did not survive. More recently, 1000 smuggled saplings had been planted in Rachel’s Park (גן רחל), in a nearby government plot, and in various places in the Jordan Valley. Farms and agricultural institutions would need to collaborate in finding farmers to plant dates more widely in the Beit-Sha’an Valley (בקעת בית שאן), and work to make dates take their proper place in the settlements’ economies.

These initial cuttings and their descendents survive in large plantations across “Israel” and the occupied Palestinian territories. Taher Herzallah and Tarek Khaill write that “Palm groves were planted from the Red Sea in the south along the Dead Sea, and as far as the Sea of Galilee up north, which has given the Israeli date industry its nickname ‘the industry of the three seas’” Since Israel occupied the Palestinian West Bank in 1967, it has also established date plantations in its illegal settlements in that portion of the Jordan Valley.” Today, these settlements produce between 40 and 60% of all Israeli dates.

In 2022, Israel exported 67,042 tons of dates worth $330.1 million USD; these numbers have been on a steady rise from 4,909 tons worth $1.2m. in 1993. Palestinian farmers and their children, disappropriated from their land and desperate for income, are brought in to date plantations to work for long hours in hazardous conditions for low pay. Workers are lifted into the date palms by cranes where they work, with no means of descending, until the crane comes to lower them down again at the end of the day. Injuries from falls, pesticides, heat stroke, and date-sorting machinery are common.

Meanwhile, settlers work to curtail and control Palestinian production of dates. The Palestinian population in the West Bank and Gaza is used as a pool of cheap labor and a captive market to purchase Israeli imports, absorb excesses in Israeli goods, stabilize Israeli wages, and make up for market deficits. Thus Palestinian date farmers may be targeted with repressive measures such as water contamination and diversion, destruction of wells, crop destruction, land theft, military orders forbidding the planting of trees, settler attacks, closing of checkpoints and forbidding of exports, and the denial of necessary equipment or the means to make it, in part to ensure that their goods do not compete with those of Israeli farmers in domestic or foreign markets. Leah Temper writes that these repressive measures are part of a pattern whereby Israel tries to “stop [Palestinian] growth in high value crops such as strawberries, avocados and dates, which are considered to be ‘Israeli Specialties’.”

At other times, Palestinian farmers may be ordered to grow certain crops (such as strawberries and dates), and forbidden to grow anything else, when Israeli officials fear falling short of market demand for a certain good. These crops will be exported by Israeli firms, ensuring that the majority of profits do not accrue to Palestinians, and that Palestinians will not have the ability to negotiate or fulfill export contracts themselves. Nevertheless, Palestinian farmers continue to defy these oppressive conditions and produce dates for local consumption and for export. Zuhair al-Manasreh founded date company Nakheel Palestine in 2011, which continues production despite being surrounded by Israeli settlements.

Boycotts of Israeli dates have arisen in response to the conditions imposed on Palestinian farmers and workers. Herzallah and Khaill cite USDA data on the effectiveness of boycott, pressure, and flyering campaigns initiated by groups including American Muslims for Palestine:

Israel’s exports of dates to the US have dropped significantly since 2015. Whereas 10.7 million kilogrammes (23.6 million pounds) of Israeli dates entered the US market in 2015-2016, only 3.1 million kilogrammes (seven million pounds) entered the US market in 2017-2018. The boycott is working and it is having a detrimental effect on the Israeli date industry.

Date products may not be BDS-compliant even if they are not labeled as a product of Israel. Stores may repackage dates under their own label, and exporters may avoid declaring their dates to be a product of Israel, or even falsely label them as a product of Palestine, to avoid boycotts. Purchase California dates, or dates from a known Palestinian exporter such as Zaytoun or Yaffa (not “Jaffa”) dates.

[ID: Close-up of the top of ma'moul, decorated with geometric patterns and covered in powdered sugar, in strong light and shadow. End ID]

Elsewhere

Other efforts to foreground the provenance and political-economic context of dates in a culinary setting have been made by Iraqi Jew Michael Rakowitz, whose store sold ma’moul and date syrup and informed patrons about individual people behind the hazardous transport of date imports from Iraq. Rakowitz says that his project “utilizes food as a point of entry and creates a different platform by which people can enter into conversation.”

[1] Plates from the tomb can be seen in N. de G. Davies, The tomb of Rekh-mi-Rē at Thebes, Vol. II, plates XLVII ff.

Purchase Palestinian dates

Donate to evacuate families from Gaza

Flyer campaign for eSims

Ingredients:

Makes 16 large ma'moul and 32 ka'k al-aswar; or 32 ma'moul; or 64 ka'k al-aswar.

For the dough:

360g (2 1/4 cup) fine semolina flour (سميد ناعم / طحين فرخة)

140g (1 cup + 2 Tbsp) white flour (طحين ابيض)

200g (14 Tbsp) margarine or vegetarian ghee (سمن), or olive oil

2 Tbsp (15g) powdered sugar

1 1/2 Tbsp (10g) dugga ka'k (دقة كعك)

1/2 tsp (2g) instant yeast

About 2/3 cup (190mL) water, divided (use milk if you prefer)

1 tsp toasted sesame seeds (سمسم)

1 tsp toasted nigella seeds (قزحه / حبة البركة)

Using olive oil and water for the fat and liquid in the dough is more of a rural approach to this recipe; ghee and milk (or milk powder) make for a richer cookie.

To make the bracelets easy to shape, I call for the inclusion of 1 part white flour for every 2 parts semolina (by volume). If you are only making molded cookies and like the texture of semolina flour, you can use all semolina flour; or vary the ratio as you like. Semolina flour will require more added liquid than white flour does.

For the filling:

500g pitted Madjoul dates (تمر المجهول), preferably Palestinian; or date paste

2 Tbsp oil or softened margarine

3/4 tsp dugga ka'k (دقة كعك)

3/4 tsp ground cinnamon

5 green cardamom pods, toasted, skins removed and ground; or 1/4 tsp ground cardamom

Small chunk nutmeg, toasted and ground, or 1/4 tsp ground nutmeg

10 whole cloves, toasted and ground, or 1/4 tsp ground cloves

The filling may be spiced any way you wish. Some recipes call for solely dugga ka'k (or fennel and aniseed, its main components); some for a mixture of cinnamon, cardamom, nutmeg, and/or cloves; and some for both. This recipe gives an even balance between the pungency of fennel and aniseed and the sweet spiciness of cinnamon and cloves.

Palestinian date brands include Ziyad, Zaytoun, Hasan, and Jawadir. Palestinian dates can also be purchased from Equal Exchange. You can find them online or at a local halal market. Note that an origin listed as "West Bank" does not indicate that a date company is not Israeli, as it may be based in a settlement. Avoid King Solomon, Jordan River, Mehadrin, MTex, Edom, Carmel Agrexco, Arava, and anything marked “exported by Hadiklaim”. Also avoid supermarket brands, as the origin of the dates may not be clearly marked or may be falsified to avoid boycots.

Instructions:

For the dough:

1. Melt margarine in a microwave or saucepan. Measure flours into a large mixing bowl and pour in margarine; mix thoroughly to combine. Rub flours between your hands for a few minutes to coat the grains in margarine. The texture should resemble that of coarse sad. Refrigerate the mixture overnight, or for up to 3 days.

2. Add dry ingredients to dough. If making both molded ma'moul and ka'k al-aswar, split the dough in half and add sesame and nigella seeds to one bowl.

3. Add water to each dough until you get a smooth dough that does not crack apart when formed into a ball and pressed. Press until combined and smooth, but do not over-knead—we don't want a bready texture. Set aside to rest while you make the filling.

For the filling:

1. Pit dates and check the interiors for mold. Grind all ingredients to a paste in a food processor. You may need to add a teaspoon of water, depending on the consistency of your dates.

To shape the cookies:

Divide the filling in half. One half will be used for the ma'moul, and the other half for the bracelets.

For the ma'moul:

1. With wet hands, pinch off date filling into small chunks about the size of a walnut (13-16g each, depending on the size of your mold)—or roll filling into a long log and divide into 16-20 even pieces with a dough scraper. Roll each piece of filling into a ball between your palms.

2. Divide the dough (the half without seeds) into the same number of balls as you have balls of filling, either using a kitchen scale or rolling into a log and cutting.

3. Form the dough into a cup shape. Place a ball of filling in the center, and fold the edges over to seal. Press the dough into a floured ma'moul mold to shape, then firmly tap the tip of the mold on your work surface to release; or, use a pair of spiked tweezers or a fork to add decorative designs by hand.

4. Repeat until all the the dough and filling has been used, covering the dough you're not working with to keep it from drying out. Place each cookie on a prepared baking sheet.

For the ka'k al-aswar:

1. With wet hands, divide the date filling into about 32 pieces (of about 8g each); they should each roll into a small log about the size of your pinkie finger.

2. Divide the dough (the half with the seeds) into as many pieces as you have date logs.

3. Take a ball of dough and flatten it into a thin rectangle a tiny bit longer than your date log, and about 3 times as wide. Place the date log in the center, then pull the top and bottom edges over the log and press to seal. Seal the ends.

4. Roll the dough log out again to produce a thin, long rope a little bit thinner at the very ends than at the center. Press one side of the rope over the other to form a circle and press to seal.

5. Repeat until all the the dough and filling has been used, covering the dough you're not working with to keep it from drying out. Place each cookie on a prepared baking sheet.

To bake:

1. Bake ma'moul at 350 °F (175 °C) in the center of the oven for about 20 minutes, until very lightly golden brown. They will continue to firm up as they cool.

2. Increase oven heat to 400 °F (205 °C) and bake ka'k al-aswar in the top third of the oven for about 20 minutes, until golden brown.

Sprinkle cookies with powdered sugar, if desired. Store in an airtight container and serve with tea or coffee, or give to friends and neighbors.

[aventurine83]

Fae Of My Dreams

Lilia Vanrouge X Reader

Notes: G/N reader!

Silver sighed as he watched Y/N and Lilia standing at the opposite ends of the ballroom temporarily arranged for Night Raven College's year-end party with magic. He watched them both sneak glances at each other before turning away yet again. He knew he had to do something about this, it was one of the only ways he could help his beloved father and pay him back for everything he'd done for the silver haired boy for years.

Lilia wore a stunning dark green suit with blue embroidery and black lace, dark red ribbons decorated the pocket at his chest, giving him quite the regal look. The bangs that usually framed the side of his face were slicked back on one side and tucked quite carefully behind his ear. His usual bowtie was replaced with a regal black tie with green thorns and other motifs of the Thorn Fairy embroidered on it. His magenta eyes were striking, impeccably beautiful in all the wondrous ways that made him so breathtaking. His ears were pointed at the tips as was a visible feature in every faerie.

"Silver! Your tie is crooked yet again! I fixed it a mere minute ago!" Lilia pouted as he fixed Silver's tie, scolding the boy with the nagging nature that was inherently present in all parents.

"Father. Y/N does not have a dancing partner yet." Silver started, a hint of nervousness in his tone. Lilia threw the boy a questioning glance, one that made him tense up due to reasons that were more than obvious. Lilia's gaze could be rather sharp and intense at times.

"What of it?" Lilia picked up a goblet of tomato juice, tilting it ever so slightly to his dark lips, drinking with grace and poise. His movements were elegant, such that set him apart from others.

"I figured you could dance with them. They do not seem to have a partner yet." Silver felt the nervousness inside him grow as he watched Lilia raise an eyebrow, his gaze even more questioning. "I meant that I felt bad that they do not have someone to dance with yet. And I have already promised to dance with someone else." Silver quickly added so that his father would not grow suspicious of what Silver was trying to do.

"Ohh! Is that so? You really are such a kind child." Lilia giggled, patting Silver's head. Silver felt a smile break out on his face as he watched his father trot over to Y/N.

---

"May I have this dance?" Lilia held the back of Y/N's hand, as he dropped to one knee on the gleaming quartz of the ballroom floor. Y/N's eyes sparkled with affection as they felt warmth build up in their chest... the Lilia Vanrouge was asking them to dance.

"I would love to." they whispered as Lilia grinned from ear to ear, pulling himself up as he led them in the dance. Lilia was a brilliant lead, occasionally floating upwards to provide himself support and momentum. The way he held their waist was gentle, his hand fitting just right on the curve of their waist.

"Have you been staring at me?" Lilia whispered. Y/N's cheeks heated up as they felt Lilia spin them around before bringing them in closer to his warm, broad chest, a motion that made them feel instantly comforted.

"Was I that obvious?" Y/N whispered back. Lilia giggled as he felt Y/N's hand travel up his back during the dance, their other hand carefully intertwined with his.

"Not you. It was due to something else, actually." Lilia winked, his warm breath hitting their ear, which made them shiver and grip onto the crimson eyed fae tighter. The former general chuckled raspily as he followed the continuity of the rhythm leading up to the final dance steps.

Once the dance concluded, every dance partner shook hands with the one they danced with, as a form of expression of having enjoyed the evening. Y/N held their hand forward to shake Lilia's, only to be met with the fae grabbing their hand and pulling it to his soft, inviting dark lips, as he planted them on top of the back of their hand. Lilia then turned their hand slightly and kissed their palm, his tongue flicking out slightly in a teasing manner during the soft kiss.

Y/N felt their heart explode, but they were not given any rest as Lilia rose up and placed his hands gently on the side of their face, kissing them on the lips, interweaving the sweet taste of his lips with theirs. The kiss lasted for several minutes, the other students all watching agape as Y/N overheated and Lilia pulled away from the kiss with a smirk.

"I love you, Y/N." Lilia murmured.

"I love you too." was all they could say.

---

"Father! How was your evening?" Silver inquired as his father returned joyously. Lilia chuckled and patted Silver's hair.

"It went great. I shall go head to Diasomnia earlier to rest." Lilia smiled cheerily.

"I'm glad." Silver gave a faint smile. Lilia walked past him, stretching his limbs. But as Lilia reached a bit farther away from the boy, he turned towards him and called out.

"Oh! And Silver. Thank you for getting this old man a love life. I had long been looking for one." Lilia winked. And with that, he teleported amidst a few sparkles and a faint, ethereal glow, and was gone.

Of course he'd known. Silver should've known better than to underestimate the man who had raised him.

---------------------------------------------------

@cecilia244 Your order!!

[poomphuripan]

what do you think of the comments on mdl of my stand in calling ming a cheater?

hi nonnie []~(￣▽￣)~* that's actually something i've been thinking to write about because i saw those remarks as well but it is such a controversial thing to discuss. if you don't mind, this discussion post will be filled with mild spoilers of the novel.

!!!!!! novel spoilers warning !!!!!!

alright so first of all, @ineffable-opinions wrote an excellent post about the danmei tropes in my stand-in (which i highly recommend everyone to read). this is a great post as they discussed the white moonlight trope presented in my stand-in.

i don't consider ming, a cheater because as i see it, tong was simply ming's white moonlight. ming never established a physical nor emotional connection with tong, throughout his time knowing joe. tong was always an idealised fantasy, he's mistaken it for it to be love. in other words, i see it as ming looking up tong like a delulu fanboy with an idol crush than him actually having any substantive feelings for tong ever. i mean if you had a partner that looked like a kpop idol, and sex with your partner makes you feel like you're achieving your sexual fantasy, are you cheating on your partner? maybe? maybe not? probably controversial and debatable question but for me, i don't consider it 'cheating'. i do think ming took for granted joe's genuine feelings and did not fully appreciate joe's affection (ming you ungrateful bish, repent).

during their time together playing pseudo 'not boyfriends', ming showed that he could be an okay partner. whether it's caring about joe's day at work, how hard joe's job as a stuntman, accepting joe's invitation to accompany him to his wrapped filming party.

i mean it's really bare minimum but that's already quite a lot coming from the dude who's afraid as hell once joe started mentioning the 'faen' word, triggering his self-defense mechanism, depreciating himself trying to claim that joe wouldn't be able to stand him.

i think one of the most obvious example of how afraid ming was to lose this relationship, was him using the word 'faen' in the last breakup fight with joe. this line was very ironic of him to say, because i'm sure even ming knows this line applies more to himself (how in this life, ming won't be able to find a better boyfriend than joe).

i absolutely love ming's emotion progression in ep 4 because it encapsulates perfectly his 21 year old spoiled brat attitude. he was confused when broken up over the phone, then mad and started throwing tantrum trying to get joe to coax him (like joe always does), until he realized it wouldn't work this time and he started frantically begging for joe to stay so they could go back to playing house and being happy.

personally, i don't consider it cheating because by around ep3/4, you can already started seeing ming settling down with the option that makes him "happy". some may even argued that by this point, he has 'recognized' his feelings (not me though, i think he just wanted his simple happiness/domestic bliss back, i still think it's during the period he lost joe 1.0 that he learned what love truly is).

now the most important question of all: is ming cheating on joe 1.0 with joe 2.0 or vice versa?

to quote chapter 63 of Professional Body Double (My Stand-In novel), i think the author puts it best how ming views joe 2.0.

He has fallen to the point of looking for the shadow of that person in a substitute. This is his punishment. When he thought that he was using [Joe] as [Tong]’s substitute, he was not aware of the actual person who had entered his heart. He had failed miserably with this method but still could not help himself from wanting to try. There are no other reasons. Just that he was in too much pain. He can’t endure anymore. He was adamant that [Joe] is not dead but no one could confirm it. That little doubtful voice in his heart is getting louder and louder, but is roughly suppressed by him time and time again. To continually be persistent with this thought, he needed a lot of willpower. He knew better than anyone else. Even if this [Joe] could bring him a little comfort, he wanted to be close to him, just like a long frozen person wanting to be close to a matchstick. This can’t save him… but he couldn’t stop himself from taking that little warmth.

i LOVE this metaphor and this little inner thought of ming we got because we can see how he's very much aware that he's falling right back into the bad habit that got him into trouble in the first place but... he's a fucking fool... who resorts to spiritual shamans for hope...

but also the familiarity he got from joe 2.0 is way too strong to joe 1.0. so for me, i'm seeing it as ming is using joe 2.0 as a means for comfort and relief as well as keeping him close to observe the similarities between him and joe 1.0, rather than viewing joe 2.0 as a replacement for joe 1.0 (because keep in mind, at this point he doesn't know they're the same person yet).

so !!!!!!!!! BIG WARNING of spoilers from the novel !!!!!!!!! if joe had considered joe 2.0 to be a direct replacement of joe 1.0, i don't think he would have had this conversation with joe 2.0 about joe 1.0.

Ming spoke right at this time. His voice sounded very faint and very soft, “Joe, are you hiding something from me?” Joe didn’t know what Ming meant by this. He asked cautiously, “I don’t understand what Khun Ming means.” Ming, “The feelings you give me is too familiar. It’s as if I’ve known you and have lived with you before. Why is this?” Joe forced himself to responded, “Maybe this is fate.” If it wasn’t because they are fated, they would not be in the predicament of today…with a relationship that is so unclear in both past and current lifetimes. “Joe. Tell me….If a person had been missing for more than two years, do you think he may still be alive?” Joe’s tensed up and smiled, “Most likely impossible. If still alive, he would have come back already.” “Why can’t he be alive? It could be that he didn’t come back because he doesn’t want to come back.” Joe is silent for a moment, “Khun Ming, are you talking about the other Joe?” Joe clearly felt Ming’s body stiffened. Then Ming asked, “How much do you know about him?” “I don’t know anything at all. I just heard from what others have said.” Ming quietly asked, “Then do you know what relationship I have with him?” Joe’s heart tightened, What relationship? You say, what relationship? He clenched his teeth in the dark, “I don’t know.” Ming’s voice is like the rising of the quiet abyss, cold and empty, “I feel that he’s not dead. He just doesn’t want to come back.” Joe heard his own voice dissociated from his thoughts and automatically asked, “Why won’t he want to come back?” Ming didn’t respond to his question, instead he tightened his arms around Joe.

i like that in the 2.0 timeline, we got ming learning but also not learning his dumbass mistakes at all. ming learned that he should be upfront about his feelings and be straightforward with his sexual partner, but at the same time he's still impatient, hot tempered and say hurtful things easily.

so i think through and through the second half of the series, you'll see his fidelity to joe (the soul) only. while perhaps it was the shadow of a back that mesmerized ming in the first place, but it's the kindhearted soul of joe that ming truly fell in love with, the person that showed him what love means, the only period in his life where he felt happiness.

© gif courtesy of the talented @alienwlw

you can also check out @befuddledcinnamonroll and @ineffable-opinions discussion on matters of transmigration, attachment of the soul with the body in their excellent posts, here and here. to sum it up, i think up kinda succintly puts it here in this interview.

of course, this is not to excuse dating/fucking anyone who resembles your missing ex but then treating them like they're your object ;_; like i'm just saying i don't think what ming is doing with joe 2.0 can be categorized as cheating (for me). it's something scummy, foolish, dumb, really stupid but... not cheating ┗( T﹏T )┛.

also if you notice, ming doesn't sleep around. surely he could have slept with dozen of nice looking man with similar physique to joe 1.0 to "keep the warmth" if he was that type of dude... but he doesn't... so for me, i see this proposal he has for joe 2.0 is not simply because of a physical attraction/similarity to joe, but it's the vibe/the aura/the ✨energy✨ that joe 2.0 radiates that is too similar to joe 1.0, drawing ming to him again.

tldr: ming is a lot of things but for me, i would never characterize him as a cheater. ming is a scummy, spoiled, arrogant, entitled, hot tempered hi-so brat but also a foolish little crying bag with zero wife-chasing skills. his only tactic is begging and getting his waterworks flowing.

ps: i'm not sure if this ask actually answers your question at all but hopefully some of my thoughts made sense ಥ_ಥ

[coca-lastic]

How would the THG male characters make the tiktok trend about ranking kisses?

Characters: Finnick Odair, Corionalus Snow, Peeta Mellark.

If you don't know what trend i'm talking about, click here <3.

My first lenguage Is not English btw.

Modern AU.

I think that if Finnick lived in a world like ours, he wouldn't be that kind of person who uses social media a lot, I think he would preserve his love for nature, especially the sea, so he wouldn't find out about this type of trends, you are the one who should ask if you can do it together.

Once you ask him and let him know the trend, he would gladly agree, he is too sweet, he simply saw that it was an activity as a couple, kisses, laughter, and said "yes"

Noooow, his ranking:

1. Lip kiss: Have you seen this man? He is the sweetest, kindest and most loving person there is, so a kiss on the lips would be his favorite kiss. He loves to kiss you on the lips at all times and looks for an excuse to do it even in the most unexpected moment, but if there is something he loves most it is that you take the initiative, that makes him feel loved and cared for.

2. Forehead kiss: He likes it because he considers it something cute and a sign of care. According to him, it is a way of consoling and giving comfort, a way of saying "I'm here for you but you have your space."

3. Check kiss: He loves to use it as a way of saying "hi" or "bye", he likes it when you do it to him and he likes it when he does it to you. "It's simple, but it's important," he says.

4. Top of the head kiss: He likes it more when you do it to him than when he does it to you, because yes, it's cute to kiss you in the middle of all your hair, but when you do it to him, OH GOD. He loves that because that almost always comes accompanied by a lot of cuddles and cuddles, scratches and caresses in his hair and a lot of kisses there, and that relaxes him a lot, he loves those little touches.

5. Nose kiss: It's funny, a kind of funny that makes you laugh, you also like it because it's tender, but at the same time it's fast, you don't need much time to do this type of "kiss", just a small approach and the magic It is done.

6. Neck kiss: The reason why this is not higher is because he feels that they are necessary for specific moments, I mean he is not going to use them unless he wants something, but if he not dislikes the sensation, he likes it and even more so when the room is hotter than usual and you are on top of him. BUT he doesn't mind if you do it at any time.

7. Butterfly kiss: It's a bit like the nose kiss, he likes it because it makes him laugh, but he doesn't like it as much as the nose kiss. Although, the advantage of doing this kiss is that he loves seeing the color of your eyes, and you love his.

8. Air kiss: "I'd rather you kiss me on the lips and that's it, but you look cute when you do that."

9. Hand kiss: It's not a common thing in your two's relationship, so it's not something he loves very much, but he values any kind of kiss, so obviously a kiss on the hand will also make him smile.

10. Bite kiss: He doesn't even do it, you just bit him a little because it appeared in the filter and he smiled, but he doesn't totally like it.

I admit, I'm not a fan of Corio, but I think he's soooo handsome, I just can't forget his future stuff.

But it's all for the girls. Anyway, I think Corio would have social networks and use them, but he would not be the guy who would participate in trends, I don't even think those things appear in his fyp, but if you ask him, he will be totally willing.

In my opinion, Corionalus, unlike Finnick, is a spicy boy, so I think the kisses he likes would be more double meanings, so this part may be a little suggestive.

And, his ranking goes like this:

1. French kiss: I think that for this and the kiss neck it was a complicated battle, but what could be more pleasant than a French kiss? He likes the feeling of mixing, the unification of the voices and tonges of the two of you.

2. Neck kiss: And here it is, almost number one but it was number two. I have a feeling that he likes to do it, to do it to you, because I think it would be a song for him to hear your voice telling him that you like his kisses, so he would go on and on and on, so a well-deserved 2nd place.

3. Lip kiss: It's the classic, the boy may have his hot side but I have a feeling that he also likes the little moments in which you go to an expensive restaurant and kiss each other on the lips while the moon and stars watch you two. Small kisses while you two laugh, or while you talk, perhaps it is not the first place in the ranking but those moments and those kisses are important for him.

4. Earlobe kiss: And we return to that usual side, he likes to hear your voice close to his ear, saying sweet little things. He likes the mix of emotions and the way both of your bodies react.

5. Bite kiss: It depends a lot on what type of bite it is, sometimes you two do it as a joke to scare or annoy the other, but if you do it after a French kiss and in specific areas it totally moves up the ranks.

6: Forehead kiss: Making sure his girl feels loved is important too, so he would do whatever type of kiss you like. But this one in particular he considers very sweet, he likes to do it to you and he likes it when you do it to him, he loves it when one of the two of you does it after a long night or after a moment of stress.

7. Top of the head kiss: The level of his affection for this kiss is a little similar to the previous one, the only reason this is lower in the ranking is because he can't feel your skin or your lips touching his skin as much, so 7 is the right place.

8. Hand kiss: He's done it to you a few times but not enough to love the gesture, it just seems elegant to him.

9. Check kiss: Once again, if you want it he will give it to you, but it doesn't seem like a big deal to him.

10: Butterfly kiss: "what Is this shit?"

MY BABY PEETA. Ok ok ok, if Peeta lived in our world his tiktok would be full of random things, but yes, things about couples would appear, so maybe he would be the one asking you to make some trend, maybe it would be you, it doesn't matter, he will always will be willing to do them.

I think that, like Finnick, he is a boy who likes the sweetness of a relationship more, a person who values small signs of affection, so his ranking would be like this:

1. Check kiss: This is because as I said previously he is a person who values even the smallest things, mine needs a long kiss to be happy. Also, when you kiss him on the cheek and smile at him I suspect he would blush and smile like a fool.

2. Lip kiss: Didn't you see him kissing Katniss? This guy knows how to kiss and he loves it, AAAAAAAAAAAAAAA, he would just come up to you and ask if you could give him a kiss.

3. Earlobe kiss: Whatever the intencion is, he likes it, it seems like a sign of affection in which he can hear your silly giggle and at the same time receive affection.

4. Forehead kiss: He sees that kiss as tender, so kind, so loving. He would probably enjoy giving them to you, he would like to see you close your eyes briefly and give you a little kiss there, it makes him happy.

5. French kiss: I feel like it would take you two a while to do it, because I have a feeling that Peeta would prefer to slow down, appreciate each moment and get used to your affection. But when they get to this point he loves it, he loves doing it but he doesn't do it so often so as not to take away that special effect.

6. Butterfly kiss: "Awww, that's cute, you look cute".

7. Top of the head kiss: Maybe after help you with your hair or when you are already in bed, but it is not that common, although that does not mean that he does not like it.

8. Spiderman kiss: "That's very complicated, better just give me a kiss." And he is right, because it is not a bad position but it is not the most comfortable for the two of you.

9: Nose kiss: Find it cute, but that's all :(

10. Air kiss: Because he prefers that you give him a kiss, but if for some extra mega hyper ultra important reason you can't, he might accept it.

My mom just hit me because I told her that she always gets upset, so she got upset and hit me 😀👍🏼 I want to kill myself haha

[hellenhighwater]

when you dip something in glaze, how do you make sure the bit where you're holding it also gets covered? Does the part where you're holding it with the tongs nit turn into an Achilles heel of some sort? or do you maybe dip twice?

If you look at the video, I am using tongs, so that's at least less covered than when I do it bare handed. You can then sort of buff the point where the tongs contacted to cover that patch; you can also just take a paintbrush and dab on glaze to make sure it's covered. Dipping is easier than painting something with a brush, but you can get the same result either way. You can dip twice but you risk too heavy of a coat of glaze--it may run, or bubble, or break. It's easy to just patch the spot where the tongs were.

Glaze does basically liquefy at high temps before it solidifies into that glassy surface you have on finished ceramics, so small bare areas often get run over with glaze naturally. That's also the reason that the bare area on the bottom of stuff goes up a few millimeters--in case the glaze runs down, it hopefully won't run far enough to reach the shelf.

[rkivesyoshi]

to be feigned into love with ryomen sukuna

special chapter, read the rest here.

pairings. oc x sukuna

content. sfw

language. english, tagalog

song.

warnings. none

tags. ryomen sukuna x fem!oc, fake dating trope, lawyer!ryomen x art director!oc, established couple

synopsis. a second time truly is magical, if given the chance. shortly after itsumi and ryomen had become an official couple, they decided it was time to present themselves to each of their parents, again, and this time, as true lovers.

note: this is written in first person point of view and in the perspective of the oc, itsumi.

enjoy reading!

◛⑅·˚ ༘ ♡ ೃ⁀➷ ` ੈ˚ ★ ◛⑅·˚ ༘ ♡ ೃ⁀➷ ` ੈ˚ ★

“Ryo, sure ka ba, okay lang ‘tong suot ko?” I ask for the nth time, checking myself in the mirror.

We’re going to meet his parents today and i have never felt more conscious, let alone anxious in my entire life. My job requires for me to converse with various people and I never once had emotions like this when doing so.

Ryo walks up to me and from the back, he wraps his arms around my waist planting a kiss on the crown of my head. “You look beautiful, my love.”

“What about my outfit, sa tingin mo, hindi ba sobra o kulang?” Aligaga kong tanong dito.

“It’s just right, my love.” He answers with no hesitation.

Realizing there was no benefit in me overthinking things, I took his word for it and we finally got to leave our apartment.

“Ah, my son was right, you are a gorgeous young woman, Itsumi.” Nakangiting sambit ng nanay ni Ryomen matapos akong mag-mano rito.

Ngumiti naman ako pabalik, “Thank you po, tita! Pero mas maganda po kayo, alam ko na kung kanino nag-mana si Ryo.”

“Naku!” Lumingon ito sa asawa. “Narinig mo ba ‘yon, mahal? Sa akin daw namana ng anak natin ang kagwapuhan niya.” Pag-bibiro nito.

“Hindi naman ako tatanggi ro’n, mahal.” Sagot naman ng tatay ni Ryomen.

Naramdaman ko naman ang pag-iinit ng mukha ko nang mapagtanto ko ang aking sinabi.

“Lagot ka,” Pag-singit ni Ryo sa gilid ko. “Hindi ka na papasa kay papa niyan.” Halata sa kanyang boses ang pang-aasar.

Pinalo naman ito sa balikat ng kanyang nanay at pinagsabihan, “Baka maniwala si Sumi. ‘Wag mong binibiro ng gano’n.”

Then dinner time came and it was nowhere near what I expected it to be. Magaan ang pakiramdam ko na makipagusap sa mga magulang ni Ryo. Palabiro ang kaniyang tatay at ang kaniyang nanay naman ay sinasabayan din ito. We shared heartfelt laughs, talked about our plans, dreams, and shared our values. Surprisingly, his parents and I have so much in common — so much more than my own.

My heart felt so full and joyous.

It was on the way home that I realized Ryo was reared in a secure household. Looking back, maybe it was the reason why he left and didn’t force anything between us—why he just let time and fate bring us together once more.

“Honestly,” Pag-uumpisa ko. “Kung ayaw mong makaharap si dad ulit, I respect that. We don’t have to go.”

Bahagya itong tumawa. “Bakit naman ako aayaw na harapin si tito?”

“Tito agad?” Tinignan ko ito ng may panghuhusga.

Natawa itong muli sa reaksyon ko. “What, does he prefer to be called sir or gusto mo, dad na lang din itawag ko?”

I cringe at the thought of Ryomen getting shut off in an instant if he had called my father dad on their first meeting in a long time.

“I can handle your father, Sumi.” He says, grabbing my hand as he guides us out of the apartment.

The ambiance from when we had dinner with the Sukunas compared to now differs greatly. This one makes you want to rip your head off, whereas the other was carefree. Moreover, I’m not entirely sure if having both of my parents here is good or bad. Though, on the bright side, this is the first time in a long time I’ve seen my divorced parents together.

“You’re that guy my daughter dated before, am I right? Iyong galing sa mababang pamilya.” Walang emosyong sambit ng tatay ko.

“Dad!” Pag-protesta ko rito.

Naramdaman ko ang kamay ni Ryo sa aking hita at marahan niyang hinaplos ito na para bang ipinapahiwatig sa akin na ‘wag akong masyadong mag-alala sa sitwasyon.

“You weren’t born a chairman. Naging empleyado ka rin na may mababang pwesto.” Pag-sumbat naman ng aking nanay.

I am already regretting even planning this dinner. Sana ay hindi na lang kami tumuloy.

“Yes, sir. I was that guy.” Sagot ni Ryomen sa tanong ni dad.

I gave him a glare, but he only squeezed my thigh, maybe as an attempt to reassure me that it’s all going to be fine.

“Was?” Natatawang tanong ni dad. “Bakit, marami ka na bang naabot sa loob ng maikling panahon?”

Kumukulo na ang dugo ko sa inis habang kalmado pa rin si Ryo.

“I believe so.” Sagot ni Ryomen. “I finished both of my undergraduate and graduate degree with latin honors. I was a top-notcher in the bar exam, and I work at a well-known law firm now.”

My dad snickered, “Face me again when you’ve built your reputation as a lawyer, or not. I know that field is very saturated.”

“I am building it at the moment, sir.” Ryomen smiles. “I specialize in corporate law and have won numerous lawsuits now. If you need my help, don’t hesitate to call. I heard your company is having troubles right now.” There was a hint of mockery in his voice.

Dad was left speechless and moments after, the silence was overrun with my mom’s mocking chuckle.

“Kid,” she turned to Ryomen. “I liked you before and I like you even better now. Good thing you two got back together.”

“Thank you, ma’am.” He smiled.

Mom waves her hand as if telling him off. “Enough with the ma’am. You can call me tita, or mom, but I prefer mom.”

Ryomen gave an amused chuckle before turning to me and winked. He leaned in closer to me and whispered, “What do you say, did I do a good job, princess?”

Naramdaman ko ang init ng aking mga pisngi.

“Kids,” Mom calls and we both face her. “Do you want to eat somewhere else? Nakakawala kasi ng appetite ‘yong atmosphere dito. Maybe we could go shopping, too.”

Pagkasabi niya noon ay dali-daling tumayo si dad at padabog na lumabas sa private dining area.

“So, kailan ang kasal?” Mom asked.

We ended up not having to change restaurants. Nevertheless, mom still insisted on going shopping and so we did, for two more hours. The night started out disastrous, but I’m thankful that at least Ryomen could get along with my mother.

“Bakit ‘di ka man lang nag-react do’n sa tanong ng nanay ko tungkol sa kasal?” Tanong ko kay Ryomen na ngayon ay nakaupo sa couch.

“I did, I smiled.” Simpleng sagot nito habang inaalis ang mga bitones ng kanyang damit.

Umupo ako sa kanyang tabi, “No, I mean, why didn’t you protest?”

Huminto ito sa kanyang ginagawa at tinignan ako na para bang may mali sa aking sinabi. “Protest?”

Tumango ako.

“Baby,” he turned to me, “there is no other ending to this than us getting married. Why would I protest? I intend to marry you, Sumi.”

“Isn’t it too early for you? You’re still starting on your career. Marriage is way different than dating.”

Ryomen examines me with a sincere gaze. “I’m not going to leave you. Hindi lahat ng marriage nasisira, Sumi.”

I look down, feeling a bit disappointed in myself for projecting unto him. “I know. Sorry.”

He scooted closer to me tilting my chin up before leaning in to kiss my cheek, “I’m going to marry you,” then my neck, “build a family with you,” then my lips, “all while loving you endlessly, my love.”

“You’re safe with me, Sumi.” He says before kissing me again, this time with more passion, as if it were full of love, hunger, and desire.

It wasn't long before my back touched the velvety feel of the sofa, and the sound of our moans and lips colliding together as he relentlessly professed his love for me faded into the night.

disclaimer! this is a fan-made content. i do not own the rights to the character of ryomen sukuna. nevertheless, i respectfully request that you refrain from reposting, translating, or copying my content because the plot is my original work.

[darkficsyouneveraskedfor]

Special Interest 7

Warnings: non/dubcon, age gap, creep behaviour, and other dark elements. My username actually says you never asked for any of this.

Characters: Cole Turner, short!reader

Part of the Bookstore AU

My warnings are not exhaustive but be aware this is a dark fic and may include potentially triggering topics. Please use your common sense when consuming content. I am not responsible for your decisions.

As usual, I would appreciate any and all feedback. I’m happy to once more go on this adventure with all of you! Thank you in advance for your comments and for reblogging.

You try to focus on your needles but find yourself distracted by your mother’s churlish cackles. Even with your music on, her performance rings through and Cole’s rocky undertones seep in. Why hasn’t he left yet? Ugh. You really can’t believe she invited him over. Or that your dad would let her.

You give up after having to redo several stitches. What a pair made in hell! Your mother is all about her fairytales and he’s a great panderer. Well, he’s old enough, maybe they should just be friends. You have no obligation to forgive him, not even tolerate him.

You lay down on your bed in defeat. You turn the music up from your phone and try to tune out reality. Billie Eilish can’t sing loud enough. 

As you reach a special reward on your favourite addictive merge game, there’s a knock at your door. You don’t answer as you go for the final match. The thumping gets louder and your mother hollers over the music.

“Dinner!” She barks, “turn that down.”

You get up and pause the music. You open the door and lean against it, “thought I wasn’t invited to dinner.”

“Can you be mature for one night?” She reproaches.

“I am, I’m minding my business,” you shrug.

“Please, honey, I never taught you to act like this when we have company.”

“Oh really, I’ll have to call up Aunt Gina–”

“Don’t say that name to me,” she snaps, “just come have dinner. And try to be nice.”

“What’s for dinner?” You ask.

“Pork chops, baked beans, and a veggie medley,” she announces.

“Fine,” you relent. You’re hungry enough to justify a plate.

You follow her downstairs, tucking your phone into your back pocket as you descend. You follow her into the kitchen and open the cupboard. Before you can slide a plate out, she closes the door, nearly catching your hand in it.

“What are you doing? Plates are on the table. Where we’ll be eating.”

“Mom,” you whine.

“Stop that,” she wags a finger at you.

You hold back a harrumph and keep from rolling your eyes until she turns away. You tramp after your mom into the dining room, keeping your gaze straight ahead. You pointedly ignore the stranger at the table. That’s what he is. You might know him but you have no desire to know that man.

Your father sits across from the intruder and you go to claim the seat next to him. Your mother tuts, “honey, I’m sitting beside your father.”

You pout and look at the other option, right next to… him. You drag your feet around the table and slide into the chair stiffly. You wait with your hands in your lap. You have a mission; eat and dip.

“Well, dig in,” your mother chimes.

You practice your patience well. Your mom will have no reason to reproach you. You wait for the man next to you to serve himself. After all, she sees him as a guest so it’s only right. 

As Cole takes a pork chop between the long tongs, he angles it over your plate, “this big enough?”

Your lashes flick up and you refuse to look at him or the cut, “sure.”

“Honey,” your mother hisses, “Cole, that is so sweet of you.”

“Well, my mom always taught me, ladies first,” he plops the chop down before he takes his own.

‘My mom…’ even you don’t talk about your maternal creator that much. He’s giving a very specific sort of vibe.

Your mother’s toe hits your calf and you wince. Her eyes flare and you clear your throat, “thank you,” you eke out.

“No problem,” he grabs the dish of beans, “how much?”

You weigh your response. You know what he’s doing. He’s trying to make you look bad. Joke’s on him, with your parents, that’s not that hard.

“Half a scoop is fine,” you utter.

He diligently serves you, finishing off with a heaping servings of veggies. Your stomach growls, betraying you just like your parents. You grab your fork as your father fills his plate in turn as he turns his attention on Cole.

“Lifesaver,” he praises, “that back-up was haunting me. Now the wife can’t nag about a broken sink.”

“Ah, it was easy,” Cole assures him.

“Wife says you come from a farm, must be handy,” your dad intones.

“Sure, you just sorta figure things out,” he slices into his pork chop and you poke at a piece of broccoli, “I’m more the green thumb type. My pa’s really the handy one. I just follow his lead.”

“Must be a good man,” your dad nods.

“I’m tryna learn as much from him as I can,” Cole agrees.

“Aren’t you like… forty?” You scoff.

Your mother drops her fork and gasps. Your father looks at you, appalled.

“Well, I mean, how much more can you learn?” You sniff, “probably learned it all by now, right?”

“Uh, yeah, he is getting older,” Cole answers grimly, “I gotta do a lot more of the heavy lifting.”

Your stomach sinks. Why did you have to say anything? You’re stupid and yet his preening was annoying. How did they not see some middle-aged dude who harassed a woman half his age in a bookstore because he thinks he knows better than a girl with a crochet book? Some big farm oaf.

“That wasn’t very nice,” your dad says, “why don’t you take a few lessons and apologise.”

“I…” you stammer and suck in your cheeks. You squint and stare at the joint of wall and ceiling, “sorry, I didn’t mean to–”

“You can apologise to him and not the wall,” your dad girds.

You huff through your nose and put your fork down. You turn in your chair to Cole and grit down your agitation. Why don’t they care that he’s invaded your life in the weirdest way possible? No one is that helpful for no reason.

“I’m sorry that your dad is old,” you say tritely.

“That’s not–” your father begins.

“Go to your room,” your mom speaks over him, “now. You’re embarrassing yourself.”

“You can’t just banish me to my room. I’m not a teenager,” you face her.

“You’re acting like one so go,” she demands.

“Gladly,” you slap your hands on the table and stand.

“It’s fine,” Cole says softly, making himself sound as pathetic as he can.

“It’s not fine, honey,” your mother insists and waves you out dismissively, “I am so sorry. You don’t deserve that after all you’ve done.”

You stomp out and shake your head. This is why your parents fell for that time-share. You’re the only one with sense and they refuse to see it.

[lisbeth-kk]

May Prompts (13) Laugh

The Luckiest Girl in the World (chapter 13)

Summary: Rosie gets a surprising gift from her parents. Later, she surprises her Papa by proposing an interesting experiment.

Thirteen Years Old

I’d wanted one for a long time, but for some reason I’d given up hope, so you can imagine my surprise, when I opened the box Papa handed me.

“But it’s not my birthday yet,” I protested more out of courtesy than actual refusal.

“You need it now, and your birthday is months away. Think of it as a gift in advance if you must,” Papa said impatiently.

That should’ve given it away, but I was so taken aback, and my brain cells probably weren’t at their brightest. The box was heavy and by the look in Papa’s eyes, it was clear that this wasn’t just a tiny thing, but something grand and important.

“Open it before Papa combusts,” Dad suggested with amusement.

Papa huffed and urged me to unwrap the damn box.

“Sweetheart, are you alright?” Dad asked when I’d peered into the now open box.

I had become mute, and apparently also adopted Papa’s way of reacting when something unexpected and sentimental was bestowed upon him - rapid blinking.

“Fine,” I whispered and finally looked up at my expectant and slightly worried parents.

I placed the box with utmost care on the table and fell into Dad’s waiting arms.

“You liked it then?” he inquired.

“Of course!” I exclaimed. “It’s perfect. Thank you.”

I kissed his cheek and turned to Papa. His arms embraced me hard.

“Thank you, Papa. I should’ve realised, but I got distracted,” I murmured against his chest.

“You’re welcome, Bee. I’m glad you liked it. You’ll need it the next couple of weeks with that science project of yours, and after that…well, I’m sure we can find some use for it.”

The gift was of course my very own microscope. A professional one like Papa’s. I’d tried his numerous times but having my own meant that I didn’t have to wait for Papa to finish using his. The things I missed were a Bunsen burner, flasks, beakers, tongs and so on, but I gathered that I would be allowed to borrow what I needed under supervision. I was already equipped with safety goggles, gloves and a thick apron. 

Papa had a whole lab set up down in 221C, which he used for his fouler smelling and toxic experiments. I knew I wasn’t allowed down there when one of them was ongoing, but hopefully I could persuade him to let me in if I was cunning enough.

***

In the weeks following my science project, I collected the items I wanted us to examine together. I had no idea if Papa already had studied this and made a spreadsheet like he usually did with things concerning the residents in 221 Baker Street. Truth be told, it was likely that he had, but I decided it was worth a try.

“I have a request,” I said after breakfast a rainy Saturday morning.

It would peak Papa’s interest if I used more adult language, instead of just blurting out: I want to do this and that.

“Pray tell.”

I had to try hard to keep my poker face intact when Papa’s eyes beamed at me from across the kitchen table.

“I know I’m not normally allowed downstairs, but I’ve noticed that there’s no ongoing experiments at the moment.”

I waited for Papa to respond, but he just narrowed his eyes and waved his hand, indicating that I should continue.

“Could we perform an experiment together?”

Dad cleared his throat.

“Nothing dangerous,” I hurried to assure him. “Just…come up to my room and see for yourselves.”

My courage was about to evaporate, but I straightened my shoulders and soldiered on. I added a please for good measure, and we all went upstairs.

I had placed everything on my desk. Zip bags with hair samples, threads from our clothes and fingernails, (alright, the latter was a bit disgusting, but at least it wasn’t toenails). In the petri dishes, I had collected our different shower gels, shampoos, conditioners and hair products. Sadly, Nana used hair spray, so there would be a gap in my spreadsheet.

“What do you think?” I asked expectantly. “We can compare…”

“Rosamund Watson-Holmes, you are brilliant!” Papa exclaimed, quite elated, laughing like a big child at this wonderful prospect.

“I guess, Christmas came early this year,” Dad added dryly. “Have fun, you mad scientists.”

He still shook his head fondly and I could hear him laugh quietly as Papa and I made our way down to 221C for a weekend of lab work.

Also available on AO3

@calaisreno @totallysilvergirl @keirgreeneyes @raina-at @helloliriels

Other tags in the replies

[cloudy-osc]

"Ever since she was little riley would always talk about these...friends in her head. We didnt know what they were of course. She even draw them on many diffrent occasions. As she got older she rarely ever brought it up untill recently how ever...she brought it up to bree and grace but they were just as confused as we are heh...why do you ask?"

Joy said to her orange companion who had a tense look of her face

"i-its just" she started "for some reason i keep worrying-no riley keeps worrying about this...i just dont understand why"

She fiddled with her sleeves before speaking up again

"you said she draw them right?"

"want me to show you?"

anxiety nodded as joy summoned the memory. Riley was no older then 4 at the time and she was coloring with her tonge sticking out like always. anxiety would have thought it was cute if the drawings wereint so...familiar? They looked familiar. Like shes seen these before...

She looked back at joy who had a smile of her face. She looked back then back at joy. Then again and again and again and again and-

"wait what!?"

"huh? anxiety whats the matter?"

"t-those drawings...there of you guys!"

Joy looked at anxiety puzzled. She looked back. That couldint be them...right

"whaat? I dout that. Its a coincidence at best"

"but joy-"

"besides Riley doseint know we exist"

"but joy!- ack!?"

anxietys worrying was cut short by a pillow to the head by ennui

"can you shut up im trying to sleep"

"oh! Ennui just the emotion i needed! Help me convince here!"

she said running and pushing ennui to the control pannel. She scoffed in return looking up at the memory playing

"and what exactly am i looking at anxiety."

"those drawings! They look familiar right?"

"...hm"

*she pulled out her phone takeing a photo of joy.*

"hmmm...looks similar to joy"

"exactly!!" anxiety yelled before looking ar joy

"see what i mean?"

"...i mean i guess it looks kinda like me" joy started "but its not possible Riley doseint know what we look like let alone if we even exist!"

"can you two just sleep on it or something. Ugh C'est trop tard for this nonsense"

anxiety sighed as she nodded

"exactly wee-wees right!"

"dont call me that"

"you just need to sleep on it. Youll forget about it by morning!"

It wasint that simple bit anxiety couldint argue. Joy then rushed the newer ones to bed as she went back to dream duty

"theres no way that real...right?"

But it got worse from then on.

(OK END NOTES! this is for an au i made a bit ago that i want to explore more. Ill write more soon but for now this is all i got. I may turn this into an ask blog or series or something like that but for now this is all you get. I hope you enjoyed! Feel fres to ask questions :>)

[daisynik7]

hruuuu! <3 for your y2k karaoke party,

"SOS" by Rhianna with getou suguru - smut+fluff?

ughh i love him so much tyyy

SOS

Pairing: vampire!Geto x f!reader

Rating: Explicit - MINORS DO NOT INTERACT

Word Count: ~1.5k

cw: vampire au, fluff, smut – PIV sex (missionary), cunnilingus, fingering, cum-eating, dirty talk

Author’s Notes: Thank you for sending in this request @idkks4m! LOVE this song, a classic hit for the y2k karaoke party! Wanted to try my hand at something a little bit different from my usual; I’ve seen the idea of vampire!Geto floating around here before, and I think it’s brilliant! Here’s my take on it. Hope you enjoy! MDNI banner created by @/cafekitsune. Likes, reblogs, and/or comments are always appreciated, thank you for reading!

It wasn’t supposed to go this far. 

That’s what you think as his fangs trail your neck, enough pressure to feel it scratch the surface, not enough to pierce the skin. His fingers glide down your arms, cold and lifeless, a stark contrast to the heat radiating from your burning body. How have you never noticed the differences before? The pale complexion, the bleakness in his eyes, the tight smirk on his lips, posing as human. How he only visits the café you work at right before closing, ordering his typical coffee, black.

Just your presence and I second guess my sanity.

You did notice the oddities but ignored them. Because no matter how uneasy he makes you, how many red flags you see, your carnal desires overtake everything else. After all, you were the one to invite him to your own home after your shift ended. It didn’t even cross your mind that this was an unsafe, reckless decision. All you could think of was the thrill of being alone with this mysterious, sexy stranger.

I should have never let him in. 

You had a choice. He asked you the question, standing outside your front door, baring his pointed canines at you, a warning sign. “May I come in?” And all you had to do was say no. You’re not sure what possessed you in that moment. Maybe it was curiosity. Maybe it was lust. Whatever it was, it made you say yes. And now, you’re absolutely terrified, undoubtedly nervous. Completely aroused.

Please someone help me. It’s not healthy for me to feel this.

His hands slide around your waist, pulling you in closer, lips joined together into a deep, passionate kiss. His tongue swirls around yours, and you can’t help yourself. You lick into his mouth, feeling for the tips of those fangs. The vibration from his voice as he chuckles sends a shiver down your spine. “You’re a curious one,” he says, eyes studying your face. “Aren’t you scared?”

You swallow hard, throat dense with saliva, shaking your head meekly, unable to get a word out. 

He laughs again, tipping your chin up with his finger to inspect you more thoroughly. “I’m not going to hurt you. Do you believe me?”

More confidently this time, you nod, managing a stuttering, “Yes.”

He swipes his tongue across his teeth, smiling. “Good girl.”

You lead him further inside, straight into your bedroom, common sense nonexistent at this point. There’s no reason for you to trust him; you know nothing about him. And yet, here you are, laid out and legs spread like a silver platter for him to feast on. Totally willing to submit to whatever he chooses to do with you. And for the first time since you met him a few weeks ago, there’s a flash of emotion in his eyes. 

It’s hunger. 

“Strip for me,” he demands, towering over you at the end of the bed, scanning your figure up and down. You obey, sliding out of your pants, hoisting off your shirt, leaving only your underwear on.

“Everything,” he growls, following suit. You marvel at his chiseled abs, salivating as he slides his sweatpants and boxers off, revealing his stiff cock sprung against his abdomen. Soon, you’re both completely naked, inspecting each other’s bare bodies, craving for a touch.

He smiles, more genuine than you’ve ever seen before. “You’re beautiful.” 

You gulp down the spit collecting on your tongue to respond, “So are you,” scooting up the bed to lean against the pillows. 

Crawling on top, he brushes your cheek with his thumb, whispering, “You’re going to be my little plaything tonight.”

You pull him down, kissing him sloppily, unable to contain your arousal any longer. He moans into your mouth, hands squeezing at your breasts, relishing the plump flesh between his cold fingers. He pinches your nipples, flicking over them with the pads of his thumbs, enjoying the way you whine at his touch. You reach for his cock, stroking it in your fist feverishly, impressed by the size. There are a million different questions running through your mind, but you save them for later, wanting nothing else except to be consumed by him. 

Not literally, of course. Though the possibility of that isn’t completely off the table just yet. And maybe that’s what makes this so exciting.

“Fuck me.” It slips from your lips, desperate and needy. Pussy aching to be filled with whatever he’s willing to offer you. 

“Not yet,” he breathes out, kissing you on the forehead. “I need to taste you first.” Suddenly, the fear returns, about ready to shove him off and run for your life. He laughs, scattering gentle kisses down your body, positioning his head between your thighs. “Not like that. Like this.” He flicks his tongue across your clit, slurping and sucking at your swelling bud until you’re bucking your hips against him, greedy for more. 

“Just as I thought,” he hums, spreading his tongue along your folds, collecting your slick. “You taste incredible.” He slips his middle finger inside you, curving at the tip to stimulate your G-spot. “Come for me. Give me your orgasm. Want to drink it up.”

You grip his hair between your fingers, climaxing on his face. He doesn’t let up, pressing himself deeper into your sopping cunt, slobbering all over you. When he pulls out, he sticks his cum coated finger into his mouth, sucking off your cum. Biting his lip, he wraps a fist around his shaft, tapping the tip on your sensitive clit. “You’re being such an obedient slut right now. Are you ready to take this cock?”

You’re in a daze, eyes half-lidded from your intense orgasm, still aching for him inside you. All you can do is nod dumbly, watching him guide his entire length inside you easily until he bottoms out.

“Fuck,” he grunts, nestling himself comfortably inside you. “You’re eating this dick up, aren’t you sweetheart?”

“Please,” you whine. “Give it to me.”

He chuckles, amused by your adorable reaction. “Okay, beautiful. Since you asked so nicely.” He grips your waist, holding you steady as he fucks you, hips thrusting wildly into your cunt. It’s even better than you imagined, his thick cock filling you up like nothing ever has before. He’s relentless, pace only increasing as your quiet moans become louder, your legs wrapping around him tighter. 

“This is what you want, huh? To be fucked like this.” His grip on you becomes firmer, nails digging into your flesh, imprinting on your skin. “You don’t even know me, and still, you let me in. What a stupid girl you are.”

You should be scared with the way he speaks to you, voice low and frigid, as if he can’t believe a human would be so foolish to let someone like him into their home, into their body. This is absolutely crazy, you admit it. But how can something that’s bad for you feel so fucking good?

Palms pressed to his cheeks, you pull his face close to yours, foreheads touching. “You said you wouldn’t hurt me,” you whisper to him. “I trust you.”

His eyes flash, seeming human for a split second. “Silly girl,” he mutters, kissing you on the lips. You stay like this until he unravels, spurting his seed inside you. Your legs are still coiled around him, holding him close to you as he comes down from his high.

“Wow,” he huffs, collapsing beside you. He’s pristine, like a marble sculpture, no trace of sweat or hint of blush on any inch of his body. You reach for him, tracing the outline of his lips, then his sharp jawline, noticing how cool he is against your fingertips.  

He smiles, letting you study him. “I’m sure you have a lot of questions for me.”

You do, and you’re tempted to ask all of them. However, in this moment, you’re not sure if you’re ready to know just yet. Instead, you ask the most vital one. A question that you should have known the answer to right from the start, human or not. “What’s your name?”

He laughs, nuzzling his nose to yours. “Geto. Suguru Geto.”

~~~

In the morning, he’s gone. You don’t expect him to stay, assuming what they say about vampires and daytime is true. Still, you’re saddened that he doesn’t. He never mentioned if he’d come in contact with you again. You assume he won’t, probably destined to move to another town where he can seduce a different woman, living in peace without his secret revealed.

So, it’s to your complete surprise when Geto does return later that night, smiling at you on your front doorstep, saying your name. “May I come in?”

[artistsmellslikeunemployment]

Things that natla did do:

- Katara stealing a water pouch from a merchant shop at night

- zuko draws!

- include pieces from the books and comics (mother of faces, Kyoshi‘s personality,

- „water the most promising seed“

- Katara standing by and smirking as Sokka flounders trying to impress Suki but her not buying any of it

- Katara never letting anyone talk over her once diplomacy fails

- Bumi‘s armpit hair

- Zuko talking about Lu Ten

- Azula learning to use a blue flame and failing

- what can I say, the actors make the show very enjoyable 🤷🏼‍♀️

- Kuruk refusing to take possession over Aang‘s body/ Avatar state

- overall I think they drew info from the books about the other eras

- the sound of Iroh‘s firebending reminding of a dragon‘s growl

- Avatar Roku making fun of Avatar Kyoshi

- Zuko basically enthusing about Kyoshi‘s strength only to then get his ass kicked by her

- Suki (and mom) gushing over seeing their role model Kyoshi in action

- random woman with broom and Zuko letting her hit him

- Aang running away at the end, after the battle. He might not have run from his responsibility but he ran from the consequences

- „have you seen my flying bison?“ which is way better because even less believable

- Katara being bold enough to train her waterbending in the abandoned fire navy ship around Wolf Cove

- emphasis on Sokka‘s inventory skills and by elongation his bad ice dodging skills

- Zuko deciding to stay with/ look for Iroh instead of chasing Aang twice

- Lu Ten‘s theme playing every time Zuko and Iroh confess their love for each other

- Omashu‘s part of the earth kingdom being India coded

- Zuko so specifically being triggered by the word „compassion“ but not „empathy/ emphatic“ because he actually does believe in kindness and much like Azula is still trapped in the pressure of having to represent all his father believes

- Zuko looking disgusted all the time

- 41st division bowing to their prince

- I had fun watching it and most of it makes sense tbh.

What I don’t get (logic mistakes):

- Mai being too openly anti fire nation by saying she wouldn’t ever come back if given the chance

- Iroh finding the Blue Spirit‘s mask in Zuko‘s pile of clothes but maybe that’s not even a negative.

- no talk about the meaning of the necklace

- Gyatso Living in the Spirit World (doesn’t Aang have enough guides with all his previous lives?);

- that assassination attempt on Ozai and Azula infiltrating the plan? Was this meant to show Ozai‘s cruelty and Azula‘s strategic thinking??

- what was Bumi‘s point exactly?

- Yue being a spirit fox. Why? It added nothing.

- „i bet you taste like chicken“ no opossum chicken. just chicken.

- Kyoshi being the narrator

- Aang being able to communicate with his past lives only by visiting their shrines and not in the right order (usually the avatar has to contact every avatar before him in the order of their lifetimes before he can get through to the next)

- Aang being shamed and gaslight by everyone

- confusion over what happened to the villagers as well as Katara and Solla by mixing Hei Bai‘s and Ko‘s stories as well as the Fog of Lost Souls and creating a new loophole into the spirit world when people stand too close to Aang while he meditates? Also, Ko‘s „Magic“ with individuality and his reason for stealing faces when showing emotion is lost.

- with all due love, what was Suki‘s mother for?

- Wan Shi Tong randomly sitting at some wayside

- Why wouldn’t normal people understand Wan Shi Tong? How are they planning for Team Avatar to find out about the solar eclipse if not through Wan Shi Tong‘s library later?

- Iroh suspecting Ozai behind the apparent assassination of Zuko so openly in front of Zhao

- Iroh justifying his war crimes with „I was a soldier“??

- Iroh „sacrificing“ himself in Omashu when the earth kingdom forces were looking for the firebender even though they both would’ve gone undetected otherwise

- Iroh killing Zhao

- does Momo carry the spirits‘ life now?

- the fire nation inventing a solar system model to predict Zosin‘s Comet and potentially the eclipse as well

[vegaseatsass]

I have to confess I really thought Tong was soooooo funny and cute throughout that entire episode.

- Divorced May to ??? protect her from the loan sharks, maybe? ideally? - But then when he's absolutely terrified for his miserable life and needs to go beg someone to help him not die, and the logical person would be the woman who actually loves him - or else idk family? Does Tong have parents? Does he, the movie star who has been established and famous for years, know any people who aren't 1. Ming's family or 2. Tong's stunt man? Even if they can't pay Tong's hundreds of millions of baht debt surely they could help him brainstorm solutions, disappear from the country, lmao something - but no he goes to kneel and beg before: his stunt man. - He claims it's because Joe can convince Ming to convince his canonically unconvinceable father to save Tong's life after exploiting his family and committing fraud with his businesses - (again, Tong does this instead of trying to convince May, a person who actually has any reason to want him to live, to convince her father) - but I think it's because he's used to going to his stand-in as a kind of everyman who can do anything Tong cannot - and because he thinks being able to do action moves on-set means being able to fight off a whole armed gang irl - Loan shark: This is real life. There's no stand-in to take the fall for you this time. Tong: Wow! Thank you for the promising, life-saving suggestion!!! - Never in a million years should any of this have worked out for him - NEVER should TONG'S STUNT MAN ever eeeeeever have been someone Tong could convince to go get kidnapped by mobsters in his stead!! - HOWEVER, Tong says the magic word, Joe's insanity trigger: orphan - (not an accurate word choice because even if Tong died May was always going to be alive and fine) - There's no way he knows this is Joe and that this is a leverageable issue for Joe, and even if this was Joe in his original body, there's no way Tong listened to his family backstory and remembered it and cared - No, this successful manipulation from our career manipulator was pure, pratfalling happenstance - And lo and behold: Tong the movie star's stunt man saves his fucking life.

All of that would be hilariously endearing enough on its own, but then after Tong convinces this man he (thinks he) barely knows to let a bunch of men with guns throw him in their van, he decides he simply can't live with himself if the guy he sent to die for him dies for him. So he - tries to blackmail his terrifying father-in-law - using blackmail material someone else exerted all the effort gathering (classic Tong) - material which hinges on using Tong's crimes and failures (classic Tong!) to strongarm his terrifying father-in-law into obeisance - which is now stale and outdated; father-in-law sealed up that particular hole in his armor days ago which either of his sons could have told you he would have done, you strike with the element of surprise or not at all - and thus, his reckless blackmail attempt is functionally useless and utterly, utterly pointless.

IT'S ADORABLE. Do you hear me. Adorable. He tried to character grow!! After unbelievably, successfully incurring a life debt from his stunt man!! He tried to pay that one (1) single debt back!! And it flopped!!! Awwwww

[thesimulationswarm]

Double Shot, Part 2

Joel Miller x f!reader x Tommy Miller

Pairing: pre-outbreak!Joel Miller x f!AFAB!reader x Tommy Miller Rating: explicit, 18+ MDNI Summary: A gorgeous man walks into your coffee shop and introduces himself as Tommy Miller. Then his equally gorgeous brother shows up. You can't decide which you like better... but maybe you don't have to. A/N: This will be in four parts, building up to the smut. Hopefully released daily. It's dumb filthy shit I couldn't get out of my head, okay? Then I'll be back to my ongoing serious series. Word count: 1.5k warnings/tags: Tommy has a hangover, gratuitous pastry, threesome, shameless flirting, sibling rivalry, pwp

This is Part 2 of Double Shot; here are Part 1, Part 3, and Part 4.

Tommy was moving a little slow that morning, nursing a hangover. He’d had a few too many last night down on Sixth Street, and now the sharp August sunshine felt like it wanted to melt a hole right into his skull. When he shifted into park, the jolt of the truck rolling back on its chassis sent a wave of nausea through him.

Leave it to Joel to use it to his advantage, swinging out the door of the cab and hustling into Prickly Pear Coffee & Sweets while Tommy was still unbuckling his seatbelt.

He had his brother’s number.

He knew why Joel had put on a shirt with no stains or holes for once, one that stretched nicely across the muscles of his chest. It was the same reason he himself had carefully knocked the mud off his work boots and lavished extra attention on his curls this morning.

It was that pretty little thing who owned the place.

Who’d been eating out of the palm of his hand yesterday when Joel came in and ruined it. Or tried to, at least— the girl had still seemed interested after his brother showed up. She’d still looked him over with that sassy, hungry gaze.

Only problem was, she’d looked at Joel the exact same way.

And Joel had noticed, of course.

Tommy jogged to the door of the cafe, running one last hand through his hair before he ducked inside. Joel was standing by the counter, studying the pastry case intently.

“Which one would you recommend?” He asked, resting his tanned forearm oh-so-casually on the glass top. Motherfucker. 

You’d been following Joel’s gaze, studying the baked goods, but when you heard the door open your eyes snapped up and met Tommy’s. Like you’d been waiting for him.

Tommy smiled his biggest smile. It wasn’t a put on— he felt a genuine flood of happiness seeing you look up to greet him. His eyes roamed over you. The golden sun pouring through the windows was catching on your hair and making your eyes sparkle. In place of yesterday’s oversized t-shirt, you were wearing a low-cut white tank. And fucking hell, you wore it well. Hangover forgotten, he strolled over to join his brother.

“Well I know what I’m having. Couldn’t stop thinkin’ about that cinnamon roll last night. Was like I could taste it in my dreams.” You looked at him and laughed, a magical soft sound.

“One sticky pecan cinnamon roll for Tommy, coming up,” you announced, and Tommy noted with approval that you remembered his name. You moved with a practiced ease behind the counter, lifting the cinnamon bun with a pair of tongs and nestling it in a plastic clamshell. You passed it to him with a sly half-smile.

Then you looked down at the pastries again, as if deep in thought.

“I think for Joel, however, we need something a bit… darker.” Tommy watched as your eyes flicked up to Joel’s.

“I think you may just be right, darlin’,” Joel practically purred back, meeting your gaze. Fuck him.

“How about a slice of my Mexican chocolate tart?”

“Perfect.”

Tommy watched you serve Joel his pastry. When you handed it over, he saw how your small hand brushed against his larger one, almost lingering there. He felt a hot flood of jealousy rising up through his chest— but then he noticed something. Even as your hand was touching Joel’s, your eyes were on him.

They sat outside on the picnic table, eating their treats and sipping their coffee.

“God damn,” Joel breathed as he set his plastic fork down in the now-empty box. “That woman can bake.”

“I know, right?” Tommy concurred. “I think I’m in love.”

Joel shook his head. “That’s gonna be a bit of a problem, because I’m pretty sure she wants to take me for a roll in the hay.”

“You just keep tellin’ yourself that, if it makes you feel better.”

Tommy rubbed his finger along the rim of his iced coffee, feeling the cold condensation that had gathered there. He loved nothing more than giving his brother shit, but he did wonder. He wanted to believe it was him that you were into. But for every moment you seemed to be flirting with Tommy, there was another when your eyes were definitely on Joel. What the hell was that thing about him needing something a bit darker anyway?

He knew Joel was handsome, that some girls dug that rugged, older man vibe. They got wet for a guy with a mortgage and sad eyes. And he’d spent his childhood watching chicks go wild for his big brother, so it’s not like this would be the first time a girl was more interested in Joel than in him. 

But it didn’t seem that simple, either. There was something playful and mischievous about you, something more his speed. And there was undoubtedly a spark there when you locked eyes. 

“Y’know what, Joel?”

“What?”

“I think we should have a little wager. See which one of us can land a date with the coffee shop babe first.”

Joel laughed and shook his head. “Jesus, Tommy. What are you, twelve?”

A slow grin spread across Tommy’s face. “Sounds like someoneis afraid he’s going to lose.”

“You really wanna play this game, Tommy? ‘Cause you know I’ll take you down.”

“Oh I do,” Tommy said, his smile widening. This was going to be fun.

Tommy couldn’t believe his luck. Joel was distracted packing up the truck for the day, making sure all his beloved tools were accounted for. And then you came right out the door of your shop, keys in hand and bag slung over your shoulder. He walked briskly across the food truck lot as you flipped the ‘Come In, We’re OPEN’ sign to ‘Sorry, We’re CLOSED.’

“Headin’ out for the day, sugar?”

You turned slowly, and he watched the delicious roll of your body. That tank top, man alive. And now that you weren’t standing behind the counter, he could properly appreciate the tight cut-offs you’d paired it with. That denim hugging your curves like a second skin.

“Hey Tommy. Yeah, it’s closing time for me. I’ll be back bright and early tomorrow, though.” 

You stood there, hand on one hip, looking him over in that saucy way you had. Expectant. He felt his palms begin to sweat— it was now or never.

“Hey, so, I was wonderin’…” He trailed off, ducking his head and rubbing at the back of his neck with one hand. Get it together, Miller, he silently admonished himself.

“Yeah?”

“Well, I thought you might be interested in goin’ out dancin’ this Saturday.” 

Your eyes were twinkling. You opened your mouth to respond, but before you had a chance—

“That’s right, me and by brother were plannin’ on hittin’ up The Broken Spoke. ‘S kind of a Miller brother tradition.” Joel slapped a hand heartily against Tommy’s back. Son of a bitch must’ve snuck up while he was distracted. “We thought you might be interested in joining.”

Your face broke into a wide smile. “That so?”

“Looks like we’ll be neighbors for a while here, while we work on this house. Be good to get to know each other,” Joel drawled. Tommy imagined how satisfying it would feel to kick his knees in with his steel-toed boots.

“I’d be happy to join you boys,” you pronounced, turning your key in the door lock with a practiced flick of your wrist. “Pick me up around 8?”