#Binary sequences

[kentuckylong]

Binary sequences

BINARY SEQUENCES HOW TO

Now, when you look inside a computer, you will see a bunch of circuits and electric wires. This information or data is the fundamental ingredient for any computer to work.

BINARY SEQUENCES HOW TO

Read also: How to Start Learning Coding? 6 Tips for Beginnersīefore we dive into how binary code and binary numbers actually work and how you can decode a simple binary sequence, let’s consider one fundamental point about data storage first.Īs I mentioned above, computers take inputs to store and process information. The bottom line here is that this simple concept of a switch being ON or OFF can translate into something really complex.Įven the most sophisticated, modern computers all work according to this very basic, rudimentary machine language with the 1’s and 0’s representing two states: either ON or OFF.īut to make this happen, your computer obviously deals with a lot more than just a single switch being turned on or off. But generally they represent numbers, letters, and other symbols. So with a computer, these 1’s and 0’s can be pretty much anything in modern computers. That is an output from your car, telling that you should get off the freeway and find a gas station asap. The same thing happens nowadays when you are driving your car and the gas light comes on. A user would see a certain light switched on to indicate a certain kind of output or message from the computer. Those 1’s and 0’s, or the switches I mentioned above, are how your computer stores and processes data.īack in the day when the very first computers were built, they had actual lights bulbs to provide outputs to their users. Read also: Computer Science 101: What is a Computer? So what does this have to do with binary code? Your computer magically knows how to translate a certain key into the right letter.įinally, the computer produced an output: you see the right letter on the screen. These are the four basic tasks a machine needs to perform to be a computer in the first place.įor example, when you’re typing on your computer, your fingers hitting the keyboard are giving the computer inputs. To understand this better, let’s look at how computers work: How does a switch that is either on or off translate into what computers do? Thus, 1 means “on”, 0 means “off”.īut wait a minute: What kind of a switch are we talking about here? To simplify things, you can think of binary as being a way of telling a computer whether a switch should be on or off. How can a highly complex computer program consist of only 1’s and 0’s? What is binary code then? How does binary code work exactly? What matters is that you are aware of how such a simple language can translate into the most complex computer programs and information structures that you see and use on a daily basis. Thus, understanding at least the basics of what binary is and how it works is not only interesting and quite fascinating, but also quite useful.īut don’t worry if the concept of binary code seems abstract and difficult to grasp at first. Those 1’s and 0’s define how computers take inputs, store and process information, as well as produce outputs for their users – that’s you and me. It is what makes every computer you use work the way it does.Īll in all, binary code enables us to communicate with computers and give them instructions.Īnd even though the programming languages you use for writing code are hopefully far from binary code, they are still translated into binary for computers to be able to interpret them and run your programs. Nevertheless, binary code is probably the most fundamental concept underlying programming and Computer Science. Instead, developers like you and me use more user-friendly programming languages to give instructions to computers. You will (most probably) never write a computer programs in binary code. Why should you understand how binary code works?īut if binary code is something only computers understand, why should you learn more about it?

[windcarvedlyre]

DR2 au where a series of misfortunes leads to Komaeda unintentionally being a murderer midway through the game, except when he's dragged off to be executed... nothing works. Projectiles miss, mechanisms jam, things meant to crush him pile up over him or stop each other with sheer friction.

Monokuma exhausts everything, increasingly pissed off. Eventually he throws Komaeda back into the trial room, flat on his face in front of everyone else still alive, and declares a new rule that murders require murderous intent.

[pitske]

I think you need a Software Upgrade!

[copper-skulls]

they're so good. you're not good enough.

[itsgerges]

Best Regards The Gravitational Waves Reflection In The Solar System (Analytical Study) (Revised) https://app.box.com/s/yx3tx5lsvwy4025p4j3mwfeliwhtka07 or https://app.box.com/s/9wywdejkxqh7x4g791ntf3p3p01kkm8f or https://www.tumblr.com/itsgerges/759715471336570880/the-gravitational-waves-reflection-in-the-solar?source=share or https://gerges2022.livejournal.com/236389.html

Abstract Paper question How Is Planet Velocity Defined? Paper Hypothesis No. (1) The solar system is one energy moves in space and reflects 3 times - the points of the reflection are the planets- as a result- the planets are created depending one each other by this energy reflection. The Explanation Of The Hypothesis No. (1) I- Preface Why do we need to define Planet velocity here? Because Planet velocity definition disproves The Solar System Classical Description. II- The hypothesis Explanation in details 1 The Energy Reflection Definition 2 The Energy Reflection Proves 3 The Energy Reflection Result 4 The Energy Reflection Objective 5 Saturn Creation Depends On Uranus And The Earth Let's explain the previous items in following I- Preface

Why do we need to define Planet velocity before any other discussion in this paper? Because Planet velocity disproves The Solar System Classical Description. The classical description refutation is a great event because the theories depend on it and – that means- more than 12 theories are wrong in the modern physics book Shortly- more than the half of the modern physics book provides imaginary ideas and wrong theories because the solar system classical description is wrong. Let's see examples to explain that clearly Example No. (1) No Planet Moves By The Sun Gravity- Newton is wrong- I have proved this fact since long time- and I explained that- Planet moves by the force caused its creation- means- the planet creation and motion is done by one force only otherwise this planet would be broken- simply – if two forces have effects on the same planet it would be broken- means- the planet moves with its creation force- again No planet moves by the sun gravity- The example shows a gap between the physics book and the solar system facts – Newton imaginary idea is believed by everyone since 400 years! But- the example doesn't show how great the gap is- in fact the shock is coming from The Sun Nuclear Fusion Theory- let's see the next example Example No. (2) The Sun Is Created By The Planets Motions Energies–The Sun Is A Phenomenon Here we can see the gap clearly The solar planets were found in their orbits before the sun creation and the planets were revolving around a point in space (this point has no light) The planet motion produces energy (1/2 mv^2) and this energy is stored in the space in waves form- the planets were revolving around this point for long periods till the stored motion energy in the space be massive energy-

From this massive motion energy the light beam is created (the sun rays is created) The sun rays is created from this energy- that tells why the sun corona temperature is 5 millions Kelvin but the sun surface is 5800 Kelvin- simply- because The Sun Is Not Doing Nuclear Fusion To Produce Its Rays, the rays is created by the planets motions energies– The Sun Rays Show The Great Gap Between The Physics Book And The Facts The wrong description is the reason behind the imaginary ideas and wrong theories in the physics book- one more example- the scientists won Nobel prize in physics for their discovery for the gravitational waves- these scientists told us – the gravitational waves are produced by the sun gravitational field which is NOT FACT– the gravitational waves are produced by Planet motion energy- where the planet moves and produces energy (1/2 mv^2) and the planet can't store its motion energy inside its body otherwise its temperature would be raised for that the planet motion energy is stored in the space In Waves Form- the scientists discovered these waves and they called them gravitational waves!! Let's provide one more example

Example No. (3) The big bang theory tells us the planet creation is done by random process- in details- the theory tells–some planets are suffered from collisions and these collisions changed their diameters and masses- by that we can't know their original diameters and masses by that the current values of these diameters and masses are found by chance and without any geometrical reasons and should be considered random data- For example- Jupiter diameter now is 142984 km but what's this diameter value in the first creation of Jupiter? The big bang theory and all random creation ideas are wrong and nonsense- shortly- I have my planet diameter equation which proves Planet diameter is created based on a geometrical rule- means- for example- Jupiter diameter is created at first as 142984 km and never changed since its creation- if any planet had collision and changed its diameter this collision results would be recorded in this planet motion features- as happened with Mars- Mars original orbit was between Mercury and Venus and Mars had migrated to its current orbit- and Mars had collided with Venus and The Earth in its migration motion- but Mars diameter equation refers frequently to its original orbit features and data- that tells the planet motion provides a record for its history because all data is required for planet motion- by that – all data depends on geometrical rules and no random process is used in it – let's introduce my planet diameter equation in following…. Planet Diameter Equation (v1/v2)= (s/r)= I v = Planet Velocity and r = Planet Diameter s= Planet Rotation Periods Number In Its Orbital Period I= Planet Orbital Inclination (example, 1.8 degrees be produced as a rate 1.8) v2, s, r and I are belonged to one planet and v1 is belonged to another planet The planet (v1) is defined by test the minimum error

Earth Equation uses Neptune velocity

Mars Equation uses Pluto velocity

Jupiter Equation uses the Earth moon velocity

Saturn Equation uses Mars velocity

Uranus Equation uses Neptune velocity (As Earth)

Neptune Equation uses Saturn velocity

Pluto Equation uses the Earth moon velocity (As Jupiter) (The Equation works from The Earth To Pluto) (the discussion explains the reason) Example Neptune Equation (89143 /49528) = 9.7/ 5.4 =1.8 89143 = Neptune rotation periods number in Neptune orbital period 49528 km = Neptune diameter 9.7 km/s = Saturn velocity 5.4 km/s = Neptune velocity 59800 days = Neptune orbital period (and Neptune rotation period =16.1 hours) 1.8 degrees = Neptune Orbital Inclination The equation tells planet diameter is created based on its velocity –means- Neptune diameter is 49528 km because Neptune velocity is 5.4 km/s The Equation Concept Planet diameter should be a function in its orbital distance –otherwise- this planet would be broken by its motion- the fact is that – The necessary requirement for planet safe motion is to create a function between this planet diameter and its orbital distance BUT- the designer can't create a function has only 2 variables (Planet diameter and its orbital distance)- the function in this case can't be useful because – If this planet changes its orbital distance its diameter would be broken also because the diameter is a direct function in the orbital distance without any other variables -As A Result The designer created the planet diameter as a function in this planet rotation period and the planet rotation period is created as a function in this planet velocity and the planet velocity is created as a function in this planet orbital distance- by that- the function between the planet diameter and its orbital distance is created but the function contains also more variables (rotation period, orbital period and velocity)- by that- if the planet changes its orbital distance- this planet diameter will not be changed but its rotation period, orbital period, and velocity will be changed and the diameter will be saved- NOTICE-Mars is the example for this theory because Mars original orbit was between Mercury and Venus and Mars had migrated from its original orbit to its current one- after Migration Mars changed its motion data but the diameter is saved

NOTICE- Planet diameter equation is very useful to analyze the energy reflection in the solar system because the equation shows the changes in data resulting from the energy reflection- for example- the equation produces the planet orbital inclination-but in Saturn equation- the equation produces the value (0.4) while we know Saturn orbital inclination is 2.5 degrees- the value (0.4) is produced because the energy is reflected in Saturn and that caused effect on the data by that the value (2.5) become (1/2.5) = 0.4- that's why I refer to my planet diameter equation in this discussion because the equation can work as a tool of anatomy which can see clearly what's happening for the energy in each planet- Matter Definition My planet diameter equation provides a new definition for the matter – this definition is found to answer the question- (How Can Planet Velocity And Motion Be Defined Before This Planet Creation?)

What's The Matter And How Is Created? The matter and space are created from the same one energy and both move with the motion of this energy from which they are created- but- the matter creates for itself a distinguish form and moves by different velocity from the space motion (notice the gravitational waves prove the space has motion and not static). This is similar to the sea of water- the space is similar to the sea of water and the matter is similar to a whirlpool (vortex) found on the sea page- The whirlpool (vortex) is created by the sea water and it's carried by the sea water motion- spite of that- the whirlpool is different in its form from the sea waves – also the whirlpool moves by different velocity from the sea waves motion velocity- this example gives explanation for the matter definition- the matter is similar perfectly to the whirlpool on the sea page- it's created by the sea water motion but it has a distinguish form and different velocity from the sea waves- Also The whirlpool dimensions depend on the sea water motion features- for example – we have a whirlpool its diameter is 2 meters, this diameter is formed by the sea water motion features (the water velocity- amount-pressure -……etc) that tells the whirlpool is found later after the sea creation- and the water motion is found before the whirlpool creation- this meaning is a fact for the matter creation and dimensions- the matter dimensions are created based on this matter motion- means- the motion is defined before the matter creation- this is proved strongly by my planet diameter equation- the equation tells (for example) Neptune diameter is 49528 km because Neptune velocity is 5.4 km/s- the whirlpool idea explains how the planet matter data is defined based on its motion- because The original energy was found in motion at first and the planet matter is created from this moving original energy and the planet matter dimensions are defined by this original energy motion features- after the planet creation, the planet moves with this original energy motion means the planet moves this same motion based on which the planet data is created that's why the planet data is in full harmony with the planet motion features. Also the idea shows the planet motion reason- as I proved before- no planet moves by the sun gravity- Newton is wrong- because the planet creation and motion are done by one force only otherwise this planet would be broken if two forces have effects on it Here we see the planet motion reason- the planet moves with the original energy from which this planet is created- What's the original energy? The original energy is one light beam energy- because – the solar planets and their distances are created from one energy and this energy is provided by one light beam –means – the planets are geometrical points found on the same one light beam and the planets move with this light beam motion- By that the planets are similar to carriages in one train and the light beam is this train engine- the light motion causes all planets motions NOTICE - this definition of the matter and planet is very important for our discussion because the paper hypothesis no. (1) tells – the solar system is one energy moves in the space and reflected on some points and these points are the planets- the reflection of energy discussion will show how each planet data and motion depend on the other planet motion by the energy reflection effect- shortly- (The Planet Is A Geometrical Point) this idea is the best one can explain the energy reflection data- by that we can understand how the energy motion and reflection can effect on the planet creation and motion- the energy reflection discussion is found in the paper first hypothesis explanation.

Planet Velocity Definition

Again let's ask ……Why Do We Need To Define The Planet Velocity? ………. Because – the planet velocity definition refutes the solar system classical description- the definition proves the planet is a geometrical point on the moving energy (and refute the classical definition tells – planet is a solid body created independently from the space and other planets) – in fact the planets are created depending on each other – The 9 planets are as 9 knots or snarls on the same one rope or cable – No planet is created independently– also all of them are created by the same one motion and the same one reason- (imagine you have a ladder or stairs is consisted of 9 units- all units are similar and found for the same reason)- the data proves this fact also Planet velocity definition provides a powerful proof against Newton theory of the sun gravity-No Planet Motion Depends On Its Mass- Newton is wrong- the velocity Definition Doesn't Refer To Planet Mass- Also planet velocity definition provides a direct strong proof for the energy reflection in the solar system- also – the velocity definition explains the complex machine behind the planet motion which refutes again the naïve idea of Newton about this motion- The planet velocity definition shows the general design of the solar system where all planets data is defined based on its velocity- means- the planet velocity is defined at first (after the orbit definition) and all other data is defined based on this velocity as we have seen the planet diameter is defined by the rate (v1/v2) by my planet diameter equation and planet orbital distance is defined by the rate (v1/v2)^2 and planet orbital period is defined by the rate (v1/v2)^3- shortly- the motion is the planet life

SHORTLY I refute the solar system classical description and I wanted to put a piece of strong proof in the first pages of my paper to show that the refutation doesn't depend on ideas or logical analysis- but the refutation depends on the contradiction between the physics theories and the planets creation & motion data- If the contradiction is proved that tells the description is wrong because the planets data can NOT be wrong Let's start our discussion How is planet velocity defined? Kelper stated, planet orbit defines its velocity, this rule is proved by the equation (v1/v2)^2=(d2/d1) where (d= planet orbital distance) and (v= planet velocity) BUT How Is The Planet Velocity Defined? And By What Rules? Planet velocity is defined by Three Rules let's see them in following (i) First Rule v1v2 = constant= 322 (my 5th equation)

47.4 km/s (Mercury velocity) x 6.8 km/s (Mercury velocity) =322 35 km/s (Venus velocity) x 4.7 km/s (Pluto velocity) x 2 =322 29.8 km/s (The Earth velocity) x 5.4 km/s (Neptune velocity) x 2 =322 24.1 km/s (Mars velocity) x 13.1 km/s (Jupiter velocity) =322 (Max error 2%) The rule (v1v2=322) tells the velocities are defined in pairs and not individually, each planet velocity has its own complementary- the rule tells the velocities are reflected on one another- the reflection of energy and data will be studied in details in planet velocity discussion- In this rule we interest for the constant (322)- let's ask- why the constant = 322?

The constant 322 depends on the speed 1.16 million km per second because (1160000 seconds = 322 hours) - Means Mercury (47.4 km/s) moves in 6.8 hours a distance = 1.16 million km and Uranus (6.8 km/s) moves in 47.4 hours a distance = 1.16 million km Shortly -we realize that the constant 322 is produced based on the speed 1.16 million km per second- means- the planets velocities are complementary each other because they are defined as functions in this same speed 1.16 million km per second (This is similar to electron and positron are produced from Gamma ray, The two particles depend on Gamma energy in their masses) Based On This Data I concluded there's a light beam its speed 1.16 million km per second and from this light beam energy the solar system is created- and the planets velocities are defined as functions in this speed 1.16 million km per second and that causes the velocities to be complementary each other- (Please note the speed 1.16 million km per second is proved strongly by other data in my paper specially because the light created the space at first before any planet creation by that all distances in the solar system are created by the energy of this light beam and its speed 1.16 million km per second is registered in the data)

(ii) Second Rule v1v2 = 1 The velocity here uses the solar day (86400 seconds) – let's prove that-

Mercury moves per solar day = 4.095 million km Venus moves per solar day = 3.024 million km The Earth moves per solar day = 2.574 million km The Moon moves per solar day = 2.4 million km Mars moves per solar day = 2.082 million km Jupiter moves per solar day = 1.1318 million km Saturn moves per solar day = 0.838 million km Uranus moves per solar day = 0.5875 million km Neptune moves per solar day = 0.4665 million km Pluto moves per solar day = 0.406 million km AND 0.406 (Pluto velocity) x 2.4 (the moon velocity) = 1 (error 2.5%) 0.4665 (Neptune velocity) x 2.082 (Mars velocity) = 1 (error 2.5%) 0.5875 (Uranus velocity) x 3.024 (Venus velocity)/1.772 = 1 (error 2.5%) 0.838 (Saturn velocity) x 1.1318 (Jupiter velocity) = 1 (error 5%) (1.772 = π^1/2) The second rule tells very similar meaning (v1v2= constant= 1) The data uses the velocities per solar day for that the constant is changed from 322 into 1 but the rule is the same- (v1v2= Constant) I want to say- the rule (v1v2 = Constant) tells a clear idea that (The Velocities Are Reflected On Each Other) this conclusion is simple one (A x 1/A= constant=1) The rule proves the energy is reflected in the solar system and this reflection has effect on the planets data and for that the planets velocities are defined by this energy reflection and the velocities are produced complementary each other as a result. Notice The second rule causes confusion because the complementary player is changed- for example Pluto is complementary with Venus (in the first rule 35 x 4.7 x 2 = 322) but Pluto is complementary with the Earth moon in the second rule (0.406 x 2.4 = 1) that tells the players are changed which is illogical idea- how can we solve this problem? The third rule solves it – let's see this rule in following (iii) Third Rule v1/v2 = 0.8 (based on the planets order) 47.4 km/s (Mercury velocity) x 0.8 = 38 (35 km/s = Venus velocity error 7.25%) 35 km/s (Venus velocity) x 0.8 = 27.78 (The moon velocity) 29.8 km/s (The Earth velocity) x 0.8 = 24.1 (Mars velocity) (error 1%) 24.1 km/s (Mars velocity) x 0.8 = 2 x 9.7 (Saturn velocity) 13.1 km/s (Jupiter velocity) x 0.8 = 2 x 5.4 (Neptune velocity) (error 3%) 6.8 km/s (Uranus velocity) x 0.8 = 5.4 (Neptune velocity) 5.4 km/s (Neptune velocity) x 0.8 = 4.3 (Pluto velocity 4.7 the error 7.25%) Please note The error 7.25 is found by the rate 1.0725 – that means 47.4 km/s (Mercury velocity) x 0.8 = 38 = 1.0725 x 35 km/s (Venus velocity) 5.4 km/s (Neptune velocity) x 0.8 = 4.3= 4.7 km/s (Pluto velocity) / 1.0725 29.8 km/s (Earth velocity) = 27.78 km/s (The moon velocity) x 1.0725 We know the rate 1.0725 is found by Lorentz length contraction effect- and we know this rate has effect on around 40% of all planets data – that's why we see this rate has effect on the planets velocities definition-

Let's remember the question- In the rule (v1v2=322) we found that Pluto is complementary with Venus because 4.7 km/s (Pluto velocity) x 35 km/s (Venus velocity) x 2 = 322 But in the rule (v1v2 =1) we found Pluto is complementary with the moon because 0.406 mkm (Pluto Velocity Daily) x 2.4 mkm (The Moon Velocity Daily) = 1 The question asked – if the planets velocities are defined in pairs complementary each other and not individually how can the players be changed? The answer tells – the planets velocities are rated by (0.8) based on the planets order means – the moon velocity daily 2.4 mkm = Venus velocity daily 3.024 mkm x 0.8 The rate (0.8) defines all planets velocities depend on each other by order-

Now let's see Planet velocity final definition – because- the definition uses three planets velocities together and not only two – let's put that clearly in following- (iv) The Planet Velocity Final Definition (A) 47.4 km/s (Mercury velocity) x 0.8 = 38 km/s (Venus velocity 35 km/s) Venus moves per solar day 3.024 million km -But 1/3.024 = 0.3307 million km = Uranus moves per solar day 0.5875 million km /1.77 (note 1.77 = π^1/2) and (38 = 35 x 1.0725) For that 47.4 km/s (Mercury velocity) x 6.8 km/s (Uranus velocity) = 322 (B) 35 km/s (Venus velocity) x 0.8 = 27.78 km/s (The Moon velocity) The moon moves per solar day 2.4 million km -But 1/2.4 = 0.406 million km = Pluto moves per solar day 0.406 million km For that 35 km/s (Venus velocity) x 4.7 km/s (Pluto velocity) x 2 = 322 (C) 29.8 km/s (The Earth velocity) x 0.8 = 24.1 km/s (Mars velocity) Mars moves per solar day 2.082 million km -But 1/2.082 = 0.4665 million km = Neptune moves per solar day 0.4665 million km For that 29.8 km/s (The Earth velocity) x 5.4 km/s (Neptune velocity) x 2 = 322 (D) 13.1 km/s (Jupiter velocity) x 0.8= 2 x 5.24km/s (Neptune velocity 5.4 km/s error 3%) Neptune moves per solar day 0.4665 million km - But 1/0.4665 = 2.082 million km = Mars moves per solar day 2.082 million km For that 13.1 km/s (Jupiter velocity) x 24.1 km/s (Mars velocity) = 322 Shortly Three planets velocities are defined in each equation- that tells the planet velocity definition is a process more complex than the simple equation (v1v2= constant) Notice The 9 planets velocities total is 176 km/s – if we add the Earth moon velocity (29.8 km/s) the total will be 205.8 km/s The planets velocities are complementary also for this velocity 205.8 km/s – let's see 205.8 km/s = Mercury velocity (47.4 km/s) x Pluto velocity (4.7 km/s) / 1.0725 205.8 km/s = Venus velocity (35 km/s) x Neptune velocity (5.4 km/s) x 1.0725 205.8 km/s = Earth velocity (29.8 km/s) x Uranus velocity (6.8 km/s) 205.8 km/s = Jupiter velocity (13.1 km/s) x Neptune velocity (5.4 km/s) x 3 Mercury velocity = 2 Mars velocity by that Pluto will be used for Mars also Max error (3%) Please Note- Saturn is exceptional because 205.8 km/s = 9.7 km/s (Saturn velocity) x 21.4 Where 21.4 hours = 2 x 10.7 hours (Saturn rotation period) Means- the distance is passed by all planets motions in one hour equal the distance is passed by Saturn in 2 rotation periods (21.4 hours) that tells more analysis is required for Saturn velocity- as we should do later. (v) A Question (Why Is The Rate (0.8) Used To Define Each Planet Velocity Based On Its neighbor?) Kepler stated (Planet orbit defines its velocity) and My planet orbital distance equation proves each planet orbit is defined based on its neighbor – means- my equation uses only 2 neighbor planets orbital distances Here also-Planet velocity is defined based on its neighbor – means- this connection enabled Kepler to conclude his statement (Planet orbit defines its velocity)

But Why The Rate (0.8)?? The rate (0.8) is found by the energy reflection effect on Planets velocities definition, for that we need to analyze the energy reflection process deeply to see how the planet velocity is defined by it - The energy reflection process is discussed deeply in the first hypothesis explanation- let's start its discussion in following…

II- The Hypothesis Explanation In Details Let's remember the paper first hypothesis The solar system is one energy moves in space and reflects 3 times - the points of the reflection are the planets- as a result- the planets are created depending on each other by this energy reflection.

In following we discuss the energy reflection process in details because the planet velocity definition proves the planets data is reflected on each other and we here try to see as deep as possible how this reflection process is done – the discussion is divided into 5 items which are Item No. 1 The Energy Reflection Definition Item No. 2 The Energy Reflection Proves Item No. 3 The Energy Reflection Result Item No. 4 The Energy Reflection Objective Item No. 5 Saturn Creation Depends On Uranus And The Earth Let's start our discussion in following Item No. 1 The Energy Reflection Definition Here we define the reflection of energy – let's do that in following The solar system is one energy- this energy moves through the space- we can imagine this energy as a light beam or electromagnetic wave- and- the data tells this energy is reflected- let's suppose this energy is reflected from the point (A) to the point (B)- now- these points (A and B) are planets in the solar system- That tells, the planet is a point in space on which the energy is reflected- it's difficult to accept such strange idea- BUT The planets data is more strong than our evaluation- we will see that- the planets data is created by the reflection of energy- this fact is proved strongly and doubtless- For that I analyze the reflection of energy process in details because by this process the planets are created and the energy cycle is completed- for that – we examine the reflection of energy deeply - Now- let's define the energy reflection in following (i) The energy is reflected three times in the solar system- from Pluto to Neptune (1st reflection) and from Uranus to Jupiter (2nd reflection) and from Venus to Mars (3rd reflection) The first and second reflections are unified and work together as one reflection only (later will explain why) - by that – the solar system has 2 basic reflections- the reflection in the outer planets and the reflection from Venus and Mars (ii) The reflection of energy is proved strongly because the planets data are changed as a result- let's write these changes in following v What's used as (A) before the reflection will be used as (1/A) after the reflection. v What's used as (a distance) before the reflection will be used as (a period of time) after the reflection v The velocities be squared –the rate (v1/v2) before reflection will be (v1/v2)^2 after the reflection. v The energy direction is changed by the reflection usually v The players of the rates of time are reflected also – These changes are found in all reflections of energy- that's why the proof is powerful and can't be refuted because the planets data shows the reflection process details (iii) Let's see the changes in the planets data generally

(Venus reflection) By this reflection of energy Venus orbital circumference 680 million km will be used as Mars orbital period 687 days and it defines Jupiter orbital period (4331 days = 2π x 687 days) and also Saturn orbital period (10747 days = 4π x 687 days x (1/0.8)) where Uranus orbital inclination (0.8 degrees) creates effect on Saturn data AND Venus Orbital Period 224.7 days be used as 227.9 million km (Mars orbital distance) AND Also the reflection defines the planets diameters by that Venus circumference 38025 km = Mars Circumference 21346.6 km x 1.772 (π=3.14159= 1.772^2) (more data about this reflection is discussed later) (The Outer Planets Reflection) The reflection is done by Jupiter to Uranus, by that, Jupiter orbital circumference 4900 million km will be used as Uranus orbital period 30589 days where (30589 days = 4900 days x 2π and Neptune orbital period 59800 days = 4900 days x 4π and Pluto orbital period 90560 days = 4900 days x 6π Notice- the reflection in the outer planets depends basically on Saturn and it's more complex than this simple data but I put similar data for comparison and later we will discuss the details ALSO The energy reflection at Venus passes above the Earth to Mars- where the Earth moon suffers from the length contraction effect and its motion distance daily is 2.4 mkm = 2.574 mkm (The Earth motion distance daily) / 1.0725 Similar to that The energy reflection at Jupiter passes above Saturn to Uranus – Where Saturn suffers from the length contraction effect because 1433 million km (Saturn orbital distance) x 1.0725 = 2 x 778.6 million km (Jupiter orbital distance) - And- the Earth moon daily displacement is 88000 km and during 10747 days the total be 940 million km=The Earth orbital circumference (where 10747 days = Saturn orbital period) The previous data shows the reflection energy effect generally- it's important because it compares the data in two different groups and proves the data behaviors are similar- that proves these behaviors are caused by the same one cause- But we will analyze each reflection in more details to see how each data is created Item No. 2 The Energy Reflection Proves (a) Venus reflection of energy is discussed in item no. (4), But - Here We Analyze The Energy Reflections In The Outer Planets- There are two reflections in the outer planets (from Neptune to Saturn) and (from Uranus to Jupiter)- let's explain the energy trajectory The energy is sent firstly from Pluto to Neptune and then The energy is reflected from Neptune to Saturn–means- it's one reflection is started by Pluto and finished by Saturn- later the energy is reflected one more time from Uranus to Jupiter- but we have to ask- if the energy was in Saturn orbit why this energy is returned again to Uranus? The reason is–Saturn is created as a result for an interaction between Uranus and the Earth- means- Uranus is Saturn Father- and the energy is got by Saturn sent automatically to Uranus and Uranus reflects this energy to Jupiter- we will discuss the process in details later. AND I put Saturn and Uranus relationship analysis in point No. (5) to prove that Saturn is Created by Uranus effect- (b) Also there's story I have to summarize before the data discussion- Pluto energy is reflected to Neptune – this is the first reflection- means- Neptune should send this same energy to Uranus and then to Saturn and the other planets-BUT – Neptune didn't send the energy to Uranus but kept the energy in Neptune orbit – Uranus could not release the energy from Neptune orbit- for that- Uranus created the interaction with the Earth to create Saturn (CONT) Gerges Francis Tawdrous +201022532292 Physics Department- Physics & Mathematics Faculty Peoples' Friendship university of Russia – Moscow (2010-2013)

Curriculum Vitae https://www.academia.edu/s/b88b0ecb7c E-mail mrwaheid@gmail.com, mrwaheid1@yahoo.com gergesgerges@yandex.ru ORCID https://orcid.org/0000-0002-1041-7147 Facebook https://www.facebook.com/gergis.tawadrous VK https://vk.com/id696655587 Tumblr https://www.tumblr.com/blog/itsgerges Livejournal https://gerges2022.livejournal.com/profile Pocket https://getpocket.com/@646g8dZ0p3aX5Ad1bsTr4d9THjA5p6a5b2fX99zd54g221E4bs76eBdtf6aJw5d0?src=navbar

box https://app.box.com/s/47fwd0gshir636xt0i3wpso8lvvl8vnv Academia https://rudn.academia.edu/GergesTawadrous List of publications http://vixra.org/author/gerges_francis_tawdrous

[hyliandude]

01010011 01101111 01101101 01100101 01100010 01101111 01100100 01111001 00100000 01101111 01101110 01100011 01100101 00100000 01110100 01101111 01101100 01100100 00100000 01101101 01100101 00100000 01110100 01101000 01100101 00100000 01110111 01101111 01110010 01101100 01100100 00100000 01101001 01110011 00100000 01100111 01101111 01101110 01101110 01100001 00100000 01110010 01101111 01101100 01101100 00100000 01101101 01100101 00001010 00001010 01001001 00100000 01100001 01101001 01101110 00100111 01110100 00100000 01110100 01101000 01100101 00100000 01110011 01101000 01100001 01110010 01110000 01100101 01110011 01110100 00100000 01110100 01101111 01101111 01101100 00100000 01101001 01101110 00100000 01110100 01101000 01100101 00100000 01110011 01101000 01100101 01100100 00001010 00001010 01010011 01101000 01100101 00100000 01110111 01100001 01110011 00100000 01101100 01101111 01101111 01101011 01101001 01101110 00100111 00100000 01101011 01101001 01101110 01100100 00100000 01101111 01100110 00100000 01100100 01110101 01101101 01100010 00100000 01110111 01101001 01110100 01101000 00100000 01101000 01100101 01110010 00100000 01100110 01101001 01101110 01100111 01100101 01110010 00100000 01100001 01101110 01100100 00100000 01101000 01100101 01110010 00100000 01110100 01101000 01110101 01101101 01100010 00001010 00001010 01001001 01101110 00100000 01110100 01101000 01100101 00100000 01110011 01101000 01100001 01110000 01100101 00100000 01101111 01100110 00100000 01100001 01101110 00100000 00100010 01001100 00100010 00100000 01101111 01101110 00100000 01101000 01100101 01110010 00100000 01100110 01101111 01110010 01100101 01101000 01100101 01100001 01100100 00001010 00001010 01010100 01101000 01100101 00100000 01111001 01100101 01100001 01110010 01110011 00100000 01110011 01110100 01100001 01110010 01110100 00100000 01100011 01101111 01101101 01101001 01101110 00100111 00100000 01100001 01101110 01100100 00100000 01110100 01101000 01100101 01111001 00100000 01100100 01101111 01101110 00100111 01110100 00100000 01110011 01110100 01101111 01110000 00100000 01100011 01101111 01101101 01101001 01101110 00100111 00001010 00001010 01000110 01100101 01100100 00100000 01110100 01101111 00100000 01110100 01101000 01100101 00100000 01110010 01110101 01101100 01100101 01110011 00100000 01100001 01101110 01100100 00100000 01101000 01101001 01110100 00100000 01110100 01101000 01100101 00100000 01100111 01110010 01101111 01110101 01101110 01100100 00100000 01110010 01110101 01101110 01101110 01101001 01101110 00100111 00001010 00001010 01000100 01101001 01100100 01101110 00100111 01110100 00100000 01101101 01100001 01101011 01100101 00100000 01110011 01100101 01101110 01110011 01100101 00100000 01101110 01101111 01110100 00100000 01110100 01101111 00100000 01101100 01101001 01110110 01100101 00100000 01100110 01101111 01110010 00100000 01100110 01110101 01101110 00001010 00001010 01011001 01101111 01110101 01110010 00100000 01100010 01110010 01100001 01101001 01101110 00100000 01100111 01100101 01110100 01110011 00100000 01110011 01101101 01100001 01110010 01110100 00100000 01100010 01110101 01110100 00100000 01111001 01101111 01110101 01110010 00100000 01101000 01100101 01100001 01100100 00100000 01100111 01100101 01110100 01110011 00100000 01100100 01110101 01101101 01100010 00001010 00001010 01010011 01101111 00100000 01101101 01110101 01100011 01101000 00100000 01110100 01101111 00100000 01100100 01101111 00100000 01110011 01101111 00100000 01101101 01110101 01100011 01101000 00100000 01110100 01101111 00100000 01110011 01100101 01100101 00001010 00001010 01010011 01101111 00100000 01110111 01101000 01100001 01110100 00100111 01110011 00100000 01110111 01110010 01101111 01101110 01100111 00100000 01110111 01101001 01110100 01101000 00100000 01110100 01100001 01101011 01101001 01101110 00100111 00100000 01110100 01101000 01100101 00100000 01100010 01100001 01100011 01101011 01110011 01110100 01110010 01100101 01100101 01110100 01110011 00001010 00001010 01011001 01101111 01110101 00100111 01101100 01101100 00100000 01101110 01100101 0

[femme-objet]

technically when i was doing research i was part of the AI lab and im kinda glad that i learned abt machine learning from that front as opposed to from current hysteria

[bemusedlybespectacled]

proposing what I'm going to call Gaylor's Razor, which is: never explain normal shit as being part of a secret message that can only be decoded by over-analysis.

"These Taylor Swift lyrics are actually coded messages saying that she's a lesbian and is forced to stay in the closet! Any lyrics that are clearly about being attracted to a man are just to throw us off the scent!" Sometimes people, like Taylor Swift, are straight and write about being straight, because they are straight.

"The fourth series of Sherlock was deliberately bad because it was actually a coded message to us fans that there is a secret fourth episode that will make Johnlock canon and will actually be good!" Sometimes writers (even experienced writers who are normally good at their jobs) will write something that's not good, because no one is perfect. They're not going to waste everyone's time and money and energy creating something terrible on purpose as part of a grand master plan.

"Tessa Virtue and Scott Moir, the Canadian Olympic ice dancers, are secretly married (with kids)! Their public relationships with people who are not each other and them repeatedly saying 'we dated as kids and now we're just friends' are just to hide the truth! Which they need to hide for some reason! Their relationship is obvious just from their physical chemistry when competing! JUST LOOK AT THIS TWO SECOND CLIP OF HIM BLINKING AT HER!" It seems counterproductive to put all that thought into hiding a relationship that doesn't need to be hidden but then also telegraph that same relationship in front of millions of people through planned choreography.

"But BB, what about times that people really are speaking in code or hiding something due to outside influences?"

If it requires huge leaps in logic, like adding all the letters in a sentence together and dividing by seventeen and that number matches the binary sequence for the color yellow so YELLOW MUST BE SIGNIFICANT, it's not a secret code.

If it requires focusing on teeny tiny details but discards huge ones, like analyzing someone's micro-expressions but handwaving away what the person is actually saying out loud with their mouth, or focusing on one specific line instead of the entire scene or song or whatever, it's not a secret code.

If both supporting and contradictory evidence are used to come to the same conclusion (ex: when Taylor says something that I interpret as gay, that means she's gay, and when she says something that I interpret as straight, that still means she's gay and just hiding it), it's not a secret code.

Trying to apply fandom meta analysis techniques to real life is a really good way of fall into conspiratorial thinking that can be easily exploited. You can totally try to predict what's going to happen in a story or choose to interpret a scene in a specific way; you can't do that in real life with real people. That way lies the kind of nonsense that leads to shit like "this image of pizza on a children's toy is actually subliminal messaging by The Cabal™ that proves that Pizzagate is real."

[befemininenow]

It may be a week late, but I hope your Valentines was amazing this year. Here's a little throwback from Escafa (aka Spawnfan) of DeviantArt fame. (If only transitioning was that easy.)

Created back in Valentine’s 2013 as an MTF transformation sequence, it's about a person (in this case, a man) who has a crush on a tomboyish girl. Unfortunately for him, she's a lesbian and does not like men. What the girl on the right doesn't know is that the person presenting as a boy has the ability to turn into a girl. Their female equivalent is a blonde bombshell and the shocked tomboy falls for her. The last panel shows some form of affection for the new lesbian couple.

At the time I saw this post, it was definitely a hot favorite of mines since I was really into MTF genderbending. 11 years later, however, my opinion on this piece is conflicted. Don't get me wrong: the girls are cute, especially the pretty blondie, who is definitely trans girl goals. However, there’s three problems with this piece:

Is the transformed girl transgender? Do they identify as a girl? What if they’re genderfluid, bigender, or even non-binary?

What are the chances this relationship may get impacted if the person in the left switches between genders based on their mood?

As cute as it seems that the left person will do anything to make the tomboy girl so happy, this piece is also part of the MTF transformation genre, which can be off-putting for some due to it’s fetishized and/or kinky nature.

I still think this is one of the better MTF TG transformations since the left person transformed themselves by choice and not by force (the latter is very common on those transformations). Yet, I can’t help but envy the transformed girl for her pretty looks and cute outfit. If only transitioning was that easy.

These were the kind of pieces that I was into before figuring out I was trans myself. This particular line art became one of Escafa’s most popular pieces and one of the most popular MTF TG transformation pieces. In fact, the one you see here is a vector repaint from another DeviantArt artist named P@ntied-Princess (their account is deactivated).

The ones you see online are reposts in ranging quality from good to really pixelated. This one, however, is not only the highest quality post I found, but it’s the one I saved from the original account. I had to use an image search engine and digital archives to find it. I’ve seen a few caption edits of this art throughout my searches, but they’re not in the best quality. Maybe with this repost, there could be some better editing to match with today’s time. Anyways, happy belated Valentine’s Day!

Original art tracing belongs to Escafa (aka Spawnfan). Vector painting done by P@ntied-Princess.

[junosartz]

base64 is a group of binary-to-text encoding schemes that transforms binary data into a sequence of printable characters, limited to a set of 64 unique characters.

[thewertsearch]

Oh, it's just Tinkerbull writing MEOW.

Unlike Rose's lavender cipher, Tavros isn't authoring this sequence in his signature color. Instead, his code is Doc Scratch white - a bad omen, if I ever saw one.

AA: an incomplete fragment consisting of four symbols AA: comprising the first word of a binary refrain

A binary refrain, implying the existence of a TOCK Player. Does each code constitute half of MEOW, or has Doc Scratch's genome been spliced with something else entirely?

AA: a pair of sounds emerging from the belly of a fabled tyrants menace

That would be the crocodile from Peter Pupa Pan.

Come to think of it, The story of Hook's crocodile draws some possibly-unintentional parallels to Homestuck's current arc. In the movie, it constantly circled Hook like a buzzard, the ominous ticking in its belly serving as a constant reminder that he was living on borrowed time.

AA: but you authored only one sound of the pair AA: i would write the other

Breath and Time, T1ck and T0ck.

What have you got cooking, Team Charge?

AA: completing the phrase of legend AA: the persisting sounds said to accompany the ultimate demise of the tyrant less an arm and an eye

These legendary injuries again. Just like in the original story, it seems that Pupa’s Hook also dies to the ticking of a clock.

In the context of the comic, this might actually be a prophecy about the death one of our Hook cosplayers – namely, Slick, Jack and Vriska. Perhaps the real reason these injuries are so common is to ensure we can't tell who this prophecy's actually about. Tyrant currently suits Jack best, but a lot can happen in four thousand pages.

AA: but even these eight characters AA: the scrawlings of charge AA: were still but half the code

Charge provides half the code, and Scourge undoubtedly provides the other. The nascent Doc Scratch is composed of four sequences, supplied by the progenitors of this group's bloodiest conflict.

It seems this code was implanted in three Prospit dreamers, and only one Derse dreamer. Sgurb's mechanics are almost universally balanced by moon, so I find this a little odd.

Immediately after the cueball incident, Vriska subconsciously authors break.

What does Terezi get, then? R3P41R?

‘BR8K H34DS.’

Team Scourge is the story of a rigged coin, and a broken 8-ball.

[felixcloud6288]

"Basic Biology" Transphobic rhetoric is so stupid and so frustrating to listen to for someone like me going into a genomics field.

To begin, the default human sex is female. So there's no point in even arguing about whether or not someone is a woman on any biological level. That's the default state.

Meanwhile, the binary nature of their mindset causes everything to essentially boils down to whether or not your genetic code contains a roughly 840-base pair length gene sequence called the SRY gene. This gene makes up roughly 0.00000028% of the human genome.

SRY is an ON switch. It activates various male-coding genes, WHICH ARE IN DIFFERENT CHROMOSOMES. Which means that everyone has the genetic material to become male, it's just a question of if the activation switch was properly installed.

But it's possible to have the gene and it fails to be expressed, causing you to become an XY female. It's possible as you get older for the Y-chromosome, and subsequently the SRY gene, to get deleted from your DNA. It's possible for the SRY gene to end up in an X chromosome and have an XX male. It's possible for the fetus to develop both male and female sex organs.

Meanwhile Transphobes are like "Ignore all that. Ignore how hormone regulation is done by different genes. Ignore that human bodies produce estrogen and testosterone naturally. Ignore that our bodies are actively receptive to estrogen and testosterone. Ignore that the SRY gene is a one-time gene that doesn't do anything after to the point you can remove it and it won't change anything. Ignore that the actual argument is completely cultural in nature and we're using FALSE arguments about biology to justify our bigotry and hatred."

Transphobes will look at this and say "Behold a man!":

AGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAATATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAACGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTCTCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTGGGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGGCCATGCACAGAGAGAAATACCCGAATTATAAGTATCGACCTCGTCGGAAGGCGAAGATGCTGCCGAAGAATTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTACAGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACGCAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTGTAGGACAATCGGGTAACATTGGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTTCAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA

And they'll ignore the remaining 0.99999972% of us that truly decides who we are.

[timetodiverge]

Me, pretending be a normal, non-obsessive Star Wars fan: yes I liked the Ahsoka end credit sequence the Normal Amount

Also me, to anyone that will listen: note the use of the taiko drums to bring us back to Ahsoka's samurai/Japanese aesthetic as opposed to the Mandalorian's cowboy/Western aesthetic; the presence of non-Jedi force-users such as loth-wolves and purrgils suggesting Ahsoka's continued journey engaging with the Force beyond the Jedi-Sith binary; the weaving in of historical Star Wars soundtrack motifs such as Where the Sun Sails and the Moon Walks and Burying the Dead; and the exquisite timing & placement of actors' names within the sequence e.g. Natasha Liu Bordizzo when Sabine's theme from Rebels begins to play, David Tennant in the visually busiest and connected section of the star map indicating Huyang's long life and extensive connections, and Eman Esfandi at the visually most lonely part of the star map as the journey line heads into isolation. Also note the intensification of the taiko drums during Sabine's theme, an intriguing juxtaposition of the "Jedi" (/samurai) identity and "Mandalorian" (/cowboy) identity, linking both identities with Sabine, and linking Sabine and Ahsoka in the audience's mind. In this essay I will-

[itsgerges]

Best regards

 Can The Sun Rays Creation Process Depend On Saturn Motion?

or

or

or

Abstract

Paper Question

Can The Sun Rays Creation Process Depend On Saturn Motion?

The question tells us (If Saturn Is Not Found In The Solar System The Sun Rays Can Not Be Created)- If This is a fact- That proves we understand wrongly (completely) how the sun rays is created!

The question refuses directly The Sun Nuclear Fusion Theory – and tells us – The Sun Rays Is Produced by another Method – and

This another method depends on Saturn motion perfectly and without Saturn motion this method can NOT work and No Sun Rays Can Be Produced

The question answer can be summarized in 3 points

(Point No. 1) The Refutation Of The Sun Nuclear Fusion Theory

(Point No. 2) The Planet Motion Reason And Design

(Point No. 3) Saturn Effect On The Solar System Motion

Let's discuss these points in following…

(Point No. 1) The Refutation Of The Sun Nuclear Fusion Theory

There Are 7 Facts Refute The Sun Nuclear Fusion Theory…

Planet Motion Produces Energy

The gravitational waves are produced by the planets motions energies and NOT by the sun gravitational field (Moreover the sun does Not create a gravitational field)

The Gravitational Waves Can Move By Speed Of Light (C= 300000 km/s)

The Sun Rays Is Created By The Gravitational Waves Motions

The Sun Rays Creation Process Depends on A Relative Motion

The Sun Corona Temperature Is (5 million Kelvin) and the sun surface is 5800 Kelvin because the energy is NOT produced by The Sun Nuclear Fusion.

The Sun Data Depends On The Planets Data 

Let's summarize these facts in following

(Fact No. 1) Planet Motion Produces Energy

Any moving body produces energy (1/2 mv^2), the planet motion produces energy also, but where's the planet motion energy?

The planet doesn't store the energy in its body because it would raise this planet temperature and no planet temperature is raised by its motion- logically where can the planet motion energy be stored? In the space in waves form-

Means- the planet motion energy creates waves in the space

The space is similar to the sea of water, and the planet is similar to a fish swims through the sea of water- as we know- the fish moves by hitting the water by its body and by this action waves are created in the water- also we conclude the water moves by a velocity equal the fish velocity because of the reaction force-

Similar to that, the planet motion energy creates waves in the space- these waves are similar to the water waves, they move far from their planet and can be reflected- also we conclude the space waves move by a velocity equal the planet velocity-

Also–because the planets revolve around the sun in one direction- the planets motions energies waves move toward Pluto perpendicular on the revolution direction.

In Pluto orbit these waves are unified into one unified wave moves by the planets velocities total (9 planets velocities total is 176 km/s)

Pluto reflected this unified wave toward Venus and this wave revolves around the sun through the Earth moon orbit- because- all planets motion energy is stored finally in the moon orbit-

 And because the wave revolves around the sun through the moon orbit- the moon velocity is added to the total (the moon velocity = the Earth velocity) – by that

The velocities total be (176 +29.8 = 205.8 km/s)

Shortly-

The Planets Motions Energies Are Unified Together And Produce One Unified Wave Revolves Around The Sun Through The Earth Moon Orbit And This Unified Wave Moves By A Velocity 205.8 km/s.

(Fact No. 2) The Gravitational Waves Are Produced By The Planets Motions Energies And Not By The Sun Gravitational Field (Moreover The Sun Does Not Create A Gravitational Field)

I claim the space waves which I have described are the gravitational waves, the scientists called them wrongly supposing that these waves are produced by the sun gravitational field but this is NOT True – on the contrary- these waves are produced by the planets motions energies.

The previous analysis proves clearly that, the planet motion must create waves in the space- by that- I have a reason to claim that (the gravitational waves are produced by the planets motions energies)- and also the sun doesn't create a gravitational field – let's prove that in following to cause a confidence in my conclusion

The Sun Doesn't Produce A Gravitation Field  

The Sun Rotation Period is (25.4 days at equator) and (34.4 days at pole), that proves the sun has NO massive gravity (even it has no gravity equal any planet gravity otherwise it would rotate in one period of time)

No planet moves by the sun gravity (Newton Is Wrong).

The planet moves by its creation force- means-  the planet creation and motion should be done by the same one force because if two forces have effects on the same one planet, this planet would be broken

Mass gravity Can Not Cause any Motion- (Newton is wrong)– let's explain that -Mass gravity is a bond between 2 masses – the Earth and the moon are bond together by the mass gravity- They are similar to a lorry and its trailer– If a force causes the Earth to move the moon will move with the Earth– this is the effect of the mass gravity but the mass gravity can't cause any motion! Why? Suppose the moon moves by the Earth mass gravity- The moon motion produces energy (1/2mv^2)- and– From what source this motion energy will be provided? From the mass itself! means- If the Earth causes the moon to move that necessitates to decrease the Earth and moon masses by the motion energy– it's wrong definition for the mass gravity - the mass gravity creates a bond between two masses- and if a force causes the Earth to move the moon will move with the Earth, in this case, this force will provide the motion energy for the Earth and the moon– but No Motion can be done by the mass gravity.

(Fact No. 3) The Gravitational Waves Move By Speed Of Light (C= 300000 km/s)

This fact I provide by a direct proof – in following –

This Is Extraordinary: Gravity Can Create Light, All on Its Own

https://www.msn.com/en-us/news/technology/this-is-extraordinary-gravity-can-create-light-all-on-its-own/ar-AA19YL5d?ocid=hpmsnHYPERLINK "https://www.msn.com/en-us/news/technology/this-is-extraordinary-gravity-can-create-light-all-on-its-own/ar-AA19YL5d?ocid=hpmsn&cvid=620db4352aa943e2b454919a7b724604&ei=83"&HYPERLINK "https://www.msn.com/en-us/news/technology/this-is-extraordinary-gravity-can-create-light-all-on-its-own/ar-AA19YL5d?ocid=hpmsn&cvid=620db4352aa943e2b454919a7b724604&ei=83"cvid=620db4352aa943e2b454919a7b724604HYPERLINK "https://www.msn.com/en-us/news/technology/this-is-extraordinary-gravity-can-create-light-all-on-its-own/ar-AA19YL5d?ocid=hpmsn&cvid=620db4352aa943e2b454919a7b724604&ei=83"&HYPERLINK "https://www.msn.com/en-us/news/technology/this-is-extraordinary-gravity-can-create-light-all-on-its-own/ar-AA19YL5d?ocid=hpmsn&cvid=620db4352aa943e2b454919a7b724604&ei=83"ei=83

This new article states the gravitational waves can move by high velocity motion and can produce a light beam. 

Notice –

I Claim The Sun Rays Is Created By This Method (The Gravitational Waves Motions) And Not By The Sun Nuclear Fusion

But- I have proved, the gravitational waves are produced by the planets motions energies- how can the gravitational waves move by speed of light if they are produced by the planets motions energies? And If the gravitational waves move by speed of light how they can produce a light beam?

The fact is that

The planets motions use different rates of time- for that – the planets motions energies are produced based on different rates of time and the motion by speed of light is done by using different rates of time – let's explain how the unified wave (205.8 km/s) moves by speed of light relative to the sun point of space

W agreed that

There's one unified wave revolves around the sun through the Earth moon orbit and this wave moves by velocity 205.8 km/s relative to the sun point of space

This is A Relative Motion between two players (the unified wave) and (the sun point of space)

The two players use different rates of time which is

(one second of the sun clock = 1461 seconds of the unified wave clock)

The unified wave (205.8 km/s) moves in 1461 seconds a distance = 300000 km/s

But the sun clock moves only (one second) during these (1461 seconds of the unified wave clock) –means-

The distance 300000 km is passed in (one second) of the sun clock- by that

The different velocity between the unified wave and the sun motions is 300000 km/s = speed of light (C)

This analysis asks a new question (How Can The Planets Motions Use Different Rates Of Time?) this question is answered in Point (No. 2* the planet motion reason)

But there's one more question we left behind- let's remember it  

If the gravitational waves move by speed of light (300000 km/s) how can these waves produce a light beam? Let's answer in the following fact No. (4*)

(Fact No. 4) The Sun Rays Is Created By The Gravitational Waves Motions

The gravitational waves move by speed of light (C=300000 km/s) relative to the sun point of space- this idea is proved by the article states (the gravitational waves move by speed of light) BUT

How Can This Motion Produce A Light Beam?  The energy is reflected in the solar system, and the energy reflection causes to square the velocities, for that, the speed of light (C=300000 km/s) be squared (C^2) by the energy reflection- and the value (C^2) is the source of energy can produce the light beam

The reflection of energy and its effects are proved strongly in my paper   

The sun rays creation process provides three new features which are

The Gravitational Waves Move By Speed Of Light (C)

The Energy Reflection Squares The Velocities (C^2)

The Sun Rays Is Produced From (C^2) That Means The Sun Rays Is Produced By  A Relative Motion

(Fact No. 5) The Sun Rays Creation Process Depends on A Relative Motion

There are three basic critics against The Sun Nuclear Fusion Theory-

(First Critic) The Source Of Energy- while the solar system is so rich in the motion energy- the nuclear fusion theory invented strange source of energy to produce the sun rays and left the stored motion energy without using- logically- the energy can NOT be stored forever and should be used- The sun rays is the very good outlet for the stored energy- means- the sun rays should be produced from the planets motions energies which are stored in the space in waves form (the gravitational waves)       

(Second Critic) The Sun Rays Production Method- The sun rays are produced by the relative motion- means- the used technical method is the relative motion- the motion produces a relative motion with different velocity = speed of light (C= 300000 km/s) and by the reflection of energy this velocity be squared (C^2) and the sun rays is produced from this value (C^2)

The important thing here is (The Relative Motion) why? because this relative motion is found between two players (the unified wave motion 205.8 km/s) and (the sun point of space motion 1 km/s) – the light production process depends on the different velocity between the two motions (C=300000 km/s)- means- if this different velocity is decreased (NO Light Beam Can Be Created)

So the method needs the different velocity to be (C= speed of light =300000 km/s) and that necessitates the unified wave velocity to be (205.8 km/s) and the sun point of space to be (1 km/s) BUT there's NO any other point in the space moves by this velocity (1 km/s)- only – the sun point of space moves by 1 km/s – later I prove that 

Means- the different velocity (C=speed of light =300000 km/s) can be produced only between the unified wave motion (205.8 km/s) and the sun point of space

That tells- the light can be produced only on the sun point of space because this is the only one point in the space moves by velocity 1 km/s –

for that reason- the sun point of space is defined geometrically!

What does that mean (The Sun Point Is Defined Geometrically)?

The designer used many mathematical calculations and geometrical rules to define the sun position in the sky and the sun creation data- let's give one example

(The sun diameter / the moon diameter) = (Earth orbital distance/ Earth moon dist)

The previous equation enables us to see the sun disc = the moon disc and that causes the total solar eclipse to be occurred- but– why the diameters rate = the distances rate? 

Because the designer made all mathematical calculations to guarantee the velocity of the sun point of space to be only (1 km/s) and Never be faster

Let's see more data behind the total solar eclipse

4900 mkm (Jupiter orbital circumference) = 1.39 mkm (the sun diameter) x 3475 km =12104 km x 406000 km = 12756 km x 384000 km = 6792 km x 2 x 363000 km

3475 km      = the moon diameter                 12104 km    = Venus diameter

12756 km    = The Earth diameter                6792 km      = Mars diameter

 363000 km, 384000 km and 406000 km are the distances between the Earth and its moon in perigee, orbital distance and apogee radiuses respectively

We see how the data is designed geometrically accurately- why the data is created by this accurate system? because the designer aimed by all means to make the velocity of the sun point of space to be 1 km/s and never moves by any faster velocity

We remember (Neptune diameter is 49528 km because Neptune velocity is 5.4 km/s) this fact is proved by my planet diameter equation-

Here also- the sun diameter is defined geometrically in proportionality with many planets to guarantee the velocity of the sun point of space be only (1 km/s)

This argument is so powerful against the nuclear fusion theory, because

The Sun Data Proves The Sun Rays Is Produced By (A Relative Motion) and not by nuclear fusion- the designer had a necessity to create these proportionalities between the sun position and data on one side with the planets data on the other side- the required task was (to create a system guarantee the velocity of the sun point of space to be 1 km/s and never moves by faster velocity) – this is the cornerstone in the sun rays creation process because the rays is created by A Relative Motion- based on different velocity = 300000 km/s

This velocity is the method by which the sun rays is created and If This Velocity Is Decreased No Light Beam Can Be Produced.

Notice

The sun circumference =4.37 million km and the sun rotation period at equator is 25.4 days – if we calculate the velocity of this motion (4.37 million km /25.4 days) the velocity be = 2 km /sec

This is a strong proof for my theory- and we note that- the machine uses the velocity 1 km/s and the sun velocity (2 km/s) forced the machine to make (double for all values) means- for example- the sun rays is created not by (90000 million km) but created by (180000 million km) as I explain later- means – this change in velocity from (1 km/s) to (2 km/s) has great effect on the data but the machine can still produce the light beam- shortly- the sun rays is created by this relative motion with different velocity = C= speed of light = 300000 km/s

(Third Critic)

The sun corona temperature is (5 million Kelvin) but the sun surface is 5800 Kelvin

This data proves strongly my theory – where

The sun rays is NOT produced by the sun nuclear fusion – means – the energy is NOT produced from the sun body – BUT

The energy is produced by the planets motions energies and for that the corona has energy more than the sun body- because the energy comes from out of the sun into the sun- shortly- the energy out of the sun is greater than the energy inside the sun because the sun does NOT produce this energy- this energy is produced by the planets motions energies.

(Fact No. 6) The Sun Corona Temperature Is (5 million Kelvin) and the sun surface is 5800 Kelvin because the energy is NOT produced by The Sun Nuclear Fusion.

This fact is told just before – the sun corona temperature is a strong proof supports my theory tells (the sun rays is created by the planets motions energies total and not by the nuclear fusion)

(Fact No. 7) The Sun Data Depends On The Planets Data 

As We Have Seen In The Total Solar Eclipse Data, the sun data is in proportionality with the planets data proves the sun rays is created by the planets motions energies- But – not only this data

The sun all data is created depending on the planets data – let's see one more example

243/224.7= 29.53/27.3 = 27.3/25.4 = 1.0725

243 and 224.7 days Venus rotation and orbital periods respectively

29.53 and 27.3 days The moon day and rotation periods respectively

25.4 days = the sun rotation period at equator

The data shows clear harmony as if the sun data very similar to the planets data

(Point No. 2) The Planet Motion Reason And Design

A- The Solar System Creation Theory

The solar system is created from one energy- this energy is provided by one light beam its velocity is 1.16 million km per second

From this energy the space is created firstly and the light energy is consumed in the space creation and the rest energy is found in One Wave moves by speed of light (C=300000 km/s) – from this one wave the planets are created-

The creation is done in 2 stages

(First stage The Space Creation)

The original light beam (its velocity 1.16 million km per second) creates the planets orbits before any planet creation, starting from Mercury to Pluto, because of the orbits creation, the light energy is consumed and its velocity be 300000 km/s

We understand this is one light beam- its velocity was 1.16 million km per second and after the space creation this light velocity be 300000 km/s

(Second stage The Planets Creation)

The planets are created from this one wave moves by speed of light (C=300000 km/s)

NOTICE

There are strong proves prove a coherence of light is done between the light 1.16 million km per second and the light 300000 km/s- let's see this idea deeply

The original light beam its speed (1.16 million km per second) started its motion from Mercury orbit to Pluto orbit (Mercury orbit is the light motion origin point) – and this light beam created all orbits before any planet creation- and the light lost its energy in the space creation and the rest energy is one light beam move by the known speed of light is (C=300000 km/s)

The other light beam is the rest energy- it moves by the known speed of light (C=300000 km/s) and it moves in the reflected direction from Pluto toward Venus and Mercury-

Now –there's a coherence of light between these two light beams- the coherence is proved BUT we should ask (how can this coherence be occurred)? Because the original light (1.16 million km/s) is consumed and its energy is used already and the rest energy be this light its speed is (300000 km/s) - HOW can the light (1.16 million km/s) meet the light (300000 km/s)??

Imagine we have (116 dollars) and we spent all money except (30 dollars)- how can this (30 dollars) meet the original money (116 dollars)??

Let's try to answer

Suppose the light beam (300000 km/s) moves in the reflected direction (in the space) and also (in the time) – that can enable the light (300000 km/s) to move into its past and meet the original one (1.16 million km/s) in the past and the coherence can be done there in the past- and we see the coherence results and effects on the solar system-

Means – the light (300000 km/s) moves into its past and found the original light (1.16 million km/s) in the past and the coherence could be done there in the past

Please note- this analysis tells us the light can move on the time axis means can move into the future and into the past- but the matter can Not do that- I explain the reason in my paper (No. I-6)

Shortly- we have a proof for the motion on the time axis and we can create the time machine by this method and the light will be our tool which can move into the past to get pictures and data from the past to us-  

Now

Let's see how the planets are created

B- The Solar Planets Creation

We know- The solar system is one wave moves by speed of light (C=300000 km/s)

Through the space- (till now NO any planet is created)  

Now -The Solar System needs To Create A Stationary Point Its velocity Zero relative to the moving wave its velocity is 300000 km/s

This is the basic information in the solar system design-

The solar system needs to create a stationary point relative to the wave motion- by that – two velocities will be found which are (v1= the wave velocity 300000 km/s) and (v2= Zero= the stationary point relative to the wave motion)–these two velocities produce a relative motion with different velocity 300000 km/s–

Notice – the stationary point velocity is 1 km/s (= Zero approximately)

Notice– The solar system is one wave moves by speed of light (C=300000 km/s), or the solar system is carried on light beam moves by speed of light (C=300000 km/s),

Everything in the solar system is carried on this one light beam motion- and nothing is static- No stationary point can be found here-

This is similar to ships are found on the sea- nothing is stopped- all ships move and can't stop- because the motion is done forcedly by the sea waves.

The stationary point will be similar to the whirlpool (vortex) found on the sea page- 

We see the whirlpool doesn't move with the sea waves- for that the whirlpool can be considered as a stationary point relative to the sea waves.  

But

The solar system needs to create the stationary point

Now – let's try to create this stationary point in following

The solar system uses two procedures to do that,  

The first procedure

The wave its velocity 300000 km/s revolves around a point in space (any point in space), the revolution motion creates 2 equal velocities on both sides of the revolution- the two velocities are equal in value and opposite in direction- their total be equal Zero-means- the revolution motion creates One Stationary Point in the center of the revolution. 

The second procedure

The previous idea is correct- but –the velocity 300000 km/s is a huge one and to decrease it to Zero velocity this is a complex process– for that- the wave (300000 km/s) created small waves with low velocities to use them as steps to decrease the velocity to Zero- the small waves are The Planets- (The planet is a small wave moves by low velocity relative to the mother wave its velocity 300000 km/s) 

Why Are These Small Waves Required?

Because the velocity 300000 km/s is decreased to Zero by using these small waves and their low velocities- the low velocities are used as steps to decrease the wave velocity (300000 km/s) to be (Zero)- this process decreases the velocity gradually from 300000 km/s to Zero depending on these small waves velocities (the planets velocities)  

Means- the planets are created for this process to decrease the wave velocity from 300000 km/s to Zero- and The Planet Is A Small Wave Moves By Low Velocity  

Shortly – the solar system has one complete system of velocities, Starting from Zero to 300000 km/s where the planets velocities are the steps between the two velocities –

Please note clearly this idea- because-

The solar system has one motor for all motions which is the wave motion by speed of light (300000 km/s) No any other motor is found in the solar system

The planets are similar to carriages in one train but the train engine is the light motion by that the only motor under all motions in the solar system is the wave motion (speed of light 300000 km/s)

So, we have to ask- how can any planet move by a velocity Less than (300000 km/s)?

Because – The Planets Use Different Rates Of Time-

The rates of time is created based on the velocities rates –

For example-

Mercury velocity =1.6 Earth velocity, for that, one hour of Mercury clock= 1.6 hours of the Earth clock and by that Mercury and the Earth move equal distances in equal periods of time. 

This is very important fact because – the light moves carrying all planets with it- Now the light moves (one motion) and passes (one distance) in (one period of time)

All planets will move (this same motion) and pass (this same distance) in (this same period of time)- but

We need different velocities for the planets to work as steps to decrease the velocity (300000 km/s) to Zero (Stationary point)- means- it's essential to have (different velocities) and that causes the using of the rates of time inevitable and essential method to enable the solar system to do its motion.

C- The Rate Of Time Use

(i)

The Rate Of Time Effect

The rate of time controls the moving energy rate-

For example (One Hour Of Mercury Clock = 24 Hours Of Pluto Clock)

What does that mean?

It means, Pluto motion energy (for 24 hours) can be used by Mercury in (one hour)

Here - the solar system is similar to a river of water moves from a point to another and the rate of time defines the amount of the transported water (energy)

In more details

The energy is transported among the planets and the amount of energy is defined by the rates of time- because- the energy transportation necessitates to transport the motion among the planets and the motion transportation caused to transport the rates of time among the planets-

(ii)

The Rate Of Time Use

We agreed that, the solar system has one motor only which is the wave moves by speed of light (C=300000 km/s)- means- no velocity can be less than speed of light unless it depends on a rate of time –

Means- all planets velocities are created based on rates of time- that causes the rates of time to be used in all motions in the solar system  

Let's remember,

Planet motion energy creates waves in the space- we remember the accurate vision- we observed one swimming fish, the fish hits the water by its tail and swims, that creates a wave in the sea and this wave moves by the fish velocity because of the reaction-

Similar to that, Mercury (47.4 km/s) moves and its motion energy waves are created and these waves move by Mercury velocity (47.4 km/s) –BUT- Mercury velocity is created based on a rate of time- that causes the waves motions use rates of time-   

I try to show how the gravitational waves motions depend on rates of time

For more clear vision

We have to consider that the solar system has one motor only and this motor is the wave moves by speed of light (C=300000 km/s) for that any motion in the solar system with velocity less than speed of light (must depend on rates of time)  

The rates of time = the velocities rate –

Let's remember out example

Mercury velocity =1.6 Earth velocity by that (One second of Mercury clock = 1.6 seconds of the Earth clock)– by this rate of time Mercury and the Earth move equal distances in equal periods of time -

We understand the reason- where

The planets are geometrical points on the same one light beam- and this light beam moves carrying all planets with it- and

The light moves one motion, passes one distance in one period of time, for that, all planets move this same motion, pass this same distance in this same period of time

(iii)

The Solar Planets Basic Rates Of Time

Let's remember the basic rates of time

(one hour of Mercury clock = 24 hours of any planet clock) and

(one hour of Mercury clock = 576 hours of Saturn clock)

That causes

(one hour of any planet clock = 24 hours of Saturn clock)

This rate of time is defined by Mercury motion effect And

The major rate of time between the planet and light motion is

(one second of light clock = one solar day of the planet clock)

This rate is a complex one because there are 2 velocities of the light (as I proved) 

The original velocity 1.16 million km per second and the known velocity 300000 km/s

Means

(one second of light 1.16 mkm/s   = one solar day of the planet clock) and

(one second of light 300000 km/s = one solar day of the planet clock)

That causes the rate of time (1=24) to be so necessary to create the harmony between the planets and light motions- for that this rate (1=24) is used by Mercury motion 

Notice

The rate of time is defined basically by the planets velocities as explained before – for example - Mercury velocity = 1.6 the Earth velocity- means – one hour of Mercury clock = 1.6 hours of the Earth clock

But the solar system energy is reflected three times in the solar system, and each reflection causes to square the velocity, by that, the rate of time (v1/v2) be growing to be (v1/v2)^3

That explains why the planets orbital periods rate = (their velocities rate)^3

Also all other planets data is worked as rates of time-

D- The Unified Wave Moves By Speed Of Light

Let's remember out equation

300000 km = 7.1 x (205.8)^2 where

7.1 is Lorentz length contraction effect for velocity 297000 km/s (= 0.99 C)

205.8 km/s = the 9 planets velocities total (176 km/s) + the Earth moon velocity

(The moon velocity =29.8 km/s = the Earth velocity because they revolve together)

Why does the data use the squared value (205.8)^2?

We know the answer- but - Let's remember it

The planets are geometrical points on the same light beam and move with its motion- for that- the planets velocities rates creates rates of time– for example-  Mercury velocity = 1.6 the Earth velocity- that means – one hour of Mercury clock = 1.6 hours of the Earth clock- as I have explained before 

Now- the velocity (205.8 km/s) move relative to the stationary point its velocity Zero (The Sun) and creates a rate of time (1 second = 205.8 seconds) –

(One Second Of The Unified Wave Clock = 205.8 Seconds Of The Sun Clock)

But – the energy is reflected in the solar system (I proved in the paper),

The energy reflection reflects the players – means

(one second of the Sun clock = 205.8 seconds of the unified wave clock)

means (one second of the sun clock = 205.8 seconds of any planet clock) –

Now during one second of the sun clock, the wave clock needs 205.8 seconds while the wave moves by a velocity 205.8 km/s- means –

During one second of the sun clock, the wave moves 42253 km = 300000 km /7.1

By that the velocity is 42253 km/s which is equivalent to the speed of light

Notice

The velocity 42253 km/s is equivalent to the speed of light 300000 km/s because of the length contraction effect rate (7.1) – because

The reflection of energy causes to reflect the geometrical effects and the rate 7.1 which caused (length contraction) will cause (length increasing)

The length contraction and increasing both effects are produced by the same one motion but the reflection of energy causes to reflect the geometrical effects.

E- Planet Velocity Analysis

DATA

My 5th equation (v1v2=322)- the planets velocities prove it–let's see that in following  

322 = 47.4 km/s (Mercury velocities)  x 6.8 km/s  (Uranus velocities)                    

322 = 35 km/s  (Venus velocity) x 4.7 km/s (Pluto velocity) x 2             

322 = 29.8 km/s (the Earth velocity) x 5.4 km/s (Neptune velocities) x 2      

322 = 24.1 km/s (Mars velocity) x 13.1 km/s (Jupiter velocity)               

322 = (17.9 km/s)^2 (Ceres velocity) (Max error 2%)

DATA ANALYSIS

The previous data tells the planets velocities are defined by two features

(1st Feature)

The planets velocities are complementary one another –means - each planet velocity is complementary with another planet – means– The planets velocities are defined in pairs and not in single planets. 

(Notice, the inner planets orbital inclinations are defined by the rule (v1/v2), for example, Mercury orbital inclination 7 deg = Mercury velocity 47.4/ Uranus velocity 6.8- that proves the effect of the rule (v1v2=322) on the planet motion)

(2nd Feature)

Why the constant is 322 because

1160000 seconds = 322 hours – means- there's a light velocity = 1.16 million km /s and this light moves for one second passes 1160000 km but we see this distance as a period (1160000 seconds =322 hours)- and - the planets velocities are defined based on this velocity 1.16 million km /s

Discussion

Ceres velocity tells the idea - Ceres is used as the origin point - as a result the outer planets be complementary with the inner planets – for that the rule (v1v2=322) controls the planets velocities.

(a)

The planets velocities are created based on one design- Ceres velocity is used as the origin point for this design

(b)

Shortly

Mercury (47.4 km/s) moves during 6.8 hours a distance             = 1160000 km 

Uranus (6.8 km/s) moves during 47.4 hours a distance               = 1160000 km 

And

Mars (24.1 km/s) moves during 13.1 hours a distance                = 1160000 km 

Jupiter (13.1 km/s) moves during 24.1 hours a distance             = 1160000 km 

(error 2%) - And

Earth (29.8 km/s) moves during 2 x 5.4 hours a distance             = 1160000 km 

Neptune (5.4 km/s) moves during 2 x 29.8 hours a distance        = 1160000 km 

And

Venus (35 km/s) moves during 2 x 4.7 hours a distance             = 1160000 km 

Pluto (4.7 km/s) moves during 2 x 35 hours a distance               = 1160000 km 

(error 2%)

Notice - Saturn (9.7 km/s) moves during 33.2 hours a distance = 1160000 km 

(between 33.2 and Venus velocity 35 km/s the error 5%) 

(c)

The planets velocities definition depend on the speed of light 300000 km/s

As we have seen before in the equation

300000 km = 7.1 x (205.8)^2

Here we see the planets velocities are defined based on two velocities which are – the speed 1.16 million km per second and the light speed 300000 km/s- that's one proof among many others which prove the coherence of light is done between the light 1.16 million km per second and the light 300000 km/s

Why is it necessary to review the planet velocity analysis here? 

Because the planet velocity analysis proves the sun is created after all planets creation and motion -Let's see that in the next point

F- The Sun Is Created After All Planets Creation And Motion (Proves)

We analyzed the planet velocity definition before, let's remember its basic feature  

DATA

We remember the rule (v1v2=322) (my 5th equation)– let's prove it

322 = 47.4 km/s (Mercury velocities)  x 6.8 km/s  (Uranus velocities)                    

322 = 35 km/s  (Venus velocity) x 4.7 km/s (Pluto velocity) x 2             

322 = 29.8 km/s (the Earth velocity) x 5.4 km/s (Neptune velocities) x 2      

322 = 24.1 km/s (Mars velocity) x 13.1 km/s (Jupiter velocity)               

322 = (17.9 km/s)^2 (Ceres velocity) (Max error 2%)

DISCUSSION

The data tells

The Planets Velocities Are Defined Based On One Design

The planets are added in pairs in the solar group- means- No single planet can be added to the solar group

Now we have to ask

Can We Add A New Planet To The Solar Group?

Let's answer in following

I add a new planet after Pluto

I suppose the new planet orbital distance to be =7000 million km

This new planet velocity will be 4.3 km/s (We can define it by kepler law)

Now we need the complementary planet because of the rule (v1v2 =322)

(322 =4.3 x 75), means, the complementary planet velocity is 75 km/s   

Where can we find a planet its velocity 75 km/s? this planet must be in the distance between the Sun and Mercury –

This planet orbital distance should be 23.2 million km

(57.9/23.2) = (75/47.4)^2  where

(57.9 million km = Mercury Orbital Distance) and (47.4 km/s) Mercury velocity

Shortly –

It's hard to add any planet in the distance between Mercury and the Sun- means- we can't add any new planet to the solar group because of the Sun existence.

But-

How Could The Found Planets Be Added To The Solar System?

The Sun is created after all planets creation and motion- means – after all planets be in their orbits the Sun is created- In details-The planets were created in their orbits and revolve around a point of space, before the sun creation, and later the sun is created in this point of space around which the planets revolve

Because - technically-  the Sun existence prevents to add any new planet to the solar system and also the Sun existence prevents any planet to change its orbit

(For example- Mars original orbit was between Mercury and Venus and Mars had migrated to its current orbit before the Sun creation And Mars couldn't return to its original orbit because of the Sun existence ) (Mars Migration is proved in the paper) 

Notice

This analysis is another proof for my theory tells (The Sun Rays Is Created By The Planets Motions Energies And Nut By The Sun Nuclear Fusion)

Shortly

The sun rays can NOT be created without the solar planets because the sun rays are created from the planets motions energies – logically the planets are found and moving before the sun creation-

(Point No. 3) Saturn Motion Effect On The Solar System Motion

Let's remember our question

Can The Sun Rays Creation Process Depend On Saturn Motion?

The question tells us (If Saturn Is Not Found In The Solar System The Sun Rays Can Not Be Created)- Let's ask (what's Saturn role in the solar system motion?)

The main rates of time are

(one hour of Mercury clock = 24 hours of any planet clock = 576 h of Saturn clock)

That causes (one hour of any planet clock = 24 h of Saturn clock)

This rate of time is changed slightly by the velocities effect to produce the nest rate

205.8 km/s = 9.7 km/s (Saturn velocity) x 21.4 second

205.8 km/s = the planets velocities total

The data tells

(one hour of any planet clock = 21.4 h of Saturn clock)

And Saturn created its rotation period (10.7 h) based on this rate (21.4 = 2 x 10.7 h)

The data shows- Saturn has the smallest rate of time in the solar system and by that Saturn moves more than any other planet- in fact

In the same period - Saturn moves a distance = all planets motions distances total 

Shortly -the Sun rays is created by the planets motions energies BUT Saturn motion alone provides (50%) of all this energy – that makes Saturn the most important planet in the solar system -and because of that- Saturn motion provides the greatest rate of time in the solar system and based on this rate of time the sun rays is created

Shortly

The Sun rays creation depends directly on Saturn motion because Saturn provides (50%) of all provided energy for the sun rays and because Saturn motion creates the rate of time based on which the energy can be stored to produce the sun rays

Saturn is the motor behind the sun rays creation process – I analyze Saturn data in details in point no. (3) of the paper because Saturn data proves that – the planets motions causes to create the sun rays clearly

The Paper hypotheses

The paper provides 4 hypotheses with their explanations and proves – let's provide them in following

Hypothesis No. (1)

The space is created from one energy and this energy is provided by a light beam moves by a speed 1.16 million km per second – the speed is registered in the created space proves the speed is a fact.

Hypothesis No. (2)

The Gravitational Waves Are Produced By The Planets Motions Energies And Not By The Sun Gravitational Field– Moreover- The Sun Does NOT Produce A Gravitational Field And It Has No Massive Gravity- 

Hypothesis No. (3)

Mars original orbit was between Mercury and Venus and Pluto was The Mercury Moon (Pluto size was equal Mercury size) But these two planets had migrated from their original orbits as a result for a collision- the planets migration caused a risk for the solar system geometrical design- Uranus and Jupiter the Two planets worked to repair the solar system design– that caused Jupiter orbit to be the main orbit in the solar system design- Jupiter orbit proves the speed 1.16 million km per second is a fact.   

Hypothesis No. (4)

The Sun Is a phenomenon created by the planets motions

The sun rays is created from the gravitational waves motions energies and the gravitational waves are produced by the planets motions energies-

Based on that 

The Sun Is A Phenomenon Created By The Planets Motions

And

The Sun Is NOT Doing Nuclear Fusion To Produce Its Rays- instead- The Planets Motions Energies Total Is Used To Produce The Sun Rays

The Sun Is Created After All Planets Creation And Motion –

Means

The Planets Are Created And Moving In Their Orbits Around A Point Of Space Before The Sun Creation- And The Sun Is Created On This Point Of Space around which the planets revolve –

And

No Planet moves by The Sun Gravity (Newton is Wrong) –

And

The Sun Doesn't Produce A Gravitational Field (Einstein Is Wrong)

And

The Sun Is A Phenomenon Created By The Planets Motions– means-The Sun creation and death depends on a cycle – means – after this current sun death another sun will be created for the solar system.

The Hypotheses Explanation

The abstract provides the hypotheses explanation and the paper provides their proves and discussions- In following the hypotheses will be explained in details 

NOTICE –

The creatures and all matters on the Earth are created from the sun light energy and the sun light speed is 300000 km/s, because of that, the creature realization is limited to the speed 300000 km/s and can't realize the original speed (1.16 million km per second) that means the speed 300000 km/s is a limit for the creatures realization and not for the universe design.   

Hypothesis No. (1)

The space is created from an energy and this energy is provided by a light beam moves by a speed 1.16 million km per second – the speed is registered in the created space which proves the speed is a fact

The Hypothesis Explanation

I- The Space Is Created By One Light Beam Energy- And This Light Beam Speed Is 1.16 million km per second

I-1 Preface (the main idea)

I-2 The Space Creation Method (the distances are one network)

I-3 Light Coherence between light (1.16 million km /s) and light (300000 km/s)

I-4 The Matter definition (based on my planet diameter equation)

I-5 The Planets Creation

I-6 Can The Time Machine Be A Fact?

The Hypothesis Proves

I-7 The Proves Logic Analysis

I-8 Planet Velocity Is A Function In A Speed = (1.16 million km /s)

I-9 Planets Orbits Are Defined By A Motion Its Speed = (1.16 million km /s)

I-10 Jupiter distances are defined by a motion by a speed = (1.16 million km /s)

I-11 The Solar System Geometrical Design Proves The Hypothesis

I-12 The Solar System Distances Analysis Prove The Hypothesis

I-13 Deep Analysis For The Planets Orbits

1-14 Light defines each planet orbital period

I-15 Can Planet Diameter Be Used As A Period Of Time

I-16 Mercury Orbit Analysis

I-17 The Planets Data Is Created By The Light Motion Directly

I-18 Light Defines Each Planet Rotation Period

I-1 Preface (The Main Idea)

The solar system (planets and distances) is created from one energy and this energy is provided by one light beam and this light beam moves by speed (1.16 million km/s)

The space is created before the planets creation-

Let's write the whole story in following

The light beam (1.16 million km per second) started its motion from Mercury orbit moves toward Pluto orbit– by that– we consider Mercury orbit is the origin point-

Now- we should notice- No planet is created yet- the motion from Mercury orbit to Pluto orbit defines the motion direction- and No planet is created before this motion end nor during this motion- the planets will be created after this motion is finished means when the light 1.16 million km per second reaches to Pluto (orbit)- after this event – the planets will be created –as I will explain later  

Notice

The light (1.16 million km per second) creates the distances by its motion- means- the light moves from Mercury point to Venus point– the distance from Mercury to Venus was not found and is created only by the light motion through it for first time- means – before the light motion this distance was NOT found- It's found after the light moves through this distance for first time-    

This is similar to the blood motion through the arteries, the blood creates these arteries and the blood moves through these arteries, but the blood created these arteries with its first motion and that needed energy- but – after the arteries creation the blood move through them without any energy is required- means- the first motion is the most important one because by it the arteries are created

Shortly- The space is created from the energy of this light beam its speed 1.16 million km per second – NOW- after the Space creation- the light beam energy is decreased because of the energy consumption in the space creation process- and the rest energy is one light beam its speed is (C=300000 km/s =the light known speed) – But - We understand that- it's the same one light beam- its speed was 1.16 million km /s before the space creation- and the light created the space and that caused to consume the light energy and that caused to decrease the light speed to be 300000 km/s

Shortly- the light beam started its motion from Mercury (orbit) with speed 1.16 million km /s and reaches to Pluto (orbit) with a speed 300000 km/s because of the energy consumption in the space creation process  

Let's give example to explain this idea

Imagine we create A Sea Of Water- we use energy to create this sea of water- now we have some energy and we use this energy to create this sea of water- BUT- our energy is NOT spent completely But there's a small part still rest with us – this small part of energy is used to create one wave moves through this sea and this wave speed is 300000 km/s (I suppose the space is similar to the sea of water)

Now – the rest energy is found in one light beam its speed 300000 km/s and this light beam is found NOW in Pluto Orbit – and this light beam will be reflected from Pluto orbit toward the inner planets– means- the rest energy will move in the reflected direction to the original light motion direction.

This idea will be explained in details in the next point- shortly

The light beam (300000 km/s) will be reflected from Pluto toward the inner planets

AND  the light 300000 km/s will meet the original light beam (1.16 million km per second) in the origin point (in fact – beside the origin point) and there's a coherence of light is done between the light beam (300000 km/s) and the light beam (1.16 million km per second) – this coherence of light is proved strongly- we have to ask (how can that be possible while the light beam 1.16 million km /s is consumed and the new light beam 300000 km/s is the rest energy? how this light beam (300000 km/s) can meet the original one (1.16 million km per second)? in points no. (I-3) and no.(I-6) I answer this question.

Notice (1) I suppose the rest energy is a light beam its speed is (C=300000 km/s) but this idea is for simplicity- the rest energy can be in any wave form its speed (C=300000 km/s) – no necessity to be in visible light beam form

It's simply energy moves by the known speed of light (C=300000 km/s)

Notice (2)

All Planets Orbits Are Defined Before Any Planet Creation-

The light used the distance from the sun to Pluto as one area and create one geometrical design for this area before any planet creation 

Notice (3)

The planets are created from the rest energy its speed (300000 km/s) – means- the space is created by the light 1.16 million km per second and the energy is consumed in the space creation and the rest energy is one light beam its speed 300000 km/s (or one wave moves by the known speed of light C=300000 km/s) – the solar planets are created from this one wave its speed 300000 km/s and that means all planets orbit are created and defined before any planet creation

Notice (4)

The Sun Is Created After All Planets Creations And Motions

The sun is a phenomenon created by the planets motions energies total

The sun doesn't produce a gravitational field and doesn't have massive gravity

Logically – No planet moves by the sun gravity

(The Planet Moves With The Energy From Which The Planet Is Created – Newton is wrong- later we discuss the proves)

Notice (5)

The child (fetus) inside his mother is created by the blood motion- the blood motion creates arteries for this child and through these arteries the blood moves also but the arteries themselves are created by this same blood motion- Similar to that- the distances are created by the light motion energy and the light moves through these distances also but originally these distances themselves are created by the light motion energy-  means the distances creation is done with the first time of the light motion through them - that required energy- but after the distances are created no more energy is required- the light (or planet) can pass simply through these distances

I-2 The Space Creation Method (the distances are one network)

Data

778.6 = 1.16 x 671

721    = 1.16 x 621

629    = 1.16 x 543

543    = 1.16 x 468

5906  = 1.16 x 5127

These numbers are distances in (million km)

778.6, 721, 671, 629, 551 are Jupiter distances to the sun, Mercury, Venus, Earth and Mars respectively- 5906 and 5127 Pluto distances to the sun and Jupiter respectively     

468 = 936 /2 where (940 million km = the Earth orbital circumference)

Discussion

(1)

The previous data tells us how the light beam motion creates the distances-

Simply the light uses a distance as (a period of time) and travels through this period another distance- that can be understood clearly from Jupiter distances- let's look deeply as possible

The light beam (1.16 million km per second) uses the period 629 seconds to pass a new distance = 729 million km (Mercury Jupiter distance is 721 million km error 1%) – where 629 million km = Jupiter Earth distance

Also  

The light beam (1.16 million km per second) uses the period 671 seconds to pas a new distance =778.6 million km (Jupiter orbital distance) 

where 671 million km = Jupiter Venus distance

by this method the light creates the distances based on each other- and that makes all distances to be created depends on one another and that makes all distances in the solar system to be One Network where all distances are created based on the same One Geometrical Design

(2)

The data shows the creation method- and we understand that- the distance 551 million km (Jupiter Mars Distance) is created firstly and the light (1.16 mkm/s) used this distance as a period of time (551 sec) and the light travels during this period a distance =(639 million km where 629 million km is Jupiter Earth distance error 1.5%) and then the light uses the new distance (629 mkm) as a period of time (629 sec) and the light travels during this period a distance = (729 million km – where 721 million km = Mercury Jupiter distance – error 1%)

The data shows the method clearly and we understand the light original motion started from Mercury orbit to Pluto orbit because the distances are created based on one another in that direction of motion as explained clearly

(3)

New data NO. (1)

2723 sec x 2 x 300000 km/s = 1622 million km – where

2723 million km = Uranus Earth Distance

1622 million km = Uranus Neptune Distance

The data shows- the light beam its speed (C=300000 km/s) is in proportionality also with the created distances but this proportionally is found in Reflected Direction

Logically, The light can NOT move from Uranus to Neptune and after that the light returns to move from Uranus to the Earth- it's simply reflected direction  

The distances are NOT created by the motion of this light beam (300000 km/s) – but the distances are created by the motion of the original light beam (1.16 million km per second) but the proportionality between the distances with the light (300000 km/s) is found because there's a proportionality between the original one (1.16 million km per second) and this light beam (300000 km/s) – AND 

Because the light (300000 km/s) moves in the reflected direction of the original light beam (1.16 million km per second) that causes the proportionality between the distances and the light (300000 km/s) be in a reflected form

New data NO. (2)

2094 sec x 300000 km/s = 629 million km

2094 million km = Uranus Jupiter distance

629 million km   = Earth Jupiter distance

The light (300000 km/s) moves in reflected direction- for that- the distance 2094 million km is used as a period of time to pass a new distance (629 mkm)

The data proves the idea clearly

Notice (1)

The proportionality between the light (1.16 million km/s) and the light (300000km/s) will be discussed in point no. (I-3)

Notice (2)

In Point (**) I prove the gravitational waves are produced by the planets motions energies- and I prove that – the planets motions energies move toward Pluto and this energy is reflected from Pluto toward Venus- this fact is proved by powerful data and proves- for that – I don't explain in details the light motion trajectory from Pluto toward the inner planets because this motion trajectory is studied in details in the hypothesis No. (2) of this discussion- understandable that- the planets motions energy trajectory is the same trajectory the light moves through it – means this trajectory is studied in details and powerful proves in point no. (**)

Notice (3)

Jupiter Distances Analysis shows that Jupiter orbit is the central orbit for the light (1.16 million km per second) based on which all planets orbits are defined.

But – this is not the first creation case –

The light (1.16 million km per second) created the planets orbits based on each other starting from Mercury orbit moves toward Pluto orbit – this is the fist creation case – and this fact is proved strongly in point no. (I-9*)

BUT

Mars had migrated from its original orbit (Mars original orbit was between Mercury and Venus) and Pluto had migrated also (Pluto Was The Mercury Moon revolves around Mercury and Pluto size was equal Mercury size)

The planets migration caused a serious risk for the solar system geometrical design- Uranus was the first planet tried to repair the solar system geometrical design and to save it- by that

Uranus created a vertical effect on Jupiter orbit to fix Jupiter in its orbit and prevent it to migrate with the migrant planets- and based on Jupiter orbit the other planets orbits are modified – that supported the solar system original design and saved it which causes to protect the geometrical design from the destruction.  

As a result

That causes Jupiter orbit to be the most important orbit in the solar system- the paper third hypothesis explains the planets migration and Jupiter orbit analysis is done with the solar system design analysis (I-11*)

I-3 Light Coherence between light (1.16 million km /s) and light (300000 km/s)

(1)

The Coherence Of Light

The previous explanation told us that we have 2 light beams-

The original light beam its speed (1.16 million km per second) and it started its motion from Mercury orbit to Pluto orbit (where Mercury orbit is the light motion origin point) – and this light beam created all distances in the solar system and lost its energy in the space creation process and the rest energy is one light beam its speed is (C=300000 km/s)

The other light beam is the rest energy- its speed is (C=300000 km/s) and it moves in a reflected direction from Pluto toward Venus and Mercury-

Now – we have a coherence of light between these two light beams- the coherence is proved by powerful proves BUT firstly we have to ask (how can this coherence be occurred)? Because the original light (1.16 million km/s) is consumed and its energy is used already and the rest energy is this light its speed is (300000 km/s) - HOW can the light (1.16 million km/s) meet the light (300000 km/s)??

Imagine we have (116 dollars) and we spent all money except (30 dollars)- how can this (30 dollars) meet the original money (116 dollars)??

Let's write the answer

Suppose the light beam (300000 km/s) moves in the reflected direction (in the space) and also (in the time) – that can enable the light (300000 km/s) to meet the original one (1.16 million km/s) in the past and the coherence will be done there in the past- and we see the coherence results and effects on the solar system -

Means – the light (300000 km/s) moves into the past and found the original light (1.16 million km/s) in the past

Notice No. (1)

The original light beam (1.16 million km/s) can NOT move toward the future to meet the light (300000 km/s) because in the future the original light beam (1.16 million km/s) is NOT found –by that – the coherence can't be occurred in the future - But – the light (300000 km/s) can move into the past because this light beam (300000 km/s) was found in the past because it's a part of the original light beam (1.16 million km/s)

Notice no. (2)

I prove the coherence is done by powerful proves- that tells- this idea is a fact–means- there's a strong proof tells (in fact the light beam 300000 km/s moved into the past) and if we can use this feature practically we can get photos from the past events and by that we can have photos from the catastrophe which killed the dinosaurs and know much better about what had happened really in that time - This can be a real machine of time – the light motion into the past is a strong method to perform this invention. 

Notice no. (3)

Why Can NOT We Move Into The Past As We Move Into The Future?

This question is answered in point no. (**)

(2)

The Light Coherence Proves

First Proof

The planets order is typical to the interference of Young –

In the double slits experiment, Young Interference is consisted of bright fringes and dark fringes - If we consider planet diameter is equivalent to bright fringe – we will see that- the planets order is typically to Young interference because

Jupiter (the greatest fringe) is in the middle and the fringes width is decreased gradually on both sides – typically to the planets order

Notice / I have proved that (Mars original orbit was between Mercury and Venus) if we restore Mars to its original orbit the order will be typical to the Young Interference

(I prove this fact in point no. **)

Second Proof

The planets velocities are defined based on the speed (1.16 million km per second) and the planets velocities analysis shows the speed (300000 km/s) is the planets motions limit- means- the planets velocities are defined based on both velocities (1.16 million km per second) and (300000 km/s) I prove this fact in point No. (**)  

Third Proof

The light coherence defines the solar day period (24 hours) which is the solar system design cornerstone 

(1.16 /0.3) x 2π = 24.3

By this equation the space and time are created- the equation tells–the space is created in curves (2π) and the time is created in units each unit is (24 hours) 

Please note – the solar system geometrical design depends on the light motion in a solar day (24 hours = 86400 seconds) 

The light (1.16 million km per second) moves in a solar day (86400 seconds) a distance  = 100733 million km (= the planets orbital circumferences total)

Fourth Proof

The planets data prove there's a speed (1.16 million km per second) found in the solar system but the sun light beam moves by speed (300000 km/s) that tells the two speeds are facts and found in the solar system and the coherence between them is a logical result

The hypothesis proves discuss many powerful proves for this fact-

Notice- the coherence of light is a very important fact because it tells the light (300000 km/s) moved into the past and by that gives us a proof for the motion on the time axis- for that – many powerful proves support this fact.

I-4 The Matter definition (Based On My Planet Diameter Equation)

(1)

Let's remember my planet diameter equation

Planet Diameter Equation (v1/v2)= (s/r)= I

v = Planet Velocity                                                          

r = Planet Diameter

s= Planet Rotation Periods Number In Its Orbital Period

I= Planet Orbital Inclination        (example, 1.8 degrees be produced as a rate 1.8)

v2, s, r and I are belonged to one planet and v1 is belonged to another planet

The planet (v1) is defined by test the minimum error 

Earth Equation uses Neptune velocity

Mars Equation uses Pluto velocity

Jupiter Equation uses the Earth moon velocity

Saturn Equation uses Mars velocity

Uranus Equation uses Neptune velocity (As Earth)

Neptune Equation uses Saturn velocity

Pluto Equation uses the Earth moon velocity (As Jupiter)

(The Equation works from The Earth To Pluto) (the discussion explains the reason)

Example

Neptune Equation (89143 /49528) = 9.7/ 5.4 =1.8         

89143          = Neptune rotation periods number in Neptune orbital period

49528 km    = Neptune diameter

9.7 km/s      = Saturn velocity

5.4 km/s      = Neptune velocity

59800 days = Neptune orbital period (and Neptune rotation period =16.1 hours)

1.8 degrees = Neptune Orbital Inclination

(the equation is proved and discussed in details in point no. **)

(2)

Can We Define The Matter Nature Based On My Planet Diameter Equation?

The equation tells, the matter is created based on its motion! means Neptune diameter is 49528 km because Neptune velocity is 5.4 km/s!!

That tells the motion with velocity 5.4 km/s is defined before Neptune diameter is created! Can we understand such definition for the matter nature? let's try

(A)

The Matter Nature

The space and matter are created from the same original energy and they move with this original energy motion- BUT the matter has a distinguish picture and different velocity from the space picture and velocity (notice- The Gravitational Waves Prove That The Space Has A Motion)  

If we suppose the space is similar to the sea of water, the matter be similar to a whirlpool or a vortex found on the sea page- means- the matter is a geometrical design has a distinguish picture from the space- as the whirlpool, it's created from the sea water but it has a distinguish picture from the sea waves picture

Means

The whirlpool is carried by the waves motion- and- the matter is carried by its original energy and moves with it- No Mass gravity is required for the matter motion- means- the matter is MOVABLE by nature.

Also

The whirlpool dimensions are defined by the water motion - for example- we have a whirlpool its diameter is (2 meters)- this diameter is defined by the sea water motion features (velocity, pressure and other motion features) by that- the water motion analysis explains how the whirlpool dimensions are created

Also- the whirlpool is created but the creation requirements are needed every day- means- even if this whirlpool is found since years it can be changed immediately if the water motion features are changed- means- the whirlpool creation process is NOT a historical one.

Also- the matter is similar to a creature muscle, the muscle is found based on the blood motion and without this motion the muscle can be changed or removed.

Shortly

The Original Energy Was Found In Motion By Itself (As Moving Light Beam)

From This Moving Energy The Planet Matter Is Created

The Created matter dimensions are defined by the features of this original energy motion (means the planet creation data is defined by the energy motion features)

After the planet creation- The Planet Moves With This Original Energy – means- the created planet moves a motion depending on the motion of this original energy because the planet moves with this original energy motion- and – the planet moves by this original energy motion (No mass gravity is required to cause the matter motion)

The planet creation data is in full harmony with its motion features- this fact is produced logically because the planet data is defined by the original energy motion features.

This explanation tells (Neptune diameter is 49528 km because Neptune velocity is 5.4 km/s)

Example For Explanation

We agreed that the space is similar to the sea of water and the planet (matter) is similar to a whirlpool found on the sea page-  this picture explains the idea clearly- because

We see the whirlpool doesn't move by the sea water waves velocity but by another velocity and that shows a distinguish in form and motion between the whirlpool (the planet) and the sea waves (the space)- BUT- the whirlpool dimensions are defined based on the sea water motion features- and if the motion features are changed the whirlpool dimensions will be changed also- also the whirlpool moves by the sea water motion even with a different velocity relative to the sea waves velocity but the whirlpool motion still is  caused by the sea water motion- based on this picture we can say (because the water motion velocity is 80 km/h that causes this whirlpool diameter to be 2 meters "for example') – this is perfectly our sentence – let's remember it     

(because Neptune velocity is 5.4 km/s that causes Neptune diameter to be 49528 km)

This idea is proved by my planet diameter equation (my fourth equation) (point No.**)  

(B)

Now The velocity is a motion in (A Defined Direction)

Means– the matter is created because it depends on a motion in a defined direction- as we have seen- Neptune diameter is 49528 km because Neptune velocity is 5.4 km/s but this velocity is a motion in defined direction- and that tells Neptune creation depends on a motion in the direction of the (x axis positive "+x ") (for example)

That tells, if this motion moves in (x axis negative "-x ") that will cause Neptune diameter to be changed or perished

Means- the matter creation needs a motion in A Defined Direction

Now let's ask our question

Why Can't The matter (creature) Moves Toward Its Past?

Because the matter depends on a motion in one defined direction- that causes the matter moves into (the future) always and can't move into (the past) let's discuss this question more deeply in point no (I-6)

Notice

No Planet Moves By The Sun Gravity (Newton is wrong) – logically because- the planet moves by its creation force- means- the planet creation and motion should be done by one force only (one energy only) because if two forces have effects on the same one planet- this planet will be broken- this fact is proved strongly with the gravitational waves source discussion (Point no.**)  

I-5 The Planets Creation

I summarize the main idea in following and the idea proves and discussions are found in point no. (**)

(i)

We know, the solar system is created from energy of one light beam its speed is 1.16 million km per second- and – the light created the space (the planets orbits) firstly and the energy is consumed in the space creation- and for that- the rest energy is found in one light beam its speed is 300000 km/s - And

From this light beam 300000 km/s the solar planets are created

Shortly

before the solar planets creation

The solar system was one light beam (or one wave moves by speed of light (300000 km/s)- by that – the solar system is One Wave moves by speed of light (300000 km/s)

Now

The Solar System needs To Create A Stationary Point Its velocity Zero relative to the moving one wave (300000 km/s)

This is the basic information in the solar system design-

The solar system needs to create a stationary point relative to the wave motion- by that – two velocities will be found which are (v1= the wave its speed 300000 km/s) and (v2= Zero= the stationary point velocity relative to the wave motion)–these two velocities produce a relative motion with different velocity 300000 km/s– this relative motion is the solar system design cornerstone.

Shortly – the solar system needs to create A Stationary Point 

Notice– The solar system is carried by the light beam motion, NO stationary point can be found here – it's similar to a ship on the sea water- Nothing can stop- because the motion is done forcedly by the sea water –

The stationary point will be similar to the whirlpool (vortex) on the sea page-  BUT

The solar system needs to create this stationary point - Now – let's try to create this stationary point in following - The solar system uses two procedures to do that,  

(ii)

The first procedure

The wave its velocity 300000 km/s revolves around a point in space (any point in space), the revolution motion creates 2 equal velocities on both sides of the revolution- the two velocities are equal in value and opposite in direction- their total be equal Zero-means- the revolution motion creates A Stationary Point in the center of the revolution. 

The second procedure

The previous idea is correct- but –the velocity 300000 km/s is a huge one and to decrease it to Zero velocity this is a complex process– for that- the wave (300000 km/s) created small waves with low velocities to use them as steps to decrease the velocity to Zero- the small waves are The Planets- (The planet is a small wave moves by low velocity relative to the original wave its velocity 300000 km/s) 

Why Are These Small Waves Required?

Because the velocity 300000 km/s is decreased to Zero by using these small waves and their low velocities- the low velocities are used as steps to decrease the unified wave velocity (300000 km/s) to be (Zero)- this process decreases the velocity gradually from 300000 km/s to Zero depending on these small waves velocities (the planets velocities)  

Means- the planets are created for this process to decrease the wave velocity from 300000 km/s to Zero- and The Planet Is A Small Wave Moves By Low Velocity 

Shortly – the solar system has one complete system of velocities, Starting from Zero to 300000 km/s where the planets velocities are the steps between the two velocities – let's prove that here

(iii)

300000 km = 7.1 x (205.8)^2 where

7.1 is Lorentz length contraction effect for speed 297000 km/s (99% of speed of light)

205.8 km/s = the 9 planets velocities total (176 km/s) + the Earth moon velocity

(The moon velocity =29.8 km/s = the Earth velocity because they revolve together)

Why does the data use the squared value (205.8)^2?

We know the answer- but - Let's remember it

The planets are geometrical points on the same light beam and move with its motion- for that- the planets velocities rates creates rates of time– for example-  Mercury velocity = 1.6 the Earth velocity- that means – one hour of Mercury clock = 1.6 hours of the Earth clock- Why??

Because Mercury and the Earth are carried by the same one light beam- the light moves one motion and passes one distance in one period of time- by that Mercury and the Earth have to move this same motion and to pass this same distance in this same period of time- but the two planets velocities are different- for that- the planets use different rates of time based on their velocities rates and by that the planets move equal distances in the same period of time –

Now- the velocity (205.8 km/s) moves relative to the stationary point (Zero) and creates a rate of time (1 second = 205.8 seconds) –

(one second of the unified wave clock = 205.8 seconds of the stationary point clock)

But – the energy is reflected in the solar system (I prove that in point no.**),

The energy reflection reflects the players – means

(one second of the stationary point clock = 205.8 seconds of the unified wave clock)

The stationary point will be THE SUN – by that

(one second of the sun clock = 205.8 seconds of the unified wave clock) – means

(one second of the sun clock = 205.8 seconds of any planet clock) –

Now during one second of the sun clock, the wave clock needs 205.8 seconds while the wave moves by a velocity 205.8 km/s- means –

During one second of the sun clock, the wave moves 42253 km = 300000 km /7.1

That creates the different velocity 300000 km/s between the sun motion and the wave motion-

Notice 1

The wave (205.8 km/s) moves during 1461 seconds a distance = 300000 km, and we know the Earth cycle (1461 days = 365 +365 +365 +366)

That tells, the speed of light (300000 km/s) is performed by the rate of time and that causes to create the Earth cycle-   

Notice 2

Planet velocity is created by the rate of time- means- if no rate of time can be used – No planet velocity can be created – instead- all motions will be only by speed of light (300000 km/s)- the planet can create a small velocity because it can use rate of time

We realize that clearly because

The planets motions depend on the light motion- by that – the motion is done by One Motor only which moves by speed of light (300000 km/s), the planets can only move by speed of light or create a rate of time for their smaller velocities - No more options are provided.  

Notice 3

We understand that, the planets are geometrical points on the same light beam, means

The planets are similar to carriages in one train and the light motion is the train engine  means the planets are carried on the light beam and move with this light motion

I-6 Can The Time Machine Be A Fact?

To answer this question we need to review basics facts we have studied – let's do that in following

(1)

The solar system is created from one energy and this energy is provided by one light beam

(2)

The light moves simply and freely in any direction (for space) and (for time)- means- the light can move into the future (as matter does) or into the past (which the matter can Not do)

(3)

We know, the solar system is created from one light beam, and this light moves by a speed (1.16 million km per second) - And

We know, the light (1.16 million km per second) created the planets orbits firstly before any planet creation and the energy is consumed in the space creation and because of the energy consumption the light speed is decreased from  (1.16 million km per second) to the known speed of light 300000 km/s – also

We know, the light (1.16 million km per second) started its motion from Mercury orbit moves toward Pluto- that means- the light (1.16 million km per second) started from Mercury orbit with speed (1.16 million km per second) and the light created all planets orbits till Pluto orbit- before any planet creation- and by that- the light lost its energy and the light beam in Pluto orbit reduced its speed to be 300000 km/s as a result for the energy consumption in the space creation process

(4)

Also we know the energy is reflected from Pluto toward Venus (the inner planets)

By that the light beam (300000 km/s) moves in the reflected direction to the original light beam (its speed 1.16 million km per second) 

And – we know-

The light beam (300000 km/s) reaches to the original point (Mercury Orbit) from which the light (1.16 million km per second)  started its motion 

And we know that

A coherence of light is done between the original light beam (1.16 million km per second) and the light beam (300000 km/s)

BUT  we don't know how such coherence can be occurred? Let's analyze that deeply in following

(5)

The produced light beam (300000 km/s) moves in (the reflected direction) to the direction of the original light beam (1.16 million km per second) (In Space)  and reaches to Mercury orbit (the origin point)

But– logically – the produced light beam (300000 km/s) can NOT find the original light beam (1.16 million km per second) there because the original light beam is consumed already in the space creation process and the rest energy is this produced light beam (300000 km/s) – based on that –

How Can This Coherence Be Occurred? Means-

How can the produced light beam (300000 km/s) meet the original light beam (1.16 million km per second)?  The answer is

The produced light beam (300000 km/s) moves (in the reflected direction) to the motion direction of the original light beam (1.16 million km per second) (In Space) and (In Time) Means- the produced light beam moves into (Its Own Past) and in the past this produced light beam (300000 km/s) was (A Part of the original light beam 1.16 million km per second) and because of that the produced light beam (300000 km/s) can meet the original light beam (1.16 million km per second),

And

The two light beams create a coherence (in the past) and we see the results of this coherence in our present time-

The idea is very important because – the coherence of the two light beams (1.16 mkm/s and 0.3 mkm/s) is proved strongly and with powerful proves and any explanation for this coherence will prove that the produced light beam (300000 km/s) must move Into The Past to enable this coherence occurrence- and that tells clearly- the travel through the time is possible and fact

BUT

Can the matter moves into its past as the light does? NO

Why?? Because

We know the light can move simply in any direction (+ x, + y, + z, + t) by that the light can move into the future and can move into the past BUT

The matter creation depends on A Motion In A Defined Direction-

let's remember this idea

Neptune diameter =49528 km because Neptune velocity is 5.4 km/s

(This Fact Is Proved By My Planet Diameter Equation)

Now, Neptune velocity is a motion in a defined direction

(for example a motion in +x direction)

The energy moves in this direction (+x direction) and because of this motion Neptune matter is created and Neptune diameter is defined- now if the energy moves in (opposite direction "–x direction") that will change Neptune diameter or cause to perish its matter at all

Means- as long as – Neptune is found- that means – the energy moves in one direction (and not two directions) – for that Neptune can move into the future but can NOT move into the past.    

Notice

The matter can not move into the past but the light can do that-

Means- we have the time machine already- we need to know how to send the light into the past and by that we can have photos from the past events- and this will be The Time Machine

The Hypothesis Proves

I-7 The Proves Logic Analysis

I-8 Planet Velocity Is A Function In A Speed = (1.16 million km /s)

I-9 Planets Orbits Are Defined By A Motion Its Speed = (1.16 million km /s)

I-10 Jupiter distances are defined by a motion by a speed = (1.16 million km /s)

I-11 The Solar System Geometrical Design Proves The Hypothesis

I-12 The Solar System Distances Analysis Prove The Hypothesis

I-13 Deep Analysis For The Planets Orbits

1-14 Light defines each planet orbital period

I-15 Can Planet Diameter Be Used As A Period Of Time?

I-16 Mercury Orbit Analysis

I-17 The Planets Data Is Created By The Light Motion Directly

I-18 Light Defines Each Planet Rotation Period

I-7 The Proves Logic Analysis

Why can we prove that, a light beam its speed 1.16 million km per second is found in the solar system? also, the theory tells this light beam energy is consumed and the rest energy is found in one light beam its speed 300000 km/s (the known speed of light), if this light energy is consumed, how can we prove its existence?

There are two major reasons, which are

The Planets Orbits Are Created Before Any Planet Creation- And These Orbits Are Created Based On One Motion- And This One Motion Is Done By A Speed 1.16 Million Km Per Second.

The Planets Matters Are Created Based On Their Orbits – means- the planet is similar to a tree and the orbit is similar to a ground and the tree is planted in the ground-

NOTICE

after the planet creation, the planet can migrate from its original orbit to any other orbit - as Mars and Pluto did and that will not cause to destroy the planet. 

Shortly-

the planet matter and data is created based on this planet orbit- the orbit is defined before any planet creation and based on the orbit the planet matter and data is created (we remember- the space is similar to the sea of water and the planet matter is similar to a whirlpool found on this sea page- that tells the whirlpool is created based on its place in the sea of water)

Shortly- The Planet Matter Is Created Depends On This Planet Orbit

The speed 1.16 million km per second is registered in the planets orbits because the orbits are created from the energy of the light beam (1.16 million km per second), and the planet matter is created from this planet orbit (energy)

Shortly

The light beam (1.16 million km per second) is the source of energy for (everything) in the solar system-

All orbits are defined by its energy, all matters are created by its energy, and all motions are done by its motion-

Can we prove this light beam is a fact? YES we can

The analysis for any data or any motion will discover this light beam because it's the source of energy for everything

Shortly

the light beam (1.16 million km per second) is The Source Energy of the solar system

The mother of all children can be discovered by analysis these children data 

A QUESTION

Can the solar system design uses a rate 1.16 and I can't understand that but wrongly consider this rate (1.16) as a speed of light 1.16 million km per second?

NO- this can't be possible – Because

The light beam (1.16 million km per second) behaves typically to the known light beam (300000 km/s) – as we will see in the data discussion

I-8 Planet Velocity Is A Function In A Speed = (1.16 million km /s)

DATA

My 5th equation (v1v2=322)- the planets velocities prove it–let's see that in following  

322 = 47.4 km/s (Mercury velocities)  x 6.8 km/s  (Uranus velocities)                    

322 = 35 km/s  (Venus velocity) x 4.7 km/s (Pluto velocity) x 2             

322 = 29.8 km/s (the Earth velocity) x 5.4 km/s (Neptune velocities) x 2      

322 = 24.1 km/s (Mars velocity) x 13.1 km/s (Jupiter velocity)               

322 = (17.9 km/s)^2 (Ceres velocity) (Max error 2%)

DATA ANALYSIS

The previous data tells the planets velocities are defined by three features

(1st Feature)

The planets velocities are complementary one another –means - each planet velocity is complementary with another planet velocity– means– The planets velocities are defined in pairs and not in single planets. 

(Notice, the inner planets orbital inclinations are defined by the rule (v1/v2), for example, Mercury orbital inclination 7 deg = Mercury velocity 47.4/ Uranus velocity 6.8 that proves the effect of the rule (v1v2=322) on the planet motion)

Ceres velocity tells the idea - Ceres is used as the main point - as a result the outer planets be complementary with the inner planets – for that the rule (v1v2=322) controls the planets velocities- that means- The planets velocities are created based on One Design- Ceres velocity is used as the main point for this design

(2nd Feature)

Why the constant is 322? because 1160000 seconds = 322 hours – means- there's speed of light = 1.16 million km /s - Shortly

Mercury (47.4 km/s) moves during 6.8 hours a distance             = 1160000 km 

Uranus (6.8 km/s) moves during 47.4 hours a distance               = 1160000 km  And

Venus (35 km/s) moves during 2 x 4.7 hours a distance             = 1160000 km 

Pluto (4.7 km/s) moves during 2 x 35 hours a distance               = 1160000 km 

Earth (29.8 km/s) moves during 2 x 5.4 hours a distance             = 1160000 km 

Neptune (5.4 km/s) moves during 2 x 29.8 hours a distance        = 1160000 km  And

Mars (24.1 km/s) moves during 13.1 hours a distance                = 1160000 km 

Jupiter (13.1 km/s) moves during 24.1 hours a distance             = 1160000 km  And

(Notice - Saturn (9.7 km/s) moves during 33.2 hours a distance = 1160000 km  - (between 33.2 and Venus velocity 35 km/s the error 5%)) (Data Max error 2%)

The Data Proves, The Planets Velocities Are Functions In The Speed 1.16 Million Km Per Second. That proves the speed (1.16 million km per second) is A Fact

(notice the planets velocities are complementary one another also based on the known speed of light 300000 km/s, the paper provides this data) 

(3rd Feature)

The planets velocities limit depend on the known speed of light 300000 km/s

Let's explain that in following

The 9 planets velocities total is 176 km/s (I add the Earth moon velocity 29.8 km/s)

The 10 planets velocities total is 205.8 km/s

300000 km = 7.1 x (205.8)^2

The speed 297000 km/s (99% speed of light) causes Lorentz length contraction effect with the rate 7.1

The velocity (205.8 km/s) moves during 205.8 seconds a distance 42253 km

Where 300000 = 7.1 x 42253 km BUT 42253 = (205.8)^2

The squared value (205.8)^2 is found because of the used rate of time

We have studied this equation in point (I-5**) -the data shows, the planets velocities are defined as parts of a complete system of velocities starts from (Zero = stationary point) and reaches to the speed of light 300000 km/s and between these two values the planets velocities are defined to support this same system- that tells- the planets velocities are defined with limit to the speed of light (300000 km/s) - The data proves the speed (1.16 million km per second) is a fact -and also the data proves the coherence is done between the light (1.16 million km per second) and the light (300000 km/s)

(CONT)

Gerges Francis Tawdrous +201022532292

Physics Department-  Physics & Mathematics  Faculty 

Peoples' Friendship university of Russia – Moscow   (2010-2013)

Curriculum Vitae                  https://www.academia.edu/s/b88b0ecb7c

E-mail                            mrwaheid@gmail.com, mrwaheid1@yahoo.com

                                      gergesgerges@yandex.ru                   

ORCID                          https://orcid.org/0000-0002-1041-7147

Facebook                        https://www.facebook.com/gergis.tawadrous

VK                                 https://vk.com/id696655587

Tumblr                           https://www.tumblr.com/blog/itsgerges 

Researcherid                   https://publons.com/researcher/3510834/gerges-tawadrous/

Google                                https://scholar.google.com/citations?user=2Y4ZdTUAAAAJ&hl=en

Livejournal                     https://gerges2022.livejournal.com/profile

Pocket                                                                     https://getpocket.com/@646g8dZ0p3aX5Ad1bsTr4d9THjA5p6a5b2fX99zd54g221E4bs76eBdtf6aJw5d0?src=navbar

PUBLICATIONS

box                                 https://app.box.com/s/47fwd0gshir636xt0i3wpso8lvvl8vnv

Academia                       https://rudn.academia.edu/GergesTawadrous

List of publications         http://vixra.org/author/gerges_francis_tawdrous

Slideshare                            https://www.slideshare.net/Gergesfrancis

[blake447]

So in case anyone's following and seen my work with dragon and koch curves, and was curious about sierpinski's triangle, it can be represented with these sequences but unfortunately the process is more irregular so we cant pull the same tricks with binary sequences, at least in any manner that is immediately obvious.

Pictured above is a process where you double each element of the sequence, and pick a number to inject smaller triangles into, then repeat the process. With a bit of practice you can draw an eularian path that forms a sierpinski triangle.

If you wanna get really fancy you can vary the edge you break into smaller triangles each iteration, though its really, really hard to do on the fly

This is one i've always wanted to write a program to generate.

[canmom]

inadequate definitions of a computer game

I'm a game dev! So I make these things called computer games. But what is it that I'm making exactly?

One simple answer is that a computer game is a string of data. That is, after all, what Steam sends you when you buy a game. The data consists of instructions, art assets, text strings, metadata etc which can be 'executed' by a suitable computer to play that game. And if you copy that data without paying the right person you're a criminal doing a crime etc etc.

But is that data the game? It can't be, because you can have completely different data that is still 'the game'. A Windows build and a Linux build of a game are probably no more similar than any two random binary strings. If you know what you're looking for you could correlate them piece by piece - that string of data represents that texture, which is present in both - but only if you know, and you decompress the data the right way etc etc. But they're the same game, because they do the same thing when you run them.

So it seems a computer game is defined by what it does rather than how it's represented on the computer. This isn't a unique property of computer games - consider how many ways you can encode a movie for example.

But which of the things it does define a given game? Computer games have a remarkable number of pieces to them, and as you soon find out when you're making one, they can all be swapped out pretty freely.

For example, a game's music is often a pretty integral part of 'the experience'. But you can easily mod a game to have different music. We don't usually consider such a modded game to be a different game entirely. Well, it's a matter of degree, it's not absolute... swap out a game's music and it's still the same game. Replace all the models, levels, etc etc as in a 'total conversion' mod and it is a 'new game'. Where we draw the line is ultimately arbitrary...

But this is pretty remarkable, I think. Most artworks in the Age of Mechanical Reproduction(TM) have a pretty fixed form. A movie is a sequence of images and sounds arranged in time, a novel is a specific string of characters. Computer games, though, are flexible things.

A computer game is assembled from lots of little elements. Each of them on their own might be more or less specific, but it's how they're put in relation to each other that gives a game its identity. You glue together these elements in the mind of the audience: play the song City Ruins (Rays of Light) and if you've played the game, it will likely conjure the image of 2B's dress, the feeling dodging the machine lifeforms, the story about the androids and their existential tragedy, all unified in this thing we call "NieR Automata". In another universe, we could imagine that some other elements were tied together in this way - another game that happened to compose the 'same song' with a different aesthetic or mechanics. But the game is beloved because all these things are considered consonant.

Computer games share this in common with film, comics, etc etc. - they're all combinations of other art forms. But computer games have this extra thing that's more or less unique to the medium, the element of direct interaction with some kind of mutable 'state' inside the computer.

At a lower level of abstraction, when you interact with a computer game, data is sent from a controller (keyboard etc) to be read by the game, which modifies some stored state in computer memory; another part of the program 'reads' that state and displays pixels on the screen. Which means there is this separation between the presentational aspect and the 'mechanics'. You look the screen and see a human running but I, the game developer, can 'know' that what's 'really' going on is that a capsule collider is moving across a plane, and we change the position and rotation value based on your input. Then, to 'draw it', another variable holds animation state, and we're sampling the animation data, and doing some IK, and deforming vertices on the GPU, and pumping it through a fragment shader and so on... but all of that graphics stuff could be swapped out and the game would still 'play the same' in the sense that the same inputs would change the game state in the same way with the 'same outcome'. There are even some games, like NetHack and Dwarf Fortress, which support many different 'frontends' which look quite different.

But which is more 'real'? We can't see the game state. We might say that given this game state we update this enum to the value we consider to mean a player has won (let's say... 0b00000010), but the only way that the player knows they've won it is if we display a corresponding message on the screen. That's the only reason we care, as well. The presentation is absolutely integral. All that internal state is just there to make sure that 'you won' and whatever other information is displayed on the screen at the right time to maintain the illusion that 'there is a game' which we're working so hard to convey.

And the state of the program is not exactly what we're trying to convey. The player is not imagining floating point values changing, let alone cpu instructions changing a binary field, or voltages in silicon; they're imagining an object in a location. 'A character jumping.' We are trying to make sure that fantasy is believable. Every layer has to work together to make this happen. Ultimately what we're creating is a rectangle of flickering lights but if we do our job well enough, and it's approached with a willingness to suspend disbelief, it will come across as something like a place inhabited by something like people...

So a game isn't any particular element of its aesthetic presentation, and it isn't the way its data changes in response to interaction. It's some kind of gestalt created from the two, only when a human interacts with the whole system, which allows them to conjure a fantasy in large part designed by another human - and have this external thing reinforce it and make it feel concrete. That's what it's my job to create. What a marvellously abstract entity...