hey this was taken from a matt rose video
lets see what animal/plant kim kardashian is
String identified:
GCATCAGTCGCATGCATGCACGATCGATCGATCAGCAGC
Closest match: Sorghum bicolor subsp. drummondii cultivar S722 chromosome 10
Common name: Sudangrass
(image source)
4K notes
·
View notes
The wikipedia article for autism
String identified: i went here and hit ctrl + a
Closest match: Carex pendula genome assembly, chromosome: 23
Common name: Pendulous sedge
(image source)
923 notes
·
View notes