Tumgik
#am organizing my navi
saintobio · 29 days
Text
SAINT’S ROYAL AUs / PERIOD PIECES.
Tumblr media
MEDIEVAL PERIOD (MIDDLE AGES).
♱ romeo + juliet, fushiguro megumi. one-shot.
tragedy, forbidden love, early modern & modern english
♱ long live the villainess, gojo satoru. series.
regression, enemies-to-lovers, modern english
RENAISSANCE ERA.
♱ as you like it, gojo satoru. one-shot.
tragedy, revenge, early modern english
BAROQUE ERA.
♱ of lovers and liars, suna rintaro. mini-series.
tragedy, polygyny, play, archaic english
ROCOCO PERIOD.
♱ tbd
REGENCY ERA.
♱ felines, gojo satoru. one-shot.
comedy, fantasy, modern english
VICTORIAN ERA.
♱ ace of spades, various. mini-series.
isekai, reverse harem, modern english
EDWARDIAN ERA.
♱ titanic, okkotsu yuuta. one-shot. (coming soon)
tragedy, strangers-to-lovers, modern english
Tumblr media
103 notes · View notes
autistme · 8 months
Text
am! shirt spotted in thrice warped 03 photos. autism blast chjarging
Tumblr media
14 notes · View notes
paging-possum · 1 month
Text
I do not think I have studied for ANYTHING this year as hard as ive studied for this radio test I dont play about possibly getting hired to take notes
1 note · View note
hellsitegenetics · 3 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: my lawyer has advised me not to answer this question
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
Tumblr media
1K notes · View notes
girlbossblackbeard · 8 months
Text
THOUGHTS AND LAYERS
i spent literally an hour analyzing this trailer at 0.5 speed. this post is long af and these thoughts are in no particular order and are poorly organized:
-there's a big storm (which I think was already confirmed), and ed gets swept overboard by a bucket on a rope:
Tumblr media
he then crawls up out of the water onto the beach
Tumblr media
then goes into the forest, creates a hut, has a journey of healing and self-discovery, meets hornigold (or his ghost??)
Tumblr media
and kills him thus killing the part of himself that he hated the most (his violence) as a parallel to stede finally getting rid of nigel's ghost by accepting and believing in himself
-in the stede/ed split screen, the stede shot is from the first ep of s2 right after stede finds the marooned crew at the end of ep 10 in s1 (you can tell bc his hair and clothes are still clean, there's no gay bandana around his neck, and that's his lil dinghy buttons is rowing)
Tumblr media
-they go to shore and wind up at the merchants shop where "susan" overhears they're tracking down blackbeard
Tumblr media
and she invites stede's crew onto her ship, cue the outfit change in the BTS photos:
Tumblr media
-the way stede makes that little swishy turn in the red coat -
Tumblr media
makes me think this may be first time he's been in fine clothes since his "death" and i hope we get a moment of him reflecting on how he gave up everything for ed only to have him hate him :( but then obviously realizing that ed is worth it and he'd do it all again in a heartbeat if it meant getting a chance at spending the rest of his life with him
-izzy and stede team up, and izzy is clearly training either himself or stede on the revenge (?)
Tumblr media
soooooo many questions: what caused him to leave ed and join stede's crew? is he fighting with ed and is training to take him out or is he just done having his love be unrequited so he leaves and just so happens to stumble into stede? is izzy thinking that if he can't cut out the longing he has for ed he has to kill him instead so the pain will go away? what, pray tell, the fuck is going on in here on this day
-wee john in the mermaid costume (and olu in a bunny or donkey costume?):
Tumblr media
a fuckery? or just a weird acid trip? OR IS IT THE TALENT SHOW THEY NEVER GOT TO HAVE??
-ed really does force everyone on his crew to wear war paint
Tumblr media Tumblr media Tumblr media Tumblr media
-all the tally marks scratched into the walls - is that the number of days since stede bonnet broke ed's heart?
Tumblr media
-ed in the forest in PEARL NECKLACE HELLOW????????
Tumblr media
-the tear in ed's eye as he moves the cake toppers closer together which he also painted to make the lady look more like him he literlaly is in love wiht stede so bad wht the FUCJ
Tumblr media Tumblr media
-ed's crew is murdering SO MANY PEOPLE at the wedding wtf (pic not included bc scary)
-delusional moment but i hope anne bonny on stede's lap is looking at calico jack off screen
Tumblr media
-stede and ed are running towards each other on the black sand beach (thank you @sluterastede for pointing this out to me wtf!!!!!!)
Tumblr media Tumblr media
which evolves my theory that ed in the forest goes through his healing journey and realizes he wants to openly love stede again but then the navy attack and stede just so happens to have found ed at the same time and they're fighting to get to each other and taking out everyone in their way (what if that was okracoke lmao)
-the swede and spanish jackie hooking up in the trailer
Tumblr media
makes me think the bts shot of ed and jackie is them looking at stede and the swede, and ed being SO in love with stede obvi but jackie is watching the swede do some weirdly hot shit so she's gotta have him (what if they got married and he became her umpteenth husband in a drunken vegas-like shotgun wedding where she wakes up the next day to realize what has happened lmao)
Tumblr media
-also this pic is DEF from the reunited/make up era bc ed's half-up hair, no makeup, soft eyes, and buttons' clothing. i am weeping
-stede in pain - is it an injury or a tattoo? or torture as @sluterastede posits?? he looks down at his lower body before screaming so maybe he knows what's about to happen to him??
Tumblr media Tumblr media
-ed in the forest wearing the pearl necklace (see above), ed saying "fuck you stede bonnet" wearing the pearl necklace (see below)
Tumblr media
does he pick it up at the wedding??? (theory credit to @sluterastede!!!! can u tell we watched the trailer together 400 times) i can't tell if he's wearing it in the one wide shot of him in that scene:
Tumblr media Tumblr media
but regardless of when he acquires it, does he take it bc he remembers stede said he wears fine things well???? and he starts to believe he may deserve them??
-side note about a LACK of something: ed isn't wearing the cravat at all in the trailer near as i can tell, and he's not wearing the pearl necklace when throwing knives at the wall (at least from what I can see, which is not much) which leads me to believe that scene is in the earlier part of the season
Tumblr media
-lastly, the most important song lyrics from the trailer (the beautiful ones by prince):
Tumblr media Tumblr media
and that's my dissertation on the ofmd season 2 teaser trailer thank you
809 notes · View notes
byunpum · 1 year
Text
AVATAR MATERLIST
Tumblr media
 ༄| A V A T A R |༄
R U L E: Any request is acceptable. Characters will always have their age increased if necessary. I accept:
Movie: Avatar 1 & 2.
Fluff | Angst | Smut | normal
I update this every time I have done a new work. If you want to support my work KO-FI
Tumblr media
Series:
Experiment 56 [neteyam x human reader]
[ Y/N characteristics and fun facts]
Summary: Y/N is surprised that she is an indispensable part of the human race, being a perfect blend of Navi and humans. Her family will do everything possible to keep her hidden and safe.
Experiment 56 SEQUEL “your time is coming” [neteyam x human reader] *paused*
PART 1 | PART 2 | PART 3 | PART 4 | PART 5
Summary: Y/N thinks she has a peaceful life with her new family. But a sudden visitor is about to change her life and her family’s life.
The New member [ Quaritch x human reader]
Part 1 | Part 2 | Part 3 | Part 4 | Part 5 | Part 6 final
Summary: After the boat altercation with the sullys, and being able to make spider return with him to the base. General ardmore has a big surprise for quaritch. A new member will join her squad, this new person will not only change the RDA, but himself.
Do you hate me? [Tsu-tey x Human reader]
Part 1 | Part 2 | Part 3 | Part 4 final
Summary: You are the eldest Sully daughter, you are adopted. All your life you have grown up watching tsu'tey, and your feelings for him have grown. Everything changes when one day you go hunting with your crush.
I can be a better father {Tsu-tey x Child Y/N x Child spider]
Part 1 | Part 2 | Part 3 | Part 4 | Part 5 | Part 6
Summary: Follow tsu'tey in his new life as a single father of two human children. A compilation of moments and adventures of their lives.
Ghost girl [Neteyam x Albino na'vi!fem x sully family]
Part 1 | Part 2 | Part 3 | Part 4 | Part 5(final)
Summary: After their village was destroyed by humans, Y/N must seek refuge in the forest. Her being rescued by a peculiar family, she discovering that her gift had led her to them.
Mama's Boy [Jake x neytiri x human reader (trio couple) x sully children's x Lo'ak son]
Part 1 | Part 2 | Part 3 | Part 4 | Part 5 | Part 6 (final)
Summary: Lo'ak is his mother's favorite child. After leaving the clan, and now living in clan metkayina. His only wish is that his mother is by his side again. The only problem is that his mother is a… human.
Tumblr media
One-shots:
1. They caught us [neteyam x human reader] SMUT
Part 1 |Part 2  |Part 3 | Part 4
2. Little gifs [ Tsu'tey x human reader] 
Part 1 | Part 2
3. The family’s Clothing [ Lo'ak x human reader]
4. Picnic in the greenhouse [Neteyam x Lo'ak x human reader] SMUT
5. A shy Y/N who doesn’t really show affection to neteyam. [Neteyam x human reader]
6. Loak and the reader take care of tuk. [Loak x Human or navi reader]
7. Reader fight with your brother loak, because he give tsireya your stuff. [Loak x human sister]
8. Neteyam does everything possible to help the sadness that Y/N feels.
9. Kiri and Y/N being twins, but Y/N has a curiosity about people in the sky.
10. Lo'ak x human/na'vi hybrid, Lo'ak lets his imagination fly.
11. Neteyam is obsessed with your chubby lover.
12. I am very sorry (Jake sully x Human daugther)
13. Use me [Neteyam x Human reader] (Smut)
14. Z-DOG she has something going on, and she doesn't know what it could be. Y/N may be able to help her.
15. Tsu'tey asks eywa for a perfect mate, eywa sends him a surprise.
16. Jealousy, damn jealousy (Neteyam x lo'ak x Human-mix reader)
17. Ao'nung save the reader from idiots (ao'nung x human reader-kiri twin)
18. Reader defending lo'ak from his father (lo'ak x human reader)
19. Quiet [Neteyam x Human-mix] (Smut)
20. Child human-reader is lost in the forest and some curious boys find her.
21. Tsa·zìskrrmipaw (Neytiri meeting us for the first time when we were newborn) Part 1 | Part 2
22. Hifwo (Neteyam x human reader)
Tumblr media
Auntie Y/N sully series:
( The parts are organized, so that you can understand better)
1. Y/N being the best aunt
2.My lost child [ Aunt sully reader x Spider](Mother and son)
Part 1 | Part 2 | Part 3
3. More moments in the life of AUNT sully.
4. Aunt Y/N's nephews are jealous of her new mate and they do everything they can to keep them apart.
5.AUNT Y/N SULLY BEING THE ‘COOL ONE’ IN THE FAMILY.
6. AUNT Y/N SULLY BEING THE ‘COOL ONE’ IN THE FAMILY Pt.2
7. Auntie Sully: New tails, new family
8. Auntie Sully: New tails, new family (part 2)
Others moments:
1. Aunt Y/N has to say goodbye to her family.
2.Tuk and kiri find an object and run to ask their aunt Y/N.
3. Jake discovers that several Na'vi tried to court his sister.
4. Neytiri reaction will be when she found out Jake and Auntie Sully are actually triplets
5. How the sully family, more neytiri. React to aunt Y/N and jake share more moments being twins.
6. Auntie sully giving everyone pizza for the first time
Tumblr media
Headcanons:
1. Neteyam being a baby daddy ft. sully family and quaritch {Neteyam x Human reader}
2. Aonung wants you to be his partner, but he is afraid you will reject him. {Aounug x human reader}
3. where y/n is trying to show off to the boys and fails miserably.
4. Loak being a good brother. 
5. Kiri with her twin sister
6. Lo'ak in love with Y/N. Literally obsessed.
7. THE BEST FATHER I COULD BE [Lo'ak x human reader]
8. Rivals for lovers with Lo'ak
9. Jake and Y/N knew sign language and they both used it to just talk shit
10. React to a chubby reader [Neytiri, neteyam, lo'ak and jake]
11. Recoms being softies for thier medic Human-reader
12. Jake and neytiri holding the human reader like a teddy bear
13. Neteyam, Jake and Lo'ak how would they react if their partner playfully bites them
14. Your brothers and you (reader) react when you see a boy courting Tuk.
2K notes · View notes
epiclamer · 10 months
Note
hii if you are taking requests,, a confident detective x mute/(semimute) villain,, like if they’re interrogating and villains likes 🙃
directions it takes up to you..
- if you don’t still know that am appreciating your writing a lot !! :D
Awwww, this could be... cute?
Tumblr media
Language Barrier
Detective placed their neatly organized files onto the interrogation table with a dull 'thwap'. Pulling a chair out and seating themselves, Villain compared them idly to their files. Both of them dressed in a dark navy blue, with white--maybe beige--underneath.
"Villain, you are being detained under investigative motive for the murder of... Civilian." The detectives' eyes flicked from fixing their cufflinks to the criminal. "Is that correct?"
The villain couldn't help their smirk, but their demeanour didn't change otherwise. They noticed the cursive handwriting on the folder matched the detective's name tag, careful and tidy, just like every other aspect of them.
Upon the stretching silence the detective sighed, pulling their folder close before opening its pages to the villain's keen eyes. Villain found it almost intimate, but they often read into things too much. It was awfully easy when one was constantly stuck in their own head, mulling things over again and again.
Smoothly, the detective slid a large printed photo towards the villain, facing it towards them as they spoke. "This is you, correct?" The image was blurry, taken from a security camera Villain figured. "On the night of the fifth?"
The one in question didn't even bother to open their mouth nor communicate. Truthfully, the one in the footage was them, but purely by incident of 'right place, wrong time'. They had left by the backdoor only minutes later after realizing their error... The backdoor that had no camera to prove it.
This was going to be a shit-show no matter how they decided to deal with it, they may as well have a little fun.
"A simple yes or no will do the trick." The detective deadpanned, expression falling flat as they were losing their patience.
Villain grinned, shrugging as they leaned back in their seat; they were beginning to grow fond of this detective.
The detective made a face, somewhat mocking, somewhat annoyance, before they retrieved the image and shuffled through what seemed to be the next part of their discoveries. "You know your rights?" Holding a text document in hand they looked back up to the villain. "Or you just like being a pain in my ass?" They frowned, putting the document back as they continued their search.
Evidently, the villain said nothing. Tapping their fingers against their lap in boredom as they waited for the other to find what they needed to 'crack' the villain.
"Aha!" The detective blurted, jumping just a little bit off their seat due to their uncontrolled excitement.
Cute.
Villain would definitely have to come back sometime later, or break into their apartment. Either one would do.
Before the villain could blink a paper was shoved into their face. It was an image of text messages, ones off their personal phone which they had kept as private as possible. Apparently not to the detective.
"Proof. That you were the last person in contact with the victim and your conversation is practically a confession." The detective waved their arms around a little while the villain studied the messages, sure they were off their personal phone, but they weren't theirs. They didn't even know the victim, let alone have text arguments with them.
The criminal's mouth hung open, reading over and over the words in bubbles across the paper. Triple checking the number at the top to make sure it wasn't theirs...
Seven-Nine-One Three-Two-Nine Five-Five-Eight-Seven
It was theirs alright.
"Got ya." The detective peered over the print, a smug smile on their moisturized face, giving it a sheen and a soft smell of coconuts. With two hands on the table they leaned forwards even more. "Still speechless? Or have you got something to say now that you've been caught?"
Villain lowered the image back to the table, noses practically touching between the two of them when there was no barrier left. Deftly they swiped the prestigious looking pen from the detective's pocket, flipping the text picture over onto its face as they began to write, ignoring the yelp from the other.
'For someone as thorough as yourself, you still managed to miss the most important detail in your case.'
After twenty-four hours had passed the villain had been released due to insufficient evidence. With the detective unable to get them to 'talk' and the villain refusing to elaborate further, the officers had no choice.
Two days later, when the villain couldn't help themselves anymore, they were one foot through the window of the detectives' house when their eyes caught on the silhouette in the corner. Hunched over a book, mumbling incoherently to themselves and squinting against the light of their computer screen, Villain's heart pounded in their ears when they realized the detective was learning sign language.
506 notes · View notes
acescavern · 7 months
Text
END TO START - LEE TAEYONG X READER
Tumblr media
Navi - M.list
Pairing: Soulmate!Johnny x Soulmate! reader, Taeyong x reader. ( Ft Mark, Jungwoo, Ten, Jaehyun, Taeil, Yuta. Mentions Jaemin once.)
Genre: Heavy angst my guys, soulmates au, neo frat au, university au, fluff, Hanahaki Soulmate trope.
Synopsis: Taeyong had been perfectly happy to sit back and watch you and Johnny be together. However, when he starts to notice certain behaviors that are all too familiar, he finds himself unable to watch you slowly die. Just because Johnny may not love you anymore... doesn't mean Taeyong doesn't love you either.
wc: 4.9k
Warnings: Heavy angst, Blood, Mentions of death, suffering, choking, johnny is unfaithful, it's a Hanahaki au so they basically cough up dead and thorned flowers. It's not a graphic description but there are descriptions of pain too, mentions of weight loss due to being unwell, Unrequited love, hurt, Taeyong's been in love with the reader since before her and Johnny got together, heavy rejection, soulmate rejection ( Just because i have written this does NOT mean that i think any one of the nct members would cheat or act thi way. this is pure FICTION.) Please let me know if i have missed any warnings
Note: Hi! I have a few fics in the works but I'm worried I wont get them done for Halloween. So, I am blessing you with this heart-breaking fic. I wanted to release this fic early as a thank you for all your love on Operation Rizz! Now, this is the same frat universe as all my other NCT fics. they can all be read as stand alone though, so don't worry! Any feedback is once again appreciated. I do not own the concept of Hanahaki.
Likes and reblogs are appreciated
Tumblr media
Soulmates were supposed to be someone's everything—the one person who was meant specifically for them. Someone you can lean on and cherish, who would dote and adore you. Someone to dish out as much love to you as you unto them. To stay by your side and grow old together. However, some people are already at that stage when they meet their destined person. There was also the worry of some people not having a soulmate. Legend says that only the blessed are gifted with such. 
Gifted? Yes. To many, the Soulmate system is a curse - depending on what type you are assigned to. Tattoos? Easy. Mind reading? Okay a little more difficult. Red string? That practically takes you straight to them.  Eternal life? Near impossible! You could spend many years with someone you thought was a soulmate only to see a wrinkle and realize you aren’t made for each other at all. Seeing things in black and white only to suddenly be overwhelmed with color at a music festival and not know who the hell you’d bumped into in that massive crowd that could possibly be your soulmate. Not everyone even had a soulmate, they could be with whoever they wanted without consequences. 
But there was one type in particular that nobody wanted. Hanahaki. Named after the fictional Japanese Hanahaki Disease. It comes from the Japanese words Hana - meaning flower and Hakimasu - quite literally meaning, to throw up. 
In a soulmate's case, when they first meet each other a seed is awakened. It grows thorned roses - the flowers of love - cradling the person’s heart and twining around inside their lungs. For the most part, other than the occasional flutter and heartburn, it goes unnoticeable. So long as the soulmate reciprocates the feelings of love. But, should one soulmate start to fall out of love? The other will suffer terribly. The flowers will die, the spikey stems squeezing at the organs they were once gently caressing with love. Crushing in their anguish.
Of course, unlike the other soulmate types, there are two ways out of Hanahaki... Let the weight of the unreciprocated love drag on painfully until you die, or convince your health insurance to accept the cost of the operation to remove the offending plants. However, by the time one realizes they are soulmates, it is likely that the bond has already been unreciprocated. 
Taeyong knew this. He knew this because it happened to him. He had once been on the receiving end of the agonizing scratch of dead rose stems climbing up his throat in a mess of blood and wilted petals. Taeyong had nearly died. He recognized the signs clearly and that was the reason he was so shocked to see them in who he did. 
Johnny’s soulmate.
Tumblr media
Taeyong first took notice when you walked through the door of the club. A celebration night to celebrate the frat’s anniversary alongside Taeyong’s new choreographer position in the dance studio he works in. Your face had a slightly paler tone and although you were doing a good job at keeping your breathing even… Taeyong recognized the telltale signs of a wince when you took the air in too harshly. 
But when he saw Johnny approach you and press a loving kiss to your forehead, he scolded himself for thinking such things. Taeyong knew something was up though, your smile didn’t meet your eyes and when you congratulated him with a hug, he swore he could feel your body tremble. 
He tried not to worry too much throughout the night but when he saw Johnny by the bar, his charming smile dazzled at some sorority girls that had been invited… Taeyong wondered where you’d gone. The disappointment within him only grew when he watched his best friend and frat brother go home with one of them. 
So, maybe his suspicions were correct. A few weeks passed and he’d not seen a glimpse of you, Johnny hadn’t even uttered your name. The rapper hadn’t had time to sit him down and ask him about the incident. Until now. 
Taeyong dabbed the sweat from his brow with the neckline of his shirt, swiping his water bottle from the floor. He shuffled toward his friend, watching as he grinned at his phone as he typed. He was talking to someone and Taeyong only hoped it was you. That you’d both mended things to stop it getting worse. The thought of it all being a misunderstanding had a relieved smile spreading across his face as he settled on the floor next to Johnny. 
“You texting ____? Tell her I said Hey.” Taeyong said, twisting the cap off his drink to take a swig. Taeyong was almost taken aback at the irritated flash that crossed Johnny’s expression at the mention of your name. 
If Taeyong wasn’t so observant, he would have missed it. Johnny shook his head, swiftly locking his phone when his leader went to peer over his shoulder. “It’s not. It’s Yuki.” 
Taeyong’s eyebrows scrunched, posture freezing for a moment. “The sorority girl you went home with?” He tried to keep his tone level. Memories of the same thing happening to himself reoccur in his mind. “What about ____?” The question hung awkwardly in the air, Johnny staring at Taeyong as if he’d asked something ridiculous. 
“What about her?” He shrugged. “Just because I do stupid things, doesn't mean I don’t love her. She’s my soulmate.” He paused, an almost defeated sigh sagging at his shoulders. “The only one I got.” 
Taeyong took notice of the slight bitterness in his words. Almost as if he didn’t realize that he did it. “Do you?” 
Johnny rubbed at the back of his neck, his mouth opening but no words coming out. Once again, a defeated shrug of his shoulders. “Yeah… yes.” He cleared his throat as his voice broke. “I’m sure we’d of noticed by now if I hadn’t.”  Johnny left no room for debate, standing up with a clap of his hands to suggest they continue their lacrosse practice.
Tumblr media
You knew. You knew Johnny’s feelings for you were dwindling. You were reminded every time you coughed. Reminded by the way your breath left you in an agonizing squeeze when Johnny would kiss your forehead.  
But, even though you knew… it didn’t make you love him any less. You knew what he got up to when your nights weren't spent together. You didn’t do a thing, didn’t bring it up. You almost tried to ignore it. You loved Johnny. You always would. And, as long as you continued to love him, he wouldn’t have the same fate as you. You would never wish this pain on him even if he was the cause. 
You wished you’d heeded Mark’s seemingly lighthearted warning at the beginning of your relationship. ‘He’s one of my closest friends but he doesn’t always do the right thing, just… please be careful.’ Mark had said one evening. You hadn’t truly understood why he had said it, nor did you get to question him before Johnny had slid his arm around your middle. 
You understood perfectly now. Especially as a sharp tickle wheezed in the back of your throat, your eyes discreetly scanning the new text message from your seat at the very back row of English lit class. ‘Can we rain check date night again? Coach is being a hardass and wants us to stay late.’ For the third week running, the same excuse. Sure, you’d seen Johnny. But Thursday was always date night. Something you’d both stuck to like glue once before. 
Pain twisted in your chest, your breath rough. You brought the sleeve of your hoodie to your mouth, attempting a discreet cough. It didn’t do anything for you, the feeling like you’d swallowed razorblades. The world felt like it was spinning for a moment and you had to close your eyes and count to ten to steady it again. 
One look at your sleeve had you frowning. The next stage had started. You’d read about this. Discoloured petals. You’d only coughed up one but one was enough for you to be sure. With one last attempt at clearing your throat, you brushed the blackened petal to the ground. 
Taeyong shared this class with you. Whilst he didn’t often sit next to you, he was mostly always on the same row. Not many people occupied the back row and so, when he heard the muffled hack come from your direction he had looked over, shoulders tensing as he watched you. 
He approached you at the end of class, watching your sluggish movements as you shoved your laptop back into your bag. “____, Are you alright?” He asked softly, noting the sheen of sickly sweat coasting your forehead. 
Lips pressed firmly together, you nodded. You were certain if you opened your mouth you'd start coughing and choking again but you didn’t want to be rude. “I’m fine.” Bad idea. “Sorry, Yong, I gotta go-” Taeyong had never heard your voice so scratchy and coarse. He had also never seen you flee so quickly before he could even open his mouth, your notepad falling from your unzipped bag as you vanished before his eyes. 
As he knelt down to collect it from the ground, his fingers made contact with a velvety, withered texture. 
A blackened rose petal. 
Tumblr media
 The next time Taeyong saw you, you were much worse than he could have imagined. He had only turned up at your apartment because he assumed Johnny had left his phone at your place. He couldn’t really understand the rushed words of ‘Shit! I left my phone at her place, I’m already late!’ When Taeyong offered to go and get it, he naturally thought of your place. 
So when you answered the door, he was standing frozen at the sight of you. Your eyes had bags under them that would put JFK airport to shame. Your complexion was grey, lips cracked and dry. Taeyong could definitely see you’d lost some weight too, your knitted sweater nearly slipping off one shoulder. His gaze caught onto the marks along your neck, long red streaks almost looking like you had been clawing at it in your agony. Your winced call of his name kicked his brain into gear. 
“Now isn’t a good ti-” His hands flew out to rub and pat your back as your words were interrupted. 
Taeyong’s heart broke as he watched you struggle. You couldn’t get your breath, your face turning red from the strenuosity. Taeyong backed you into your apartment, kicking the door closed behind him. He sat you on your couch, disappearing from view for a moment.
You didn’t even take note of what exactly was being thrust under your nose, only that it would catch what your body rejected. One of his hands held the bucket, the other sweeping your hair away from your face. It was all too familiar for him. Except for Taeyong, he had done it alone. 
“It’s okay, ____” He hushed, palm flattened over your back to rub comforting circles. “Breath through your nose and count to ten. It helps.” 
You did as such, shoulders relaxing as the air finally seeped into your lungs. You wiped your mouth with the back of your hand, sighing at the crimson residue that was becoming all too familiar. You opened your mouth to speak, only to be gently hushed once more. 
“It’s okay, it’ll hurt too much if you talk.” He set the bucket down on the side table. “You should get yourself some grapeseed oil. A teaspoon a day should at least prevent the attacks so often.” Taeyong didn’t look at you as he spoke, his hands busying themselves with opening the small drawer to your coffee table in search of tissues. 
“You mean this?” You rasped, pulling the small droplet bottle from your pocket, and setting it down on the surface before you. Taeyong’s eyebrows creased. 
It was the exact same bottle he was sure he had. Though, catching sight of the label on the bottle he knew it was his bottle. ‘Taeyong’  scribbled messily on the labeled sticker. He looked at you expectantly. 
“Johnny gave it to me.” Just uttering his name sent a pang of hurt through you, a wave of emotion rippling from your jaw to the tips of your toes. 
Taeyong understood immediately, a deep sigh resonating as he nodded once. “He knows then.” To which you nodded, eyes fixed on your lap. 
He had never seen you cry, and he would hate to admit it but your eyes looked pretty when you did. It was as if the glaze of tears enhanced the colors of your iris. “He doesn’t know it’s this bad. He thinks the tickle has just started.” 
“____, you’re dying and you’re telling me Johnny hasn’t noticed yet?” To say that Taeyong was in disbelief was an understatement. The new knowledge that Johnny knew now had floored him. 
Why? Because Johnny hadn’t once let it show. Taeyong had been around the guy all week and he was still the happy comedic genius he always was. Not a hint of anything bothering him. 
“Yong, It’s okay. I..” You drew your knees up to your chest, patting the spot next to you for him. “I’ve come to terms with it.” 
“Come to terms with it?!” He spluttered. “____, you are in your twenties! You can’t be okay with dying in your twenties.” His hand raked through his hair, eyes blinking rapidly like he couldn't come to terms with how calm you looked right now. 
Taeyong could feel the anger bubbling up in his chest, his gaze hardening as he addressed you once more. “You know he’s been seeing her too, don’t you?”
You were silent, shame eating at your subconscious. “If I ignore it then he won’t have to be like this too.” 
Taeyong sprung up to his feet. “Wake up! He’s out there living his life with no regrets and you’re the one to suffer? I can’t…” He shook his head, shoving his clenched fists into his pockets. “I’m sorry, I just-” With one last shake of his head, Taeyong left you there. The slam of your front door announcing his absence.
Tumblr media
Johnny remembered the conversation between the two of you very clearly. He was convinced he still loved you a lot. Just not in the way you need. At first, he thought it was doubt, but as time went on he started to notice the dry tickly cough and the abundance of petals scattered in your trash. He was sure it wasn’t harmful yet, certain that he still held the love in his heart for you. 
Johnny didn’t love Yuki. She was fun. She was different. She wasn’t you. He could spend time with her without any strings attached. It was freeing, knowing he wasn't destined to be with her no matter what. 
He felt guilt at first. He didn’t like lying to you, but it was for his own selfish gain that he did. Johnny had seen Taeyong go through the pain and near death of a soulmate falling out of love, he didn’t want that for himself. Johnny had too much to live for, as arrogant and self-centred as that sounded. 
 He remembered what you said when he gave you the vial of grapeseed oil, how your shaky hands had placed over his own. How you told him it was okay, it wasn’t his fault. But Johnny couldn’t help but think it was. Johnny tried so hard to make himself love you still. Your words of comfort swirled in his mind and kept him up at night. ‘Nobody can help who they do and don’t love. Feelings change, People don’t’ You’d said to him.
Johnny felt ashamed. Being unfaithful to you whilst you still loved him with every ounce of your soul. Deep down, Johnny knew you only had two options he just hoped you made a decision before it was too late. 
Tumblr media
Taeyong had been seen by barely anyone all week. It was as if he was attending his classes and then picking up every extra shift or odd job imaginable. The Neos were even more shocked when Mark slapped a flier down on the dining table ping pong table in front of some of the brothers. A for sale flier, advertising their frat leader’s motorcycle. The very same one that he cherished and spent a fortune to modify. 
“Do you think he’s in debt?” Jungwoo frowned, setting his beer on the table. 
That question alone earned a chortled laugh. “Woo, we’re in university. We’re all in debt.” Yuta clapped him on the back. “But, on a serious note, He’s been acting super weird lately.” 
Everyone launched into debate, trying to determine why Taeyong would be selling his pride and joy so suddenly. Conversation ceased when the front door opened and the man in question shuffled into the open-plan living space with an exhausted wave. 
“Ty, are you actually selling the bandit?” The question came from Taeil, Neo frat’s oldest member. 
Taeyong moved through the living area, taking a seat at one of the beanbags littered around the table. “Already sold it.” He bobbed his head in a nod. 
It earned him many concerned looks. “Are you in trouble or something? Are you trying to cover the water bill from when Mark broke the faucet?” 
“No, Jae. I’m not in trouble. It’s not for me.”  He reassured, his voice dying down quietly. “It’s for ____.” 
Everyone stopped. Mark locked his phone, Yuta stopped chipping at his nail polish, and Taeil nearly spat out his beer. Jaehyun and Jungwoo were already staring at him. 
“Why?”
Taeyong took a deep breath, anticipating the question.It didn’t take long for him to catch them up to speed.  “You haven’t noticed? I can’t watch her die. Even if she’s come to terms with it.” 
“She’s not been to class for a few weeks. Professor Choi just straight-up skips over her name now. I’m guessing they know.” Jaehyun hummed. 
“Hm, Jaemin said he saw her last week on his midnight ramen run.” Mark recalled, “Said she looked like something out of living dead.” 
“Mark,” Taeyong gave him a warning look. The younger just shrugged his shoulders. “I’m going to book the operation for her. She doesn’t know. I just need the deposit. After that, it’s monthly payments. I can scrape enough together for the monthly just fine.” He looked pained. “Whenever I see her, it’s like I’m watching myself go through it again.” 
One by one, Jaehyun, Mark, Jungwoo, Yuta, and Taeil offered their help. 
Tumblr media
The six of them didn’t make it known what their plans were but soon enough, after Taeyong had put what he had already saved with what the others offered, it was enough. He rocked up to the private medical center, cash in an envelope that was tucked neatly within the inside pocket of his jacket. 
Taeyong was pleasantly surprised that he was allowed to schedule and pay the deposit on your behalf. Acting on best interest. The receptionist did stress that you needed to fill in the form and sign consent upon arrival but Taeyong was more pleased that he was giving you a chance at life. That there was a possibility that you could carry on.
What he didn’t expect, was your immediate refusal when he brought the leaflet and forms over to your apartment the following morning. The smile dropped from his face as you tried to hide away from him.  ‘He could die.’ You’d cried at him. And whilst it had been proven he wouldn't, you were convinced. 
“He won’t, ____.” Taeyong begged. “Please, you can’t just accept this.” The bed dipped as he sat on the edge. The many times he had visited you now, you had always been. The last time you got up to open the door, Taeyong honestly worried that you would pass away right there on the doorstep. He took your spare key after that. 
Taeyong’s gentle fingers lifted the damp wash cloth from the bowl at your bedside, running the cool material over your brow and cheeks. A light smile twitched at the corner of your lips, the sensation easing your fever, only a little but it was better than before. He knew he wasn’t going to get many more words from you this evening. You’d exhausted yourself already for the evening. Taeyong was just content enough to sit here and care for you. 
Honestly, before it was known that you were Johnny’s soulmate, Taeyong had hoped you’d notice him. He had often found himself wishing that it wouldn’t last so he could at least have a shot with you. His hopes were crushed when Johnny had run through the fraternity declaring you were both soulmates. Taeyong had made peace with the idea that maybe he was meant to be alone, satisfied just by seeing you whenever Johnny brought you over to hang out. 
He never wished for this, though. 
Tenderest of touches brushed your hair away from where it had clung to your forehead. Taeyong clicking on the standing fan in an attempt to offer you some cool relief. “Trust me, ____.” He whispered, voice brittle. “I went through this.” His confession had your right eye cracking open. 
“Back in the first year,” Taeyong recalled. “Watching you and Johnny go through this… it’s like a mirror. I nearly died,” He picked up your hand, engulfing it in both of his own. “I refused the operation until it was nearly too late. For the same reason, actually.” 
Your fingers twitched in his own, your index finger hooking around his thumb to offer comfort. You have suspected Taeyong had some close experience with this. Especially in the way he always seemed to understand your pain, the sad gazes, and his drive to help you. You had never expected that he would be the one in your position though. The meer thought had tears welling up in your eyes. You seemed to cry a lot around the man these days. 
“He didn’t die though. Apparently, he just… coughed up the root.” He lifted your hand, the ghosting feeling of his lips against your knuckles. “I promise you, Johnny won’t die… At least think about it.” To which you nodded in agreement. 
Taeyong made you soup, your favorite kind. You weren’t even sure how he knew it was your favorite but he did. He parted from you with a lingering kiss to your hairline. Just like every night. This form of unrequited love seemed to of hurt him more than his last. 
He’d left the forms and leaflets on the empty bed space by your feet.
Tumblr media
You’d asked Taeyong not to come over for the last four days. As worried as he was, he had to respect your wishes. You didn’t want him to see your sudden decline as you entered the last stage of the rejection. Meaning, that Johnny had almost fallen completely out of love with you now. 
You were expecting it, Taeyong too. You and Johnny had broken things off the last time you saw each other. Both of you doing so without even having to clarify the matter. He was free. Almost. 
Taeyong had been stressed all week, even his frat brothers had given him a wide berth. Many put it down to the lacrosse game the pending evening. Only a select few really knew that it was because today was the same day Taeyong had scheduled for your surgery. 
He hadn’t known it was the same day as the game, Jungwoo uttering the words with caution the day before. Taeyong swore to himself that he thought he booked it for next week. He didn’t even know if you were going to accept it… Any time he brought it up you tended to change the subject. 
How Taeyong managed to even pass the ball with steady swings amazed even himself, his hands hadn’t stopped shaking. He had nearly skipped the game in favor of being with you, but he knew he couldn’t.  The game had gone smoothly, they were winning by one. In fact, Johnny had to take the penalty shot. 
The whole field waited on bated breath, all eyes on Johnny as he just stood there, his expression morphed in such a way that Taeyong exchanged a look with Jaehyun.
“Seo! Take the damn shot already!” The coach didn’t even get through his ending word before Johnny’s form curled over, knees slamming into the ground. 
Taeyong rushed over as his friend tore off his helmet and spat his mouthguard to the ground. He would worry about that later. Taeyong slid to his knees beside Johnny, his own helmet crashing to the ground out of his grip. 
Johnny had never felt such pain. His airways were burning. The sensation in his chest felt like all the oxygen was being torn from him. The team crowded around him, blocking anyone else's view of the scene.  A choked cough left his throat, a shout of agony following after. Petals. Blood. Stems.  The flower was unwinding itself, pulling at the roots from within his chest and lungs. 
The team managed to maneuver Johnny back to the locker rooms, it took four of them to carry him but soon the male was slumped against the tiles of the showers. Taeyong was beside him once again. “Cough it up Johnny, you’ll do more damage if you don’t.” He tugged Johnny’s arm to sit him forward, his fist thumping down in the center of his back. “Johnny, come on!” 
To say Taeyong was relieved when Johnny finally started coughing again was an understatement. “You gotta carry it on, it’ll hurt but I’ve got you.” He pleaded over the sound of his friend’s cries and chokes. 
Johnny doesn’t know how long he continuously coughed for. All he knew was the last one to shake through his body finally offered him release, Taeyong tugging him away from the mangled mix of plant and blood only to rip him, Johnny, from his shock-induced state by shoving him under the freezing cold shower stream - kit and all. 
A big, clear breath left him. 
“What the fuck, John?” Ten peaked his head around the corner, having raced in after the team to check on his best friend. 
“Dude, that's your flower.” Mark grimaced, crouched down next to the offending object. 
The announcement made Johnny’s spine straighten, and Taeyong hung his head. “What does it mean?” Johnny shakily stood, pressing the button to stop the stream of cold water. 
It was fascinating how Johnny already felt better. He felt no pull in his chest, no weakness even after the whole ordeal. He felt new. But if he felt like this… then what had happened to you? The realization of what had happened weighed heavy on his guilt. 
He turned to address the sort of traumatized, faces around him but it wasn’t him that spoke up. It was Taeyong. “It means I need to find ____.” 
Tumblr media
Taeyong had raced past his teammates and into the locker room without any further explanation. His phone cramped between his ear and shoulder as he tugged on his sweats at record speed. “C’mon, Petal. Pick up.” He swore to himself, only removing the device from his ear to throw on a t-shirt from his locker. It was a term of endearment he had taken to calling you of late, though quite often when you were too dazed to notice. 
He ignored the looks of confusion from his friends. Well, from those other than Mark and Jaehyun. From the look on Johnny’s face, he was still piecing things together. Taeyong didn’t have time for that, snatching the keys for the beat-up Honda he had gotten recently and sprinting from the room. 
Taeyong continued to call you on the way to your apartment. He had just hoped you’d gotten yourself to the appointment. He didn’t want to think about the possibility of losing you like this. He found himself afraid to enter your building, scared of what he may find. His head thumped against the steering wheel, eyes burning with unshed tears. You had to be okay. 
His phone buzzed, body jumped when he saw your name flash on the screen. He swiped to answer, bringing it up to his ear with a relieved sigh. “____.” He listened to your breathing for a split second, registering the steady beeps in the background. 
“Is he alive?” Your tone was filled with urgency but your voice was clearer than Taeyong had heard in weeks. It had a relieved laugh bubbling from his chest, salty droplets cascading down his cheeks and leaving his tear ducts with the tension in him. 
“He’s fine.” He sniffled, rubbing at his face. “ Petal, you’re okay. I tho-” You interrupted him with a soothing call of his name. 
“You were right.” He listened to you pause, the sounds of you sipping through a straw present in the receiver. “There are things I do have to live for.” You spoke quietly. “The first one being myself.” 
He hummed in agreement, starting up the car again. “Yeah? I’ll be there soon and you can tell me all about the second, Petal.” He was rewarded with a breathy laugh. “What?”
“Petal.” You murmured, Taeyong could hear the slumber lingering back into your tone. 
“Get some rest. I’ll be there soon.” He was about to pull the phone away from his ear when you quietly called his name again. 
“Yes?” He hummed, clicking the hands-free and setting the phone into the holder on the dash. 
“Can I tell you my second reason?” 
“What’s that, Petal?” He smiled softly to himself. 
“It’s you.”
Tumblr media
©Acescavern - I do not give permission for my works to be copied, translated or reposted
231 notes · View notes
byuljoonie · 7 months
Text
Never Goodbye // myg
Tumblr media Tumblr media
It’s never goodbye, I’ll always see you again…
pairing: yoongi x reader
genre: one shot, angst, fluff, quick smut, rash decisions
word count: 3k
warnings: mentions of mental health, mentions of past SH/scars, sad-ish smut, d-day tour, swearing, almost oral (m4f), dom!suga sub!reader, unsafe sẽx, creampie, fluff if you hate fluff.
note: My depression has been hitting so hard lately. I will re-edit tomorrow, I’m exhausted and can’t double check tonight. I love Min Yoongi, I will backflip for him. In all honesty, when Yoongi did his first live since being gone for a while, I ugly sobbed over my iPad. I missed him so much and the thought of him leaving shook me to my core lmao. Though I’m overdramatic, I am a proud military wife for 3 so far of 7 husbands. Enjoy the one shot and feel free to submit requests to the link in my bio, and listen to some of my playlists also in the bio. I will post Ramo Buchón and this story on Ao3 next week. -dubu
Tumblr media
I stood in the dimly lit record store, surrounded by rows upon rows of vinyl records, each a portal to a different musical era. I held in my hand the debit card my thoughtful boyfriend, Yoongi, had given me to use this afternoon. He had gifted me a beautiful scarlet record player, and now I was on a mission to fill it with music.
The store was a treasure trove of musical history. Rows of records stretched out in every direction, organized meticulously by genre and artist. I traced my fingers along the spines, feeling the nostalgia emanating from each one. Rock, jazz, classical, pop – it was all there, waiting to be explored.
My indecisiveness was palpable as I contemplated my choices. I would pick up one vinyl, then another, carefully examining the album artwork and reading the tracklist. Yoongi had given me complete freedom to choose, and I wanted to make sure every selection was perfect.
In the midst of my contemplation, my thoughts drifted to Yoongi. I couldn't help but smile as I remembered the way he had surprised me with the record player earlier. It was clear that he knew just how much I loved music like him, and he wanted to share that passion with me.
As I continued browsing, my eyes suddenly lit up when I spotted the records I had been searching for. There, among the vast collection, were albums by Queen, Mac Miller, Lee Moonsae, and Diana Ross – artists whose music had shaped my life. I felt a rush of excitement as I reached for each of them, holding them close as if they were precious treasures.
With a heart full of gratitude for Yoongi's thoughtful gift and a bag full of vinyl records, I headed to the checkout counter. I knew that each record I had chosen would be a soundtrack to special moments shared with Yoongi, and that made the indecisiveness and the joy of discovery all the more worthwhile.
My collection is finally growing again and I’m so grateful to him. I checked out quickly, holding a brief conversation with the nice blue-haired woman at the counter. Thanking god for the half empty store, I stepped out into the cold air. I called a taxi on my phone and waited the everlasting 10 minutes as I nearly froze in place.
The sleek navy-blue car pulled in front of the little store, a middle aged man stepping out of the drivers side to open the door for me. I thanked him as he grabbed my bag and set it in the trunk for me. The short drive back to our apartment was quiet, the hum of NPR coming from the radio piercing the silence. The heater blowing directly at me.
We pulled up to the tall building hurrying so I can escape the cold air. I grabbed my bag from the man and tipped him extra for his generosity and service. I scanned into the building making my way to the elevators past the front desk. After I exited the elevators I grew more excited to see Yoongi. I skipped happily to our door, putting in the key code.
I’m greeted by the smell of air freshener and our puppy running up to me. Excitedly licking my hand and wagging his tail. I closed the door setting my bag on the small table near it and then taking off my shoes.
“Hi baby!” I said cheerfully looking at Yoongi as he walked over to me. He grabbed my waist and placed a kiss on my check, making his way down to my neck. Resting his head on my shoulder as he held me. I felt like putty in his palm, moving to grab his face and plant a kiss on his lips.
He hummed into the kiss, letting his hands sneak around my waist to my ass. I giggled and pushed him away immediately, missing the feeling of his hands on me already. He pained a hurt expression and I gave him a knowing look. He was supposed to be packing but the laundry basket I left him to sort through seemed to be almost untouched as it sat idle by our sofa.
“Min Yoongi why is your laundry still folded neatly in that basket?” I questioned pointing to his clothes and resting a hand on my hip. “I needed a break,” he said nonchalantly, walking to go sit back on the sofa. He was precious but we have things to do and I can’t let his cuteness distract me. I grabbed my shopping bag from the table and walked over to Yoongi, sitting on his lap so I could show him the merchandise.
“Let me show you what I bought and then I’ll go start on dinner while you actually pack,” I said smiling at the way he rested his hands on my thighs. I took the vinyls out of the bag, setting the first two on the sofa cushion next to us.
“First I got this classic Diana Ross record, but I can’t hold in my excitement anymore!” I said grabbing the Mac Miller record and handing it to Yoongi. I watched as his eyes light up in excitement. “I know I was supposed to be shopping for me but I couldn’t help myself.” I said starting to tear up. I didn’t want to cry but the emotions are hitting hard, Yoongi leaves in a few days.
“Thank you so much baby I love it,” he said setting the record aside to kiss me softly. Yoongi sighed as he stared down at me on his lap. I noticed the worry in his eyes and sat up placing a hand on his cheek. “Are you okay my love?” I probed gently.
“It’s just…I can’t help but worry about leaving you alone again while I go on tour. Your depression and anxiety, I’m afraid they might worsen, and I won’t be there to help you when you need me the most,” Yoongi said staring deeply into my glossy eyes.
I smiled warmly at his confession, cupping his face in my hands. “Min Yoongi, it’s so easy to see why your parents named you light. You’ve helped me through so much already, you are my light. I’ve learned so much from you about handling my emotions, and even on my worst days, just a phone call with you can calm me down. I’ll be okay baby, I promise,” I choked out.
Yoongi looked at me for a second, seemingly analyzing me. He nodded slowly pulling me into a tight hug. “I know you’ve grown stronger, but I can’t help but worry. You mean the world to me Y/N,” he said as I buried my face in his neck.
“And you mean the world to me too, Yoongi. We’ll get through this together, just like we always do.” I said hugging him tighter. We stayed in our embrace for a while, finding comfort in each others presence. Eventually I break the hug and get up to go make dinner, while Yoongi starts to sort through his laundry basket.
“I guess I’ll actually start getting my things in order,” he mumbled to himself with a huff. He stood up flinging open his suitcases, and throwing in a few items he eyeballed. I giggled at how unenthusiastic he was being.
“I’ll help you pack after dinner Yoongs, you know I have to double check and make sure you have everything you’ll need.” I said busying myself at the stove. After I mixed the pasta, I told Yoongi to set the table while I change and I’d be right back.
I retreated to our bedroom, eager to change into my comfortable pajamas. As I shed my days attire and donned my soft, oversized pjs, my eyes involuntarily drifted to the prominent scars that crisscrossed my body, momentos of a harrowing time that altered my life.
A wave of sadness washed over me, recalling the challenges in my journey to recovery. Moments of doubt crept in, but just as I was about to get lost in my melancholic thoughts, I heard Yoongi’s voice gently calling me from the dining area.
“Babe come on I’m hungry and your food smells too good,” he whined cutely as I walked into the dining room. I placed some pasta in his plate and sat in the chair across from him, unconsciously tugging at the short sleeves on my shirt, hoping he wouldn’t notice.
Yoongi hummed in delight at the taste of the cream pasta, and I quietly chewed along. It didn’t take long for us to finish our meal, I stood up making my way to the sink, grabbing the dishes from the table. I started washing dishes, mindlessly humming one of Yoongi’s songs.
“Why’re you so quiet tonight sweetheart?” Yoongi questioned as he walked up behind me. I felt his hands wrap around my waist, he then pulled me flush against him. “Talk to me Y/N,” he said in my ear, leaving a soft lingering kiss behind.
“I’m sorry I just don’t feel the best, honestly, I feel like a burden. All these ugly scars already make me feel less than, but the thought of me holding you back from doing what you love pains me the most, Yoongi,” I said nervously, melting into his embrace.
Suddenly Yoongi unraveled his arms, reaching around me to turn the faucet off. I turned around to face him, confusion flooding my features. He gently placed his hands on my face, searching my eyes for an unknown answer.
“Will you let me show you how much I love you Y/N?” He asked. I nodded slowly, bringing my hand up to touch his that rested on my cheek. He leaned down to place a kiss on my lips, hovering close after he pulled apart.
We walked hand in hand to the bedroom, closing the door behind us. Yoongi guided me over to our bed, helping me up onto the tall mattress. He climbed onto the bed, gently pushing me to lay down flat on my back.
“With every piece of clothing I remove from your body, I’ll leave a trace of me behind. You deserve to know how gorgeous you are Y/N, how utterly irresistible and perfect you are. Every piece of you that you view as an imperfection, I view as another reason to love you.” Yoongi said removing his black shirt from his toned figure.
He removed his shorts, carelessly tossing them to some shadow realm. He looped his fingers under my, formally his, oversized shirt, pulling it over my head in one swift motion.
He stared at my exposed chest for a second, eyes flickering back to mine every so often. He then leaned down, placing a trail of kisses down my neck, and stopping when he reached my collar bone.
He started leaving behind love bites, sucking and licking at the quick forming bruises. I hissed in pleasure as his tongue felt like pure ecstasy, sighing at the way he took my nipple into his mouth.
He looked up at me through hooded eyes, staring at me intensely as he massaged and sucked my breasts. I moaned his name quietly, wrapping my legs around his torso as he moved his attention to the other side.
He made his way down my exposed front, leaving no inch of skin without a trace of his love, or tongue. He moved further down the bed, hooking his fingers under the band of my flower covered panties.
His eyes never left my face, he smirked as I watch him in anticipation. Stomach quickly rising and falling with every nervous breath. He pulled them down my legs painfully slow, I shivered as the cold air hit my exposed clit. He’s barely touched me and I’m already a soaking mess.
He placed a kiss on my left hip bone, massaging the right one with a free hand. He kissed his way down until he hovered over my center, watching the way my eyes drank in his sinful appearance. I could feel the warmth of his breath hitting my core, causing an accidental whine to escape my pouty lips.
He let out a breathy chuckle before placing a kiss on my clit. That earned another moan from me as well as a tight grip on the rappers long hair. He sat up suddenly, receiving a look of disappointment from me. “I can’t wait any longer pumpkin, I need to fill you up like the good girl you are. Gonna make you cry for a much better reason than before.” Yoongi said tossing his boxers to the side and rubbing his length against my pussy, I squirmed in anticipation.
I felt his tip probe at my entrance, his length slowly being engulfed into the hot, soft cavern. I gasped at the intrusion, squeezing Yoongi’s arm as he began to move slowly. With every thrust I clenched harder, scratching down his back as he loving fucked me into oblivion.
“I can never get enough of you princess,” Yoongi grunted out as he sped up his rhythmic movements. “This is my pussy baby you’re mine, all mine, and no one else’s.” He growled eyes darkening with pleasure.
“hmfp I…I’m all yours Yoongi all yours please please fuck me just like that,” I stuttered out, crying as my body grew sore with the force of Yoongi’s hips slamming into mine. I enjoyed every second of this painful pleasure, yanking him by the neck down to my mouth. Lewd noises echoed through our apartment, a melody of wet sounds and heavy breathing reverberating off the walls of our bedroom.
I screamed in pleasure as Yoongi reached down and started furiously rubbing my swollen clit. “Fuck down on me Y/N, let the neighbors hear all those pretty noises you make. Tell me how much you love this dick baby it’s all yours,” he said hotly leaving a trail of wet kisses down my neck.
“It’s mine oh f…fuck Yoongi I can’t take it, I want you to cum inside me please. N…need you to fill me up so I can fully be yours,” I choked out in between sobs. Before I could react the bed shook with extreme force, Yoongi unbelievably fucking me deeper, lifting my hips off the bed and squeezing my bruised hips.
I felt his dick pulsate inside me, indicating he was just as close as I was. “Fuck…cum with me baby,” he grunted out head rolling back in pleasure as his pace slowed. I felt his warm cum shoot inside me, I shook furiously hips spazzing as Yoongi gently set me down. He wiped my tears as I exhaustedly went limp, too tired to get another word out.
“I hope you know I’m going to think about this all the time while I’m gone,” Yoongi said grabbing some water from his bedside table to give to me. I mustered the courage to sit up and graciously take the water, passing him the rest after I finished. He leaned over and placed another kiss on my lips, holding me in his arms as he quietly talked me into a restful sleep.
Yoongi stood by the door, his bags packed and ready for the waiting vehicle outside. I watched him, my eyes brimming with emotions as he turned to face me.
“Y/N, I wish I didn’t have to leave without you, but I know how important your work is to you. I promise I’ll try to call you everyday, no matter the time difference,” he said softly.
“I know Yoongs, but I’m going to miss you so so much,” I said voice quivering as I struggled to keep my composure. My body shook with sadness, shoulders slouching in defeat. Yoongi cupped my face in his hands and gently wiped away my tears.
“Hey look at me, beautiful. I want you to know that no matter where I am, my heart is always with you. If you ever need anything, if you’re feeling down, just call me and I’ll answer in a heartbeat. I would fly across the country in seconds to get to you my love. I might not say it enough, but you mean everything to me Y/N there is no me without you. You’re my inspiration, my strength, and my love.” He confessed, his eyes holding a depth of emotion he often struggled to express.
“I love you too Yoongi, more than words can say,” I said while sniffling. Yoongi smiled at me through glossy eyes, clearly trying to hold it together for me. “Actions speak volumes, right? I’ll prove it to you everyday I’m away. This tour won’t change how I feel about you, and it damn sure won’t change us.” He said pulling me into another tight embrace. A car horn could be heard impatiently honking in the background.
“Goodbye my love,” I said smiling through my tears.
“It’s never goodbye, I’ll always see you again darling.”
205 notes · View notes
babyonboard · 2 years
Text
just hooking up. | jake ‘hangman’ seresin x f!reader
Summary: as a nurse for navy pilots at top gun, hooking up with one of your patients seems unprofessional. but for jake seresin, you’ll make an exception.
Word Count: 6,080
Warnings: mentions of, and a small amount of smut (minors dni), a little angst, slow(ish) burn, mentions of blood, intense medical scenarios.
I am not a nurse and I may get some shit wrong about hospitals. Also, I had to tweak some things about top gun to make this story work. Deal with it :)
Tumblr media
It had just been a boring day in the office. Sitting silently in your room, you cleaned the medical table, the bed, and even got some organizing done for your cabinets. Humming a non-existent song, you were interrupted by the phone that sat outside of your door ringing. Swinging the door open, you answered.
The phone ringing usually meant one thing. Something had gone wrong in the field, and someone was on their way to you to get checked out. You hadn’t met anyone in the new pilot class yet, you had only seen a few of them coming in to get their physicals with the Doctor. Other than that, these new people were complete strangers to you. The thing about Top Gun was that usually, the problems were either very minor, in which you would receive a phone call that a pilot was on their way to you, or the problems were extremely major. You had only experienced one major problem, a couple years ago during your first year as a nurse at Top Gun. You didn’t like to think about it.
“Hello, medical ward.” You greeted, holding the old phone to your ear. Wrapping the cord around your finger, you mentally noted that, even though the hospital was tiny, you really needed a new phone.
“Hey, this is Captain Mitchel, I’ve got a pilot headed your way. We were fixing up his jet and a piece fell on him, he's got a pretty good gash on his arm.” He said. You could hear the muffled voices of other pilots laughing around him, making you almost sigh in relief at how small this problem seemed to be.
“Thank you Captain. We’ll take good care of him.”
“You’re the best.” You could practically hear him winking through the phone.
Seconds later, you heard the door in the lobby burst open, and two boys talking. You walked through the double doors towards them, and they both stopped talking to look at you. Fuck you thought. They were both cute.
“Hi gentlemen.” You smiled, suddenly self conscious about your decision to wear red lipstick this morning.
“Well what do we have here.” One of them said “I’ve never had a cute nurse before, I thought that those were a myth.” He smiled. You rolled your eyes and noticed the blood slowly running down his arm.
“Mav said he was gonna call you, but Hangman cut the shit out of his arm.” The other one said said, You noticed the dirty, oil stained towel they were holding to his wound on his bicep. Nice.
“I heard.” You said, stepping closer to them. Setting your hand lightly on the blonde's shoulder, you said, “Let's get you checked out.” You turned to the boy who had come with him. “Thank you Lieutenant, I'll take it from here.” He gave you a head nod and turned to walk out.
“Follow me.” You said. “Hangman, is it?”
“Yes ma’am. And you are?” He still had a paper white smile on his face. Unexplainably happy for someone with blood dripping from them.
“Y/N.” You stated.
“I like that name.” He said simply. You stopped in front of the door to your office and opened the door.
“Thank you.” you said as he walked inside. You walked in and patted the bed twice.
He got on the bed, his eyes never leaving you. He stared at your face, your red lips, and your figure. He started wishing he had cut his arm much sooner than today.
“So, how’d this happen?” You asked, turned around at the counter, wetting a new clean towel with sanitizer.
“I was fixing my jet. I scraped my wing on the side of a mountain and when I was replacing it, one of the pieces that got scraped came off and, well, this happened.” He explained. He seemed very nonchalant.
“Alright, well I’ll see what I can do, Lt.” You said, turning around. He still wore that award winning smile on his face.
“You can lay back.” You mentioned, lowering the back of his bed so he could lay down.
“You don’t have to tell me twice.” He smirked. Classy.
The cut was on the underside of his bicep, sort of near his armpit. You lightly grabbed his elbow, moving his arm so it was by his head. You could hear him breathing, and you could see his eyes on your face out of the corner of your eye, and you could see the seemingly never ending smirk that rested on his lips.
You took off the towel they had used, and you saw the gash for yourself. “Jesus” you breathed. “Stitches for sure.” You muttered under your breath. He shrugged.
“How are stitches a shrugging matter?” You laughed, placing your new towel over his wound.
“Used to it.” He shrugged again.
Sighing, you continued to disinfect his cut. He never winced or tensed, sometimes he even laughed, which you thought was strange. At some point, he changed his position from holding his arm up by his head to putting his hands on the back of his head, leaving him in a seemingly relaxed position. Again, strange. As you worked on him, you couldn't help but admire his muscles. They were extremely defined, especially in the position he was holding his arm.
“You know, gorgeous,” He started.
“Y/N” You interjected quickly.
“Same thing.” He quipped. “I think I might need to start getting hurt more often.”
And that’s exactly what he did.
Over the next several weeks, he had come in for a number of reasons. Which, not that you minded. It added something interesting to your day. Also, you liked seeing him. He was cute.
He came in for any reason you could think of. A “sprained ankle” that he needed ice for, but he couldn’t put the ice on it himself because he was “really sore” so you had to sit at the end of the bed, holding it on his ankle. He came in for a headache, a stomachache, a “sore hand”, and he even came in for a paper cut.
You noticed that each morning, you spent a little bit more time on your makeup in hopes you would see Hangman that day. You noticed that whenever the phone rang or whenever you got a knock on your door, your heart would skip a beat. This was a problem. You knew that Top Gun pilots come and go. The class only lasts upwards of 6 months. It had already been almost 2. You had no idea where he would go after this, and you didn’t want to fall for someone you might never see again.
One particularly early morning, your coffee still hot, you heard a knock on your door. Standing up, you adjusted your hair subconsciously. You opened the door to Hangman leaning on the door frame, giving you a puppy dog face.
You sighed with a smile. “What is it today, Hangman?”
“Good morning to you too, princess. And what did I say about calling me Hangman?” He half scolded with a smirk on his face. Uninvited, he makes his way into your office and sits down in his usual place on the bed.
“Right” you shut your eyes “Jake, sorry.”
“I forgive you.” He smiled his signature smile. “Is that a new necklace?”
Instinctively, you touched your neck. It was a new necklace. “Yeah, it is.”
“I like it. Pretty necklace on a pretty neck.”
The color of your face had to have changed in a second. “So… what is it?” You asked, sitting on your stool, changing the topic so you didn’t have to blush any longer.
“Well,” he started, bringing his hand in front of his face. “I have a hangnail.”
You put your face in your hands. “You have to be kidding me.”
“I know, it’s very tragic, I’m not kidding you.”
Defeated, you lifted your head. Wheeling your stool towards him, you said “Let me see it.”
He looked at his pinky. He studied it for a second then met your eyes. “I think it fell off.”
You stared at him. He stared right back. It was silent for a moment while the two of you tried not to laugh. He broke first, a smile pulling at the corner of his lips. It made you push away your own smile, and you had to look away, and before long, you both were laughing.
As the laughing died down, he took a deep breath to compose himself. “Okay, okay, the real reason I came in was for something else.”
“Really? I never would’ve guessed.”
“Well, me and my friends usually go to this bar across the street on Fridays, and I want you to come with me tonight.” He said.
You sighed. Bars. Not exactly your thing. “I don’t know Jake…”
“Come on, goody two shoes, it wouldn’t kill you to have fun.” He reached over and put his hands on your shoulders. Unintentionally, his grip was tight. He had huge hands.
“I am not a goody two shoes.” You crossed your arms, your shoulders adjusting under his large palms.
“Sure.” He scoffed. “Come with me, princess. Please?”
It’s nicknames like those that get you into difficult situations. Nicknames that you can’t say no to. And now, your difficult situation was that you were standing next to Jake in a bar, surrounded by his loud, sweaty friends. More and more just kept appearing.
“And who’s this?” A girl asked, giving you a sweet smile.
“This is Y/N. She’s my… well, she’s a nurse over at the medical ward.”
You quirked an eyebrow at where that sentence was heading, but you didn’t have enough time to question him about it, because that girl immediately dragged you to play darts with her.
You learned that her name was Phoenix. You sucked at darts, but she didn’t seem to care either way.
“So, you’re the girl hangman’s always talking about, huh?” She said, keeping her eyes on the board.
Butterflies erupted in your stomach at the thought. Sure, you talked about him non stop to your friends, but imagining him talking about you almost made your heart burst.
“He talks about me?” You looked across the bar at him, his eyes already on you. He held a pool stick, and he offered you a head nod and a wink. You smiled in return.
“Hell yes he does. He runs out of class like it’s a race and is always talking about how he’s going to see his “sexy-nurse-dream-come-to-life.”
You laughed. You knew what he thought about you, he’s not afraid to say it, but hearing it from someone else felt different. It felt more real.
Phoenix got bored with darts and she led you over to the bar. You half-pretended to not see Hangman’s eyes on you at all times. Without asking, Phoenix ordered two shots.
“Shots? Phoenix I’m not the best at-“
“Shots without me?” You heard Jake's voice over your shoulder. After hearing his voice, you felt his hand on the small of your back. His pinky touched the rim of your skirt. You had to close your eyes and take a deep breath in order to not lose your cool. His touch felt so good.
You stuttered to try and make a sentence, your whole focus on his hand on your back. “I was just saying I don’t know if I can do that. I haven’t done a shot in… well in a long time.”
“You’ll be fine.” Phoenix smiled and turned back to the bartender, speaking to her as she poured the clear liquid into two shot glasses.
Suddenly, Jakes grip got tighter, and moved to the side of your hip. It wasn’t set on your hip, he was grabbing it. “I like this skirt.” He spoke slowly in your ear.
You gulped. You wanted to make a snarky comment back at him, but you didn’t think your brain could form words right now. Phoenix turned around with your shot, handing it to you.
You grabbed it and turned to look at Jake. “I seriously don’t know if I can take this. What if I like, throw up.”
“You won’t.” He smiled. He grabbed it from your hand. “Let me help, okay?”
You nodded. His huge hand came up to the side of your jaw and cupped it. His fingers on the back of your head, he tilted your head back. His thumb moved across your cheek, and painfully slow, it made its way over your lips, coming to rest on your bottom lip. He tugged it lightly. “Open.” He spoke. Without thinking, you opened your mouth. His jaw clenched, he pulled at your hair the smallest amount to tilt your head even further back. You had subconsciously brought your hands to hold on to both of his elbows, completely trusting yourself with him. Your eyes were glued to each other, the eye contact never broke. A grip that had started out light was now intense. He brought the cool shot glass to your lips pouring it into your mouth with no warning. Keeping your eyes on his, you swallowed.
“Good.” He mumbled. You didn’t really wince or make a grossed out face, your entire mind thinking about his hands on you. His thumb came back to your lips to wipe them clean of any vodka. You couldn’t tell if it was the shot or his touch that made your knees wobbly. All at once, he let go of you and smiled, suddenly in a joking mood again. “See?” He laughed, “that wasn’t so hard.”
You had no idea where Phoenix went, but she had left you and Jake at the bar together. You blinked, standing completely still, your mind lagging while trying to process what just happened. Heart racing, you chose to ignore what was going on between your legs right now.
“This is a random question, do you wanna get out of here?”
The walk back to Hangman’s apartment was excruciating. It was a hot July night, your hair sticking to your neck and shoulders as you walked. It was a short walk, but it felt like it was taking forever. The conversation on the way back was normal. The two of you were back to playful banter, which made you question if he felt the same way about what had just happened at the bar. Is it normal for him to do that to girls?
Stepping through Jake's door, you put your arms out to feel the cool air conditioning. “Oh, my god.” You groaned as he shut the door behind him. “It was so fucking hot in that bar, I thought-“
Jake's lips were on yours. His hands on either side of your face, his lips were practically squished against yours. Shocked, your body completely froze for a second. You dropped your arms at your sides, and let your brain catch up to what was happening. His lips were searing hot, yet his hands were cool on either side of your face. Your legs almost gave out on you, and he must have noticed, because he moved to wrap his arms completely around your waist, pressing your stomach against his abs. Your body catching up to your brain (or vice versa) you brought your hands to his broad shoulders. You fought back a shudder as he bit your bottom lip lightly, but you couldn’t hold back the small moan you let out.
That must have flipped a switch for him, his hands moved down over the curve of your ass, landing on the back of your thighs. He pulled them up, picking you up completely. You wrapped your legs around his torso, and you could feel him walking somewhere. He stopped at some point to mess with the light switch, turning it on as he held you up with one arm.
He dropped you lightly on your back onto his bed, his hands were on either side of your head, propping himself up. For a second, he gave you a sweet smile. You giggled lightly, a “is this really happening?” giggle.
“Have I ever told you how gorgeous you are?” He nearly whispered above you, his eyes scanned all over your face.
“I think you’ve mentioned it a few times.” You smiled.
Tumblr media
Hooking up. That’s what it was. Friends with benefits. Well, friends who flirt and are obsessed with each other with benefits.
You really liked hooking up with Jake. You liked waking up in his bed, you liked how he would just come and see you at work now, no medical excuse at all. You liked the way he looked above you, and below you, for that matter. You liked holding onto his hair while he goes down on you, and you liked the way his hand felt around your neck. You like how fucked out and flushed he looked when you were done, and you liked how sometimes, he would kiss your forehead at the end. You liked that he started keeping a toothbrush for you in his bathroom, and you liked how safe you felt in his arms. And, you liked him.
The situation was sticky. You have heard multiple murmurs from his fellow pilots how you were his “girl of the month”. You knew his reputation, and you didn’t even wanna know how many girls have gotten this same treatment before you. The way Jake felt about you was playful. It was sexual, flirty, and fun. And for you, it was the same way. But recently, you felt like your connection to him was a little deeper. You had real feelings for him. You felt stupid that sometimes you would let yourself think that he felt that same way about you. But sometimes, the way he looked at you was not the way that “friends with benefits” look at each other.
One day in particular, he had you underneath him after a really long day of classes. He hadn’t been able to see you for a few days prior, practices on the field ramping up more and more. You’d think that after a frustrating day, he would be rough with you, but he wasn’t. He stroked your cheek lightly, his forehead pressed against yours and the tip of his nose touching yours. You could tell he was getting close by how sloppy his thrusts got.
“Fuck.” He gritted his teeth. “You are, fuck, Y/N, you’re so beautiful.”
You said nothing, you just looked at him with complete and total heart eyes. Your heart fluttered and you thought that if he didn’t have real feelings for you, he wouldn’t have said that. When he finished, he rolled off of you. You hoped for a kiss on the forehead, but unfortunately, not today.
He didn’t take a moment to catch his breath, or hold you, he got straight out of the bed. You visibly frowned.
He stretched and picked up his shorts off of the ground. “Fuck, my head hurts.” He mumbled as he walked out of the room and into the kitchen. You laid there, naked in his bed. You suddenly felt over-exposed, so you pulled the covers over you. Your mind raced. Why did Jake Seresin have to be such an emotional roller coaster? Now, seconds after being sure he had feelings for you, you were almost positive he didn’t. You wished that, just once, he would hold you after he was done. You heard a pill bottle shake from in the kitchen, and you contemplated leaving. You didn’t want to be annoying. Pulling your shorts up, you found your sweatshirt on the ground and pulled it over your body.
He stood shirtless in the kitchen, holding a glass of water. “You sleepin here tonight?” He asked
As badly as you didn’t want to seem clingy or needy, or reveal your feelings for him at all, you really did want to spend the night. You couldn’t tell if he was asking because he wanted you to, or if he wanted to know if he was getting rid of you. “I can.” You answered simply.
“We could watch a movie?” He smiled smally. Fuck, he was so cute. If he asked you to marry him right now, you would say yes.
Your heart lifted. He did want you to stay. After all, you were forgetting that you and Jake were practically best friends. He liked being around you. “Okay.” You smiled.
He was confusing. One second, he was telling you how beautiful you were while he finished inside of you. Next, he won’t even look at you when he’s done. Then, he wants you to spend the night.
Jake ‘Hangman’ Seresin had spent a good part of his life hooking up with girls. Usually, it was a bartender, or a sorority girl, or a girl he met in flight school. He had partaken in numerous friends with benefits agreements, had many ongoing hookups, and plenty of one night stands. He will admit, he has never met a girl like you before. A literal ray of sunshine, a beautiful girl with a beautiful heart. It kind of scared him. As terrible as it sounds, a lot of his hookups had been passing time, where he sees the girls only purpose as getting him off. Then he met you. He spent his time on you, making sure you were, well, real. He thought you were too good to be true. He didn’t really know how to go about it.
So, I guess he would say it started as meaningful hook up’s with you. He didn’t see you as someone who could get him off. The problem was Jake didn’t know how to do relationships. He knew hookups and one night stands. He didn’t know what crossed the line into relationships and how to tell if you wanted to be with him. As time went on, he had to remind himself that you weren’t in a relationship. You were hooking up. He had to remind himself that whenever you kissed him and he wanted to pick you up and spin you around. He had to remind himself when he found himself caressing your face, your eyes locked in his. He really had to remind himself whenever he saw you. Just. Hooking. Up.
He had to remind himself that night, while you were curled up under a blanket on his couch. He wanted to put his arm around you, but he didn’t know how. For about the first time in his life, he felt awkward in front of a girl.
He usually would know the perfect move to make, but that would be in a sexual, flirty situation. Now, he wanted nothing more than cheesy romance. He started out with his arm over the back of the couch, then he let his fingers touch your hair. He wanted to take this slow, he wanted to make sure you knew his touch wasn’t sexual, he just wanted to cuddle with you.
“You can lay back if you want.” He blurted out. Mentally scolding himself, he held his breath. So much for taking it slow, Jake.
You turned around and looked at him. He had to be horny or something. If he didn’t have feelings for you, would he really be asking you to cuddle with him right now? His back against the arm rest, he waited for your response. He was relieved when he saw that small, familiar smile on your lips.
You obviously weren’t going to pass up this opportunity. “Okay.“ you replied softly. You slowly leaned into him, resting your back on his abs, the back of your head on his chest. He adjusted his arms around you, bringing a hand up to touch your hair.
You couldn’t see each other’s faces, but you were both smiling.
It was nice to be touched by Jake, not because he wanted to fuck you, but just because he wanted to touch you. His hand lightly stroked your hair as the movie played, but neither of you paid any mind to it.
The two of you sat in silence in this position, and after a while, you turned over onto your stomach, wrapping your arms around his torso and laying your cheek onto his chest. His heart swelled.
In a quiet, sleepy, middle of the night haze, your eyes fluttered open. A second passed and you weren’t exactly sure where you were or what was going on. Becoming aware, you opened your eyes fully, and you realized that Jake was carrying you. He was cradling you like a baby, almost tip toeing so that you didn’t wake up. You must’ve fallen asleep on the couch. You felt him gently lay you down on the bed and pull the covers up over you. His lips touched your forehead softly, then he climbed in on the other side of the bed. Climbing under the covers, he wrapped you up in his arms. You nuzzled your face into his neck and sighed.
It must have been because you were tired, or just because you were overwhelmed with the feeling, but without thinking, you opened your mouth to whisper “I love you, Jake.” The words never made it past your throat, your mouth stuck open like you were about to start a sentence. Part of you thought you should just say it, but the rest of you thought you were so stupid to think you could tell the boy you were hooking up with that you loved him just because he was cuddling with you.
That morning, you woke up early with Jake. He had to be up at around 6 to go to classes, and the absence of his arms around you had caused you to wake up.
“You could call in sick?” You crossed your arms at the edge of the bed.
He was changing at his dresser and he laughed at you. “You know, you’re cute when you’re grumpy.”
You frowned. He looked to you to see if you liked his joke, and he sighed. “Y/N, you have work today too.” He came to sit by you on the bed. “You can sleep here until you have to go in, and maybe I’ll come visit you today.”
In a silent agreement, you rested your head on his shoulder. He patted you back then stood up. Ouch.
You hoped that he would kiss you before you left, but he didn’t. He rushed out the door, leaving you with a mere “maybe we can chill tonight.”
When he was out the door, you slammed your back against the bed with a groan. He cuddles with you all night, then doesn’t want anything to do with you the next day.
‘Just hooking up’ Jake repeated in his head as he walked out of his apartment, leaving a bed headed, incredibly cute you lying on his bed. ‘Just hooking up. Just hooking up. Just hooking up. Just hooking up.’
It was almost time for you to leave the office, and Jake hadn’t come to visit yet. You couldn’t stop checking your phone, waiting for a “Come to my apartment after work ;)” text. You started to believe it wasn’t going to come.
Your moping was interrupted by the sound of the small radio on your belt beeping. Confused, you looked down. The radio was for emergencies. It must be a test.
You picked it up and held it to your ear. “We’ve got two pilots that need search and rescue. There was some sort of collision. Both ejected. We’ve got Bradley Bradshaw and Jake Seresin. Pull their files and be ready for treatment. EMTs, rooftop helicopter in 2 minutes.”
You stood there, frozen. Your mind couldn’t even process the words, and your feet took off out of mere instinct. You wouldn’t even let yourself think of the possible outcomes of this situation, and yet, there was only one thing on your mind as you climbed the steps to the roof:
Jake.
You made it to the roof where the rescue helicopter was. You weren’t an EMT, and you certainly weren’t search and rescue, so you knew they wouldn’t let you come. You technically should be getting ready for two pilots who will need medical attention in about 5 minutes.
Not even sure what you were doing, you ran up to the helicopter where the EMTs were loading on. “Let me on!” You yelled over the roaring helicopter.
Most of them didn’t even pay attention to you, but one of them looked at you. “Y/N? You’re a floor nurse?”
“I know, please let me on.” You nearly whispered. Hopeless, you felt tears in your eyes. You thought for a second about fighting your way on, but then you thought about how this hospital only had a handful of other nurses and doctors, and if you really wanted to help, you should be getting ready right now.
You took a deep breath and wiped your eyes. Pull. Yourself. Together. Put the stupid fucking hookups aside and do your fucking job.
Not having time to be embarrassed by the looks the EMTs were giving you, you ran back inside. Everyone was already bustling around, grabbing files, supplies, moving beds, and clearing rooms. You didn’t have a ton of time to get ready for whatever you were about to see, but you had enough.
A beeping sound came from your monitors, which meant that the EMTs had made it to the site. Everyone listened to hear the severity. You closed your eyes, dreading what you could possibly hear. “Both responsive.”
You seriously could have cried in relief.
The buzzing noise on the intercom meant that the patients were in the building. Half of you hoped you would be one of the nurses to help Jake, but the other half thought maybe it would be best if you weren’t. It was kind of a gamble on which patient you would get, it just depended on what room the EMTs were closest to and which patient made it in the building first.
When Jake was wheeled in through your door, his face bloody and his shirt tore open to reveal a dirtied up chest, your breath hitched in your throat. Do your job Y/N, forget about who he is and do your job.
The doctor started barking orders at you and the other nurse in the room. “Scissors for his shirt.” He directed the other nurse. “Y/N, hook up his vitals.”
Cautiously, you stepped up to his bed. Holy fuck. You couldn’t tell where the blood on his face was coming from, it looked like his head. His eyes were drooping closed, and his chest was heaving. You picked up the IV and touched his arm lightly. His eyes shot open.
“Y/N” he cried. His hands were shaking.
You swallowed the lump in your throat and blinked your tears away. “It’s okay, Jake. You’re okay.”
“Y/N” he croaked again. Tears mixed with the blood under his eyes. His lips quivered and his chest heaved even harder.
You couldn’t even respond as you slipped the IV into his arm.
“Jake?” The doctor said “I need you to tell me what’s hurting you.”
“My head.” He cried “Fuck, it’s my head.”
You heard the doctor say something about an MRI to someone in the hallway. The doctor was examining his head as you wrapped a blood pressure cuff around his arm.
“All set for MRI.” A tech popped their head into the room.
You turned back to Jake, who was looking at you. “They’re taking you for an MRI, Jake. It won’t take long, I promise.”
“No, please.” He shut his eyes.
“It won’t be bad Jake, it’s okay.”
“Come with me.” He said, reaching for your hand.
“I can’t. I’ll be here when you get back.” A technician came in to take him away.
“I’m sorry.” He cried. They started to wheel him out of the room. “I’m sorry, Y/N. I love you.”
You swallowed. “I love you too.”
They took him out of the room and you stood there, heart pounding. Honestly, you didn’t spend too much time thinking about how he said that he loved you. You didn’t have the time.
The only moment you had a small amount of down time to think was a few hours later. It was getting dark outside, and your shift had already ended. You obviously stayed. His room was lit up by a lamp in the corner and his head was turned to look out the window until you walked in.
You hadn’t gotten to talk to him since he told you that he loved you. Since then, he got 14 stitches and 6 staples in his head, and a brace put on his back. They were keeping him overnight for observation due to the trauma on his head.
“Hi.” You said as you walked in. His head turned towards you and he smiled.
“Hi princess.”
You sat at the edge of his bed, resting your hand on his leg. “How you feelin?”
He shook his head and shrugged. “Not great. Just crashed a hundred million dollar plane, almost killed another pilot. They’re never gonna let me go on the mission now.”
“I’m sorry.” You offered.
It was silent for a moment. Not awkward, but peaceful. “You know, when I went down and I was waiting for search and rescue, I was like ‘fuck I hope Y/N doesn’t see me like this’.” You giggled, which made him smile again.
“But I knew you worked today, and then when I got here, I was hoping I would see you.” He gulped and looked out the window. “I was scared. I didn’t wanna die and have a ton of random people around me.”
“I was scared too.” You said. “I don’t like seeing you hurting.”
In a moment unlike Jake Seresin, he was quiet. He messed with the blanket on his lap, looking down. “You know, I’m sorry if what I said made you uncomfortable. I just, I had a moment of like, realization, I guess.”
“Jake, you know how I feel about you, don’t you? I’m not very good at hiding it.”
He sighed. “I know. That’s why I said I was sorry. I feel like I kind of fucked with your feelings.” You nodded slowly. “But I’m done with that now. I’m just… not good at emotions, and all that shit.”
Confusing as always. “What are you saying?”
“I want to be more than just hooking up. I do love you, Y/N. I meant it when I said that.” He finally looked up at you.
You let out a breath of relief and leaned down to kiss him. For once, it wasn’t a kiss that was going to lead to something else. It was just a kiss. A loving one. “I meant it too. I love you Jake.”
You weren’t allowed to spend the night, so you went back to his apartment. You spent the whole night washing his sheets, making his bed comfy, cleaning his kitchen, and you even went and got some groceries early in the morning.
That morning, you drove Jake back to his apartment. You tucked him into his bed and made him breakfast. He absolutely adored how domestic you were, and he always begged you not to get out of bed, even if you were going to the bathroom. You laid in bed next to him as he ate his breakfast, and he tried to share some of it with you, but you insisted you weren’t hungry. You spent the whole day babying him, and he spent the whole day loving it.
The best part by far was the several “I love you”’s that we’re exchanged every 5 minutes.
As a movie played on his tv, he stroked your hair. “I have a question.” He stated.
“Okay.” You said, not lifting your head from his chest.
“So… I'm like… your boyfriend now, right?”
You couldn’t help but giggle at how awkwardly he posed the question. “Yes, Jake.”
He smiled widely. “I think that, since you’re my girlfriend and all, you should give me a kiss.”
You lifted your head to get close to his face. “Nothing would make me happier.”
2K notes · View notes
desert-fern · 1 year
Text
A Gun Amongst Daggers - Jake “Hangman” Seresin X Fem!Navy Seal Reader
Part 7: Shaping up and Shipping Out
Summary: When Jake meets a woman at the Hard Deck, the last thing he expects is for her to be a Navy Seal. And not just any Seal, the Commander of Seal Team 3. She’s beautiful, smart, dangerous, and everything about her just makes him want to get close. Her name? Bear. When the Seals need backup, Cyclone puts the Daggers on their radar and now, Jake has to work with Bear and her team, all the while trying to stay professional. Can he do it? Or will he end up falling for the Navy sniper and mission Commander?
Tumblr media
*GIF is from Pinterest. Not mine*
MINORS DO NOT ENGAGE! 18+ ONLY. MINORS & BLOGS WITH NO AGE/EMPTY BLOGS WILL BE BLOCKED.
Warnings: like 2 swears, tis mostly fluff
Word Count: 2.6k
Masterlist >> Part 6 >> Part 8
===
The next few weeks were busy. Between organizing information, running exercises, and trying and failing not to drool over Hangman, Bear was scattered. The night before she had taught the pilots a little about handling the paintball guns they used for training and organized a paintball competition with everyone. She could hear the laughter and the teasing that had echoed loudly through the warehouse and it made her smile. Bear loved how easily her people and the pilots had come together, forming their own little pack. She had promised to look after them and seeing that their support systems were growing filled her heart with joy. A knock at her office door broke her from her thoughts. “Come in.”
“Hey Bear. Hope we didn’t interrupt anything.” Bob and Rooster were standing in the open doorway.
“No, not at all. I was just finishing up. What’s going on?”
Bob replied simply. “Us and a few of the others are heading out to the bar for a bit before we ship out tomorrow. You feeling up to joining us?”
Bear smiled softly. “Wish I could, Bobert and Chicken. I still have to finish my packing — well actually start my packing. Plus I need a night to just take it easy for a bit. But I appreciate the offer.”
“No worries, just wanted to see if you were interested,” Bob told her, giving her a wave. “Pretty sure Hangman’s going to be disappointed though.”
Bear’s mouth fell open in shock. “I-what? Where did that come from?”
“We all see how you look at each other,” Rooster added. “And honestly, Bug and I were chatting yesterday, she thinks that it would be good for you. I do too.”
“Boys, come on,” Bear sighed in defeat. “Nothing can or will happen there. The fact of the matter is that I am his and your superior. There’s rules against this sort of thing.”
Bob gave her a sympathetic smile. “But you aren’t his direct superior. Especially once this mission is over. It could still happen. Doesn’t mean that you have to, but just think about it,” he said gently. “But we will leave you to finish up, and we’ll see you bright and early tomorrow morning.”
“Have a goodnight, Bear.”
“Thanks guys, you too. Have fun tonight,” Bear said quietly. Her mind was whirring. Somehow, the Daggers and her team knowing that there was mutual interest between her and Hangman made it worse. Her thoughts about the blonde pilot were all jumbled together. It would take a madwoman to sort through them and she just couldn’t handle that on top of everything else she had to deal with. So she stuffed them down. She could sort them out later. Hopefully he’d understand.
Bear shut off her computer and packed her bag in a daze. A part of her wanted to see Hangman before they shipped out, but she knew that she’d see him tomorrow, so with a muddled mind, Bear left her office.
She was intercepted halfway to the parking lot by Fanboy and Fireball, who asked her the same question as Bob and Rooster had only minutes before. She turned them down, just like she had earlier and gave them a wave. Once in her car, Bear let her head thunk against the steering wheel, trying to shake off the haze of her thoughts. Taking a few deep breaths, the fog cleared and she drove home, humming along to a random song playing softly through the radio.
Her arrival home was unremarkable. Every house she drove past looked the same. The same U.S. flag flying from the porch, the same cookie cutter front yard. And then there was hers. The only house without the flag because it kept flying away and getting caught in a tree or stuck on the roof. The only house missing the ‘lived in’ feel.
Inside, Bear tossed her keys on the table by the front door, her bag hung up on the hook in the kitchen. With a groan, she heaved herself up the stairs and into the shower, fully intending on relaxing for the rest of the night, with no blonde flyboy to make her trip over her words.
===
Well, at least that was her plan. Two hours after arriving home and after her shower, Bear had begun packing. Clothes were strewn across the room, her uniform in the wash, and she stood there in a t-shirt and small black bike shorts that only just barely covered her ass. While in the middle of folding shirts, the doorbell rang, making her swear and stomp down the stairs. “Whoever the fuck is at the door better have a good-” she cut off her tirade abruptly, seeing Hangman on her front porch. “Hi.”
The pilot looked amused. “Hello to you too,” he said. “Is everything alright?” Jake was holding a pizza box in one hand, the other hanging awkwardly at his side. It was like everything had stopped when Bear yanked open the door yelling. Her hair, normally tied into a tight bun, was hanging loose about her shoulders and she stood in front of him in shorts that should have been illegal with how closely they painted themselves to her thighs.
“Umm…yeah. It is,” Bear replied awkwardly. She had leaned against the doorframe, one hand still holding the door open. “What are you doing here?”
“Fireball mentioned that you weren’t coming out with us tonight, and that you have a habit of not eating when you’re busy,” Jake told her, his other hand coming up to rub the back of his neck awkwardly. “So he gave me your address and I brought pizza.”
She grinned at him. “You did, huh?”
“Yep. So can I come in?”
Bear pretended to think. “Well, you did bring food and I don’t hate your face, so sure.” Her eyes were bright as she grinned up at him. She stepped aside, letting him pass before shutting the door behind him.
“Nice place,” Jake remarked as he stood in the entryway, glancing around at the pictures on the walls. “These are your platoons?”
She nodded. “They are. Each team I have been a part of since I first enlisted,” Bear told him, pride evident in her voice. Sidling close to him, she pointed at the last picture on the wall. “This is the only one I have of the Lieutenants from the current team.”
Jake swallowed thickly, trying to ignore the warmth of her body against his arm as she told him about the pictures. “Is that Flare? She looks so young.”
“It is, she had just been promoted not even a week before this,” Bear said, her voice full of pride. “But you didn’t come here to stand around and hear me talk about nothing. Let’s get the pizza in the kitchen, it’s literally right behind you.”
“Actually I did come here to listen to you ramble,” Jake replied, shooting her a wink and relishing in how her cheeks pinked and how she tugged her bottom lip between her teeth, chewing on it. “It’s why I brought pizza AND rang the doorbell.” He wandered into the kitchen, opening cabinets to find plates, the pizza box now on the counter.
Bear shook her head, following him into the kitchen and popping open the box. “Fuck yes, pepperoni,” she mumbled excitedly under her breath, not catching the smug look on Jake’s face behind her.
“I told you, Fireball told me a lot.” He passed her a plate, stepping beside her to grab a few pieces for himself. “Including your love of pepperoni.”
“Well thank god for that,” Bear said in between bites. “I had completely forgotten about food. So thank you, Jake.”
“It’s not a problem, Teddy.”
She groaned. “Please stop calling me that.”
“I think I’ve grown rather attached to it,” Jake teased, stepping into her space, forcing her to look up at him.
“Fine, Flyboy. Whatever,” she said with a shrug, forcefully willing her blush away. “I have to finish packing.”
Jake stuffed his pizza crust in his mouth, nodding as he took both of their plates. “Need a hand?”
Bear gave him a confused look. “I mean, if you want. It’ll be pretty boring.”
He merely nodded, putting both plates in the sink before following her up the stairs. “You’re a bit of a chaotic packer, aren’t you?” Jake teased, taking in the room in front of him.
“Shut up,” Bear tossed back, going over to her bag and refolding a few shirts to make room. “Something has to give and it sure as fuck won’t be the intel.”
Jake shrugged, silently agreeing with her. “Makes sense to me,” he replied. “Did you need any of this?” He held up two black tech shirts.”
“Ummm…,” Bear hummed, mentally going through her list. “Is the one on the right the smaller of the two?”
Jake’s brow furrowed as he checked the tags. “Yep, you need it?”
“Duh, that’s why I asked,” she sassed. So Jake threw it at her, watching it hit her in the face and land in the bag. “Hey!”
He began to laugh, completely distracted by the look of surprise on her face and he didn’t see her wind up and throw a balled up pair of socks at him. “You are gonna regret that Teddy,” he replied, grabbing a handful of the clothing left on her bed.
“You promise, Flyboy? Because I think you forget who you’re up against,” Bear teased, jumping up to stand on her bed, another pair of socks aimed at Jake’s face, practically daring him to try something.
Seconds passed as the two had their little standoff, before Jake whipped a sweater at her, yelping as the socks bounced off his chest not even seconds later. Bear continued pelting him with clothing, laughing at his reaction. “Okay! Okay! Mercy!” Jake finally managed to say between laughter.
Bear hopped off the bed, one last item in her hand as she stood over his folded position on her bedroom floor. “Beg for your life, Flyboy.”
Jake was laughing too hard to answer her, sending the woman above him into peals of giggles. “Okay. I’m good,” he said with an exhale. “Let’s finish getting you packed.”
Bear extended her hand to him, clasping his forearm and pulling him up, stumbling back half a step when they found themselves nose to nose. “Ummm…” Bear trailed off, ducking her gaze and slipping past him. “Packing. And now thanks to you, I have to pick up all my socks again,” she teased, bumping him with her elbow.
He shook his head at her antics. She seemed carefree, happy in his presence. Maybe he was imagining things, but a man could dream that he had a hand in easing her tension. “Sure, blame me. C’mon Teddy.”
===
Over the next few hours, Bear and Hangman packed up her gear, continuing the stream of conversation, bouncing from one topic to the next with ease. It felt natural to them both, almost effortless in the way they spoke and teased the other.
It was only when the last zipper was pulled closed and the last bag was placed in the hallway, did the conversation stop. Both paused, somehow unable to find words that had been there not even seconds before. “Thank you for your help,” Bear finally spoke after a long pause. “I appreciate it. Especially since you could have been out with the team.”
She felt suddenly shy, pinned under the pale green gaze of the man in front of her. It was as if she stood bare before him. Every thought, feeling, and desire was exposed and brought into the light for him to see. She had misjudged him at first, dismissing him as just another cocky pilot who thought he was better than everyone else. And while she wasn’t completely wrong, tonight he had shown her more of himself than she had expected. But she stopped herself. “This can’t happen,” Bear thought to herself. “I could lose my position and my job if this ever gets out.”
Jake smiled at her. The last few hours had been some of the best that he could remember. Having seen yet another side of this strong woman, Jake fell harder. It was no longer physical. Well, it was, but now it was so much more than that. Bear was everything he’d never considered for himself. The strength, the kindness, bravery, gentleness all seemed to radiate from her, bathing all who were lucky enough to get close to her in the light that shone from her. And he was thrilled that she allowed him this close. “Honestly, this was probably the most fun I’ve had in a while,” he admitted quietly. “Including when I hit Rooster in the chest during that paintball fight last week.”
A soft laugh escaped her. They had drifted from her room, back down to the front entryway, neither willing to part from the other. “That was pretty funny,” Bear replied. Glancing at the clock on the wall in the kitchen, she hummed. “It’s getting late and we have to be up early tomorrow. You should probably go.”
“Probably.” Giving her one last soft smile, Jake opened the door, stepping out onto the porch. “Have a good night Teddy. I’ll see you tomorrow.”
“Tomorrow,” she echoed, eyes still fixed on him. Letting out a small chuckle, Bear leaned against the door frame. “Drive safe, Flyboy. I need your ass in order to run this mission.”
“Yes ma’am,” Jake replied. He stood awkwardly next to his truck, hand tapping against his thigh, before nodding once and unlocking the vehicle.
Bear watched him pull out of the driveway, and waited until he was down the road before shutting the door and locking it. Once inside, she leaned back against the door, pressing her hands against her eyes until bright spots filled her vision. “Get it together,” she mumbled. “You can’t let him distract you.”
===
The next morning, Bear found herself on the dock early. Her larger bags had been sent ahead, leaving her with her backpack that held her documents. She greeted each member of her four platoons, exchanging hugs and greetings with their families, before counting them all and sending them aboard the USS Lincoln to get settled. She was waiting for the Daggers to arrive, being unable to leave without Maverick making an appearance.
“I’m going to miss you, love,” she overheard Phoenix say, pressing a deep kiss against the lips of a brunette woman who stood only slightly smaller than the pilot. “I love you.”
“Love you more, Nat.” One more quick kiss and the other woman stepped back, watching Phoenix clap Bob on the shoulder.
Watching the goodbyes always made her stomach clench. It was a reminder of how easily something like the Navy could take over your life and make it impossible to find someone who truly understood what it was like. “Bear!”
“Chicken. You’re chipper this morning,” she replied, having been abruptly pulled from her thoughts.
He grinned, pulling her into a side hug. “What can I say? I had some of my girl’s lovin’ last night and now I’m not sure how I could ever leave.”
“Okay, gross. I did not need to know that.”
He laughed, clapping her on the back before ascending the walkway onto the ship, catching up with Fanboy and Payback.
More pilots trickled past, and from the corner of her eye, she caught Maverick arriving. He was in deep conversation with Admiral Simpson, who met her curious gaze. Bear snapped into a salute, only lowering her arm when the gesture was returned. “Good morning, Sir.”
“Commander. Is your team ready?”
“Yes Sir, we are. Admiral Harris is up to date on any recent changes to the plans, and if things change further, I will keep you both in the loop,” Bear replied.
“Good to hear, Commander,” the Admiral said. He nodded once to Maverick, who returned the gesture, before turning to them both. “Best of luck to you both.”
“Thank you Sir,” Maverick replied, shifting his bag in his grip. Admiral Simpson walked off, pausing to converse with the woman Phoenix had kissed goodbye on the dockside. “Are you ready Commander?”
“Are you, Captain?”
He laughed, “Fair enough, let’s get settled.”
===
A/N: So they're getting closer! Almost makes you wonder if it’s going to stay like that….
Thank you to @startrekfangirl2233 @dakotakazansky and @sarahsmi13s for yelling at me! Any and all errors are my own!
Tumblr media
Taglist: @startrekfangirl2233 @dakotakazansky @sarahsmi13s @horseshoegirl @roosters-girl @lovinglyeternal @lavenderbradshaw @roosterforme @bobby-r2d2-floyd @twsssmlmaa @footprintsinthesxnd @bradleybeachbabe @fandomxpreferences @dempy @gizmodear @fighterpilothoe @iwantmyredvelvetcupcake @djs8891 @rhirhikingston @impossiblebagelcowboyfreak @thegoddessc @sgt-barnesveins @taytaylala12 @urmom-999 @formulapierre @pinkpantheris
371 notes · View notes
harriet13lovely · 8 months
Text
Tumblr media
Lola- HS
Part 1- 6-7k words
Lola's whole purpose in life was to be the wife of the Don of the biggest Mafia in the world. Ever since she was a little girl she was told about Harry and how they would make the perfect couple when they got married later on life. Lola didn't know much about Harry himself, she had only heard story's about him and had had dinners with him and his family ever since she turned 15 four years ago. They were never allowed to talk outside of these dinners though, Lola was still too young and Harry was already too busy for anything apart from work.
Since she was to be Harry's wife, his family had always provided for her. They made sure she was placed in the best schools and had all the best pieces of clothing and makeup. Harry's mom would take her shopping once a month for anything she could want. Once she turned 16 she was given a credit card that was funded by Harry, it had no limit so she could spend as much money as she wanted. Lola rarely ever used it, her parents gave her money too so she found no interest in spending Harry's money.
Lola was as of three hours ago officially 19. She had been awoken by knock on the door at around 8:30. It was her mother and father, they had breakfast and a boquete of flowers with them. After congratulating her they talked for a while as she ate breakfast. At 9 her parents left her to begin getting ready, Lola took a shower and did her skincare. Once she was done she walked out of her room and took a look out her window. Her party was being set up outside in the garden of her house. She could see her mother talking with the party organizers and one of the contractors that had provide all the utilities.
"Come in." She said after hearing a knock on the door. She turned around as the door opened and found her little brother standing there. He was still in his pjs and looked like he had just woken.
"What's up?" Lola asks him but gets no response, instead he walks over to her and wraps his arms around her waist. He was only 8 and was incredibly affectionate. Still too innocent to the world they lived in.
"Happy Birthday." He says and looks up at her.
"Thank you." She bends down and picks him up. Even though he was getting bigger and taller by the day, to Lola he was still a baby. She was 11 when he was born and she very much saw him as her own kid. He wrapped his arms around her neck and legs around her waist.
"I heard that you're leaving." He whispers.
"Who told you that?"
"Dad was talking about it over the phone. I don't want you to leave." He hugs her tighter and it makes Lola want to cry, the last thing she wants to do is to leave him alone. But she truly has no choice, Harry would most likely propose to her at the party and she would have to say yes. After that she would have to move in with Harry and plan the wedding with him.
"I won't lie and say that I'm not leaving because I am. But I will be here every weekend with you, mom, and dad. You won't even notice I'm gone." She walks over to her bed and sits the both of them down.
"It won't be the same." James says and begins crying.
"James, I will always be your big sister and you will always be my baby brother. I'm always gonna be here for you Jamsie." Lola wipes the tears that where falling from James's eyes.
"Promise?"
"Promise."
Lola played him a movie on her TV while she got ready for the day. She had changed right after her shower into cream shorts and a navy blue jumper. She let James "do" her makeup in hopes it would cheer him up. And it did, he became a giggling mess after smudging a lot of blush all over her nose.
"Lo, Emma is here." Her mom said as she opened the door to her bedroom. Emma was Harry's mom, she had been involved in Lola's life since she was a baby. She cleaned off the blush from her nose and put on her shoes.
Lola walked downstairs to the living room and found Emma sitting there talking with the organizer of her party who looked rather stressed. She felt bad for the man, the pressure he must feel from her mom and Emma must be getting to him.
"There's the birthday girl!" Emma stands up and wraps her arms around the girl. "Happy birthday, Lola."
"Thank you."
"We need to get some last minute confirmation on the music you would like to be played." The organizer said and pointed to her notebook. Lola took a seat next to him and begin to list off some songs she would for sure want to be played. They spent half an hour doing that, after that she was directed outside to personally inspect the decorations in the tables and the food that would be served later on.
"Harry is coming, right?" She asked Emma as they where watching people put the flower arrangements together.
"Of course, he wouldn't miss it for the world." Emma gives her an encouraging smile and wraps her arm around her shoulder.
Lola continues to supervise the whole set up with Emma until she is sent off for lunch at 12. She eats some pasta and chicken and watches some TV with James and her dad. At 1:30 the crew that was doing her makeup and hair arrived to begin to get her ready for the evening. She would be having two different outfit changes, a pale yellow minie dress and a baby pink long flowy dress. The shorter dress would be used during the cocktail/ day side of her party, the longer dress would be used during the night time of the party. Both of these dresses had been chosen in between Lola, Emma, and Lola's mother.
The party would officially start at 5 but they wanted Lola to be ready by 4 so she could take pictures with her family before the party. Her hair was curled into beach waves and her makeup was mostly glittery and with soft pastel tones in the corner of her eyes. Her heels are plain white and had some pearls on the straps.
"You look perfect." Emma says as he looks at her. Emma was now changed and ready to go for the party too. Her blonde hair was put into a half up half down style and her sage green dress looked absolutely stunning on her.
"Thank you, you look amazing too."
"There is someone for you downstairs."
Emma had a cheeky smile on her face so that could only mean one thing, Harry. Lola walks down the stairs and in fact finds Harry in the living room talking to her father. He was wearing a dark blue, almost black, suit with a loose white shirt underneath. He had his usual cross necklace dangling around his neck and a pair of black sunglasses pulling back his curls. He stands up from his seat and walks towards her.
"Happy Birthday." He says to her and gives her a quick hug. Even with heels she was still shorter than him so she had to look up at him a bit to meet his eyes.
"Thank you."
"You two look so cute together." Anna, one of Lola's younger cousin's, said. This earned her a slap on the arm by her mother but that didn't take the smile off of her face. Harry's and Lola's "love" was something that people in the mafia looked up to. They were meant to be the perfect match, this was at least what they showed to the others. In reality, Lola didn't even know Harry's favorite color or ice cream flavor.
"Can I take some pictures of you two outside?" A man with a camera asked them. Harry nods and leads Lola to the garden.
Lola stands beside Harry as they take pictures. His right arm wrapped around her waist. They had never been this close before, the most they ever got to was sitting next to each other during dinner. They take a couple more pictures before Harry leaves to take a business call. Lola took some solo pictures and with her family before heading back inside so she can welcome the guests as they come in.
Lola doesn't see Harry again until dinner is served at 7. Harry took a seat next to her in the head table where only close family was sitting at.
"I like this dress more." He whispers into her ear, she was now wearing her pink dress. The dress made her look like one of those fairytale princess and Harry really liked that. Lola smiles up at him, she was hoping he would like her dresses.
"I'm glad." Harry shifted on his seat and that's when she saw it. Inside his pocket was a small white box, he really was going to do it that night. Lola felt her heart stop for a minute, she had been expecting it but now that it was really happening it scared her quite a bit. Once they got engaged the wedding would be close to come and as soon as that happens they would begin to try for children. Her duty was to provide Harry and the mafia with an heir. Same way that Emma provided Harry as heir she would too. It was all dawning on her too quickly to the point she begin to feel like she was suffocating. Her heartbeat was the only thing she could hear and the room felt too warm for her comfort.
"I'm going to use the restroom." She stands up and walks towards the house quickly. She manages to get to her room before she fully starts to hyperventilate. She sits on the edge of her bed and holds onto her mattress. She hadn't even noticed she was crying until a knock on the door took her out of her trance.
"I'll be out in a sec." She says to whoever was outside.
"It's Harry." He doesn't wait for any sort of response before opening the door and walking into the room. He had never been in her room before so this was a completely new environment for him. She had a lot of posters and vinyls all over her walls. He also noticed that the dominating colors where white and pink.
"Oh, hey." Lola says as she wipes her tears.
"What's wrong?"
"It's nothing, I'm just being stupid."
"You're not, and I can tell that there is something wrong."
"I saw it, the... the box."
"Oh." Harry doesn't really know how to respond, he thought it was to be expected for him propose that day.
"Can I see it?" She asks, Harry hums and takes the box out of pocket. He opens it before passing it Lola. The stone on the ring was large and shiny, something that would definitely make Lola stand out.
"It's beautiful." Lola says to Harry.
"If you don't want to get engaged today I can switch the date." Harry tells her but Lola immediately shakes her head and gives him the ring back.
"No, it's okay. We should head back down." Lola tells him and stands up. Harry follows after her as they walk downstairs. Right as they are about to walk to the garden Harry grabs Lola by the arm and pulls her back.
"You sure you want to do this?" Harry asks her.
"Yeah."
They walk back into the party, Lola putting on a big smile and Harry going back to his usual stoic face. They eat dinner and chat with the people around them, Lola stands up and begins to walk around the tables making sure that everyone is having a good time. At around 8:30 everyone was finished with their dinners. Lola was talking with one of her cousins back at her original table when Harry stood up to make a toast and called her over to the dance floor. It was go time.
"I would like to make this toast to congratulate my girlfriend on her birthday. You deserve the world and more Lola. I hope we have many more birthdays like this together. Because of that I would like to ask you something." Harry got on one knee and pulled out the box from his jacket. "Would you like to marry me?"
"Yes!" Lola almost yelled before jumping up and down. She was told by her mother to overreact if she had to but to look as happy as possible. Harry stood up and put the ring on her finger before pulling her into a hug. The guests all clapped and cheered for them.
Lola and Harry walked around the party together and accepted all the good wishes they received from members of the Mafia. They decided on cutting the cake after that so they could really party for the rest of the night. Her cake was of multiple layers and pink with gold stars all over them. The candles where pink with gold swirls and there was a candle in the number 19 in the middle. They all sang happy birthday for her and Lola was told to make her wish. She wished for her future marriage to go well, if it did, by her next birthday she should be pregnant or with her baby already.
Once everyone ate their cake they all took to the dance floor. Harry of course refused Lola's attempts at pulling him to the dance floor, saying that he didn't know how to dance as the main excuse. Lola however knew that was a lie, she had seen him years ago at parties when he was in his late teens/early twenties and he was always dancing with someone. Harry watched Lola and the rest of the members dancing for the next couple hours. Enjoying a few drinks here and there as a form of distraction.
"You sure you don't want to dance?" Lola asks Harry as she takes a seat next to him. Harry looked bored and she was just trying to make him feel more welcomed into the party.
"No, I think I'm gonna head out. Have a couple meetings early tomorrow." He says and stands up.
"Already? It's barely midnight." Lola tells him, was he really that bored?
"Work's my priority and like I said I have early meetings tomorrow."
"By meetings you mean drug deals or gun trafficking? I'm glad to know my birthday means that little to you." Lola says with a scoff.
"I would have expected you to have better manners considering how much money I have spent on your education." He says and begins to walk away. Lola is now feeling the bravery of the alcohol and decides to go after him.
"I would have expected you to care more about me since I'm your future wife after all."
"I do care." They where farther out in the garden and right outside her house.
"Whatever makes you sleep better at night."
"Lola I'm not going to argue with you right now."
"I wish you would."
"Why would you? Do you want to be on my bad side, is that it? Or are you just that much of an attention seeking whore that any sort of attention makes you feel good?" Harry says and gets up close to Lola's face. Lola however stands her ground, keeping eye contact the whole time.
"I just want to get to know you."
"We can do that some other time, I really gotta go now." He walks away once again, this time Lola doesn't follow him.
….
Lola and Harry had managed to avoid each other for a week before they where forced back together. Emma had suggested they visited Harry after having lunch together so they could begin talking about some details of the wedding. Lola had tried to convince Emma of not going but after some insisting on Emma's part, Lola gave in.
"Good evening." Collin, Harry's assistant, said as the elevator opened. Harry had a whole floor to himself and his close people. The building had over 50 floors, each directing a different branch of Harry's "business".
"Mr Styles will be with you in a second. Is there anything I could get you to drink?"
"Can I get some tea?" Emma asks him politely.
"I'll just do some water." Lola tells him and he nods before walking inside a different room. Lola watches him leave and come back with the two drinks. She grabs her water and thanks him. Collin walks back to his desk but stands back up after a beeping sound is heard.
"Mr Styles is ready to see you." He opens the big black door that leads to Harry's office. Emma walks ahead of her and sets her drink down before hugging Harry.
"Good evening, darling." Emma tells her son softly.
"Good evening, mum." Harry hugs her back slightly. Harry looks up and finds Lola standing just a couple feet from where he was. She was wearing a black turtleneck, white miniskirt and black platform boots. A black leather purse hanging from her right arm. Her hair was down and mostly straight. She looked stunning even in a simple outfit. The ring was however the most noticeable thing in the outfit, it was shiny and large.
"Lola." He said with a nod of his head.
"Hey." She takes a seat on the couch area in Harry's office. Emma walks over, pulling Harry along, and sits down in front of her.
"We are here to talk about the wedding." Emma says excitedly, Harry looks at Lola and they make eye contact. They keep it for a couple seconds before Lola looks away.
"You guys can choose the stuff, my only request would be that it's held in my house." Harry tells them.
"That's it?" Lola asks him.
"Yeah, it can all be to your choosing. It's supposed to be your day after all."
"It's not just mine, it's our day. Our wedding day at that." Lola was questioning if he even wanted to slightly get married at all.
"I know that, but the decorations can be of your choosing. If there is any input to be given from my side my mother or sister can choose it."
"So you really don't care about anything?"
"I'm gonna leave you two for a minute." Emma stands up and walks out the office.
"It's not that I don't care, I just think it's better if you take care of it." Harry says as soon as his mom closes the door to his office. Lola rolls her eyes and looks as far away from him as she could.
"No, you just don't care." She stares blankly.
"Okay, Lola. You can think whatever you would like. If that's all you were here for you may leave."
"Why do you have to be such an asshole all the time?!" Lola yelled.
"I'm not, this is just the way our marriage will work. I'm sorry if this is not what you wanted, trust me it's not what I wanted either." At that Lola felt tears brim her eyes, she never really thought he would outright state his dismay against the arrangement.
"Then choose another wife." She tells him and walks out of the room. Purposefully slamming his door in the process. Lola feels Emma following after her to the elevator. Once they got in and the door close Emma spoke up,
"I'm so sorry, darling." Emma hugged her side. "Know that I will be talking to him very seriously later tonight."
"Please don't, If he wants to move on with our marriage he can talk to me on his own. I don't want you to have to be a mediator between us."
"It's truly no bother but I respect your wishes. Just know that I will always have your back no matter what, I was once in your position after all."
"Thank you, it truly means a lot." Lola told the woman and hugged her tight. She doesn't know what she would do without Emma.
"Of course, darling. Let's get you home now, I think you've had enough for today."
Emma dropped Lola off at her house and they said their goodbyes.
"I'm home!" She yelled as she walked through the door and dropped her bag in the couch.
"Lo!" James yelled and ran towards her. Lola bend down and picked him up spinning him around the air.
"I missed you."
"I missed you more, Jamesie. How was football?" Lola asked him and placed him back down on the ground.
"Good! My coach said I am improving so much. I might be getting moved up with the older boys." James explained as they walked towards the kitchen together.
"That's amazing, I'm so proud of you. Do you want a snack?" Lola asked him and he hummed.
"Strawberries and Nutella?" He asked with puppy eyes.
"Sure, but don't tell mom."
"My lips are sealed." He 'zipped' his mouth and threw away the 'key'.
Once she made him his snack she guided him through a bit of his homework before going upstairs to get changed. Her outfit was getting quite uncomfortable and there was not point in wearing it anymore since she wasn't going out. She changed into a pajama bodysuit with long sleeves. It was one of her personal favorites, mainly because the patter was of little pink flowers. She washed of her makeup and brushed her hair. Once she was done she put on her Ugg boots and walked down to the living room.
"Almost done?" She asked James who hummed.
"Just have math left, it's what I'm working on."
"Confused or doing good?"
"I'm good."
Once James was done with his homework they went upstairs to the family room and watched some movies together as they played UNO. At around 7 their parents came back home and they all ate dinner together. Lola helped the maids wash some of the dishes and clean up the table after being dismissed from dinner. It was a bit of a normal occurrence for her to do so. She enjoyed talking to the girls who worked at her house, they where all quite a bit older than her but they where still pretty close. She was talking with Brooke, who was 25 and the youngest of the maids, when another one of the maids interrupted them.
"Mrs Lola, there is someone here for you."
"Who is it?" She asked as she dried her hands off and took off the apron she had been wearing.
"Mr Styles, he was quite persistent on seeing you." The maid responded her in a dreamy voice, it seemed that everyone was in love with Harry.
"Wish me luck." Lola told Brooke who gave her a thumbs up. She walked out to the living room and was shocked at what she was seeing. He was wearing dark blue jeans, a large orange sweater, and off white tennis shoes. She had never seen him look so normal in all the time she had known him. If she saw him on the street she would have never guessed he was the don of a mafia. To add more to the strangeness he had a bouquet of pink roses with white baby breath and a couple other kinds of pink flowers.
"Harry?"
"Hey." He felt his breath be knocked out when he looked up at her. She looked adorable and comfortable in her pjs.
"These are for you." He walked over to her and handed her the flowers.
"Thank you. Sophia?" The maid came out of the kitchen and waited for what she was going to be asked to do. "Could you do me the favor of putting this in water, please?"
"Of course, Mrs Lola." Lola handed her the flowers.
"Thank you." Lola waited until Sophia was back in the kitchen before turning back to Harry.
"What are you doing here?"
"I was hoping we could talk, in private." Harry told her and motioned towards the kitchen. He was sure the maids where overhearing the whole conversation.
"I trust them, but we can go to the library if you'd like."
"I was hoping we could go to your bedroom, it's a more familiar environment to you." Harry explained and Lola gave him a strange look.
"Uhm, sure. It's this way." She led him upstairs and to her room. She walked in, Harry behind her, and took a seat on her bed.
"I'm gonna close the door if that's okay."
"Sure." She begin to fiddle with one of her pillows as she watched Harry close the door and take a seat in-front of her.
"What did you want to talk about?"
"About what you said earlier, about me getting another wife." He explained and Lola felt even more confused then she was before.
"I'm not doing an open marriage if that's what you want." Lola said sternly causing Harry to immediately shake his head.
"No, it's just- if you weren't to be my wife, what would you want to do? Like a career or something."
"I'm not sure, perhaps study fashion design. In Milan or Paris, it was my childhood dream." She continued to pick on her pillow and avoid as much eye contact with Harry as she could.
"I can make that happen for you." Harry stated simply.
"How? I'm supposed to marry you in a few months and give you a kid."
"I would call off the engagement." Lola looked at him like he was a ghost.
"As great as that sounds, we can't do that. I can't do that to my family."
"I can, I am the don. I can change the rules if I want to, and don't worry about your family. They will still be under my protection for as long as they live. Including you too of course."
"But-"
"I can and will find a way around anything. But I will only break it off if you want to. I won't ruin your life like that, Lo."
"I- I don't know. I guess Paris sounds nice but I'm not sure I want that."
"I know it's hard but I don't want you to be miserable with me. And from what I can tell we aren't very compatible. Perhaps it would be for the best, you deserve a husband that lives up to your dreams, that will treat you like the princess you are." Harry places a hand on her leg and pats it. Lola felt a couple tears fall from her eyes.
"Okay." She simply says.
"Okay what?"
"We can break off the engagement." She wipes her tears and looks outside through her windows.
"Are you sure?" He asks her and Lola hums before removing his hand from her leg and standing up.
"Lola, don't leave please." He said as he watched her walk towards her bathroom.
"I just need a minute." Harry stands up and follows behind her. He watched her rest her hands on the sink and look at her face in the mirror. More tears where falling from her eyes every passing second. Harry couldn't just stand there and watch so he did the next best thing. He walked behind her and wrapped his arms around her. This just cause Lola to cry more, in all honesty she didn't know why she was crying. She didn't love him but a part of her wanted for him to love her. She had this image in her head where once they where married they would both fall in love with each other, and just like that their fairytale would begin.
"Shhh, it's okay." He held her up and rubbed his arm up and down softly.
"I just- I- I don't know what I'm supposed to say or do."
"Sit down." He sat her down on the toilet and bended down in front of her.
"It's okay, just breath. In and out, in and out. You're doing so good." He held her hand until she started to breath more normally.
"Why don't you want to marry me?" She asked with a little sob at the end.
"It's for the best, Lola. Like I said, we are not compatible."
"So it's my personality?"
"It's not just you, it's me too. We clash all the time, you won't be happy with me darling." He ran his fingers through her hair softly.
"And you won't be happy with me either."
"I won't." It breaks Harry's heart to say it and Lola's heart to hear it.
"I'm sorry." She said and looked at him in the eyes for the first time.
"You have nothing to be sorry for."
"I do, my duty was to be everything you would want and I failed. I failed you and everyone else."
"You didn't fail me or anyone. You are a lovely girl, Lola. And I'm sure you will be a lovely bride one day but it just can't happen with me." He explained to her in the softest voice he could muster. He hadn't realized how fucked up this whole thing must be for her. He was taking away her whole birth purpose without any warning.
"Can I ask you something?" Lola asked him.
"Anything."
"Is there someone else that you are interested in? I totally understand if you are, I would rather know now."
"There's no one Lola, you've been the closest I've gotten to any sort of formal relationship."
"That's a bit weird, don't you think? I mean we barely know each other, I don't even know your favorite color."
"Orange and blue, those are my favorites. Thats why I'm wearing them right now."
"Pink and gold are mine."
"I sort of guessed that one by looking at your room." Harry laughed and Lola rolled her eyes playfully at him.
"It is kind of obvious." She admitted and Harry nodded. They didn't say anything for a couple seconds, the atmosphere felt warm and comfortable to the both of them.
"I should go now." Harry stood up and extended his hand for Lola to take.
"Okay."
"Come on, I'm not leaving you in the toilet." Lola took his hand and stood up. Harry lead her to her bed and lifted up the comforter so she could get underneath the covers.
"Thank you."
"It's my pleasure, go to bed soon."
"I will."
"And I will let my parents and your parents know that we are not getting married anymore."
"No, can we tell them together? Your parents have been in my life for so long, I love them so much too. I want to be able to tell them too."
"Okay, I'll organize a dinner for Friday. Invite our families and a couple close friends."
"Yeah, that works."
"I'll call you tomorrow for some other details. Take care of yourself, Lola. Goodnight."
"Goodnight."
Harry walked out of her room and closed the door behind him. As soon as he made it to the stairs he felt his legs give out on him a little. He took a seat on the top step and rests his head on his hands. He felt so oddly empty, even though he didn't feel much for Lola, apart of a small attachment, letting her go stung his heart. She had been a comfort to him his whole life even though they had never had talked at all. When life got bad he always knew he would have her at the end, they where meant for one another. Now that was done and over with. No more Harry and Lola, the best match the mafia had ever seen, everything had been perfect. Until now.
"Are you a robber?" He heard the voice of a little boy behind him.
"No, do I look like one?" He asked the young boy.
"No, you look more like a pumpkin." The boy giggled and Harry chuckled
"You are James, right? Lola's little brother?"
"Yeah." He took a seat on the stairs next to Harry.
"Are you her boyfriend?"
"Yeah." He decided it would be better to not confuse the little boy on all the small details.
"Can I have a room in your house once you get married?"
"Sure, but why do you want a room?"
"So I can stay there all the time, have sleepovers like I do all the time with Lola now." James explained to Harry.
"I will make sure you have a room all for yourself then."
"Thank you, that works as great bribery to me so I officially like you now. I hate you for taking Lola away but I like you for getting me a room. I will like you even more  if you get me a new LEGO."
"New LEGO, got it. Have a good night James."
"Good night, Lola's boyfriend." James stood up and went back to his room.
Once walking down the stairs he made his way outside. His car was waiting for him in the front of the house. His car was red Ferrari and one of his personal favorites of his collection. The drive back to his house was of about 20 minutes, he used to be closer when he lived in his parent's house. His mom had advices him he bought a house close to Lola in case of an emergency but he had refused. At the time he was still incredibly against the idea of marrying Lola. He was only 24 and felt disgusted by the idea of marrying someone. Now that he was older he hoped he had listened to his mom, it would have been easier to keep and eye on Lola and his family. They where under his protection after all, he would rather die than have any of them be hurt because of him.
He drove up the long driveway, saying hi to his guards in the process. He walked inside the house and headed to his room right away. He wasn't in the mood to eat dinner or do any work. He took off his shoes and pants before laying down on his bed. He rolled around a bit before finding a comfortable position. Somehow he ended up with a pillow hugged to his chest. Harry buried his head deep into the pillow and closed his eyes. He would never admit it to anyone but he thought of Lola, the way she would feel as they cuddled during the night. She would play with his hair and he would hold her so close to him he would be able to feel every inch of her on him. If she was pregnant he would be rubbing at her tummy all night making sure that their baby was safe. That thought on its own sent him down a spiral. But now that can't happen, he had pushed her away too far this time. Their future was simply nonexistent.
⭐️⭐️⭐️
139 notes · View notes
peterman-spideyparker · 11 months
Text
Horses and Zebras (College!Matt Murdock x Fem!Reader)
Author’s Note: I wrote this a bit ago with the intention of having this be smutty, but what I was coming up with just didn’t feel right, so I pivoted and turned it into this. I wanted to use a gif of college Matt but this one popped up, and I will never not use a gif of Tristan Thorn if given the chance and I’m also sorry for the sucky title. It might have a second part, but that’s TBD. Enjoy! :)
Summary: You’re in the medical program at Columbia, but you have some space in your schedule to take an elective, so you opt for a health policy and law class. What you don’t expect is meeting a handsome, blind law student.
Warnings: Fluff, flirting, medical jargon, angst (mentions of death, medical diseases), swearing
Other Characters: Foggy Nelson
Word Count: 2,184
Tumblr media
“Is this seat taken?” you hear a smooth, deep voice ask to your right as you take out your notebook and pencil case.
“It’s up for grabs,” you say with a smile as you turn to look at the asker. You feel your cheeks burn hot when you see the handsome man with brown hair, navy sweater, and sunglasses standing with a soft smile. He shifts the cane in his hands as he puts his bag down and begins unpacking his things. “I’m (Y/N), by the way.”
“Matt,” he returns as he settles. “Are you a 2L or a 3L?”
“I’m actually a med student—year and a half left.”
His thick eyebrows scrunch and his lips turn into a confused frown. “They’re letting a med student take a law class?”
“Well, it’s a health law and policy class. I’ve taken some summer courses to get ahead, and my advisor vouched for me. I figured if I’m going to be a doctor, I should try to help them and advocate for them as much as I can. Even if I know a little of it, I hope it would be a big help for some patients.”
“Wow,” he says softly. “You don’t really meet people that think like that.”
“Tell me about it. There’s this guy in my class, right? Stephen. He’s thinks he’s a real hot-shot surgical godsend, when really he’s just an egomaniac that always has to be the one holding the knife.”
“Sounds like a real dick,” he says with a sympathetic pout.
“There’s always people like that in any profession, I guess. Any people like that come to mind in the law program? Or am I talking to one?”
“I guess it depends on who you ask.”
“Mm,” you hum with a little smirk. “Sounds like a yes for the second to me.”
Matt smiles and licks his lips. It looks like he is just about to say something else when the professor walks in with her briefcase.
“Good morning and welcome to Intro to Health Law Advocacy. Now, we will be starting with medical ethics, and from there, segue into medical malpractice—which is slightly askew from the way it’s organized in the book. If you’ll open your textbooks to chapter eight . . .”
Tumblr media
“How are you not worried about this exam?” Matt asks, flipping through his notes on his bed, taking off his glasses and putting them to the side, pinching the bridge of his nose.
“Well, so far, I’m already familiar with these things,” you sigh as you turn on the chair at his desk. “We covered them the first or second year of the med program. I really haven’t learned anything new that will help me as a doctor. This class isn’t what I thought it would be, and I’m starting to think that’s why they let a med student take a law class.”
“So, what exactly are you studying right now, then?”
“Advanced abdominal and reproductive anatomy and diseases.”
“Ew,” he grimaces.
“Eh, it’s not bad. Some of my friends and I have done the ‘What’s my disease?’ game with all the symptoms and stuff, it’s just making sure I get these muscles right.” 
“How can I help?”
You lightly scoff. “Matthew, are you trying to get out of studying?”
“I would never,” he says in mock offense, a wry smirk almost immediately pulling at his lips. 
“It’s good you’re practicing your lying now,” you laugh as you move to make a highlight in your notes. “You really wouldn’t want something that bad presented in court.”
“Seriously, though,” he offers after he stops laughing. “I need a bit of a study break, honestly. How can I help you?”
“You could always just sit there and tell me how pretty I am.”
“(Y/N).”
“Matt, I appreciate it, but I don’t know if you can. Unless you want to be a live model, that is.”
“How so?”
You sigh, regretting even having brought it up. “It’s one thing to read it and look at diagrams, but it’s another thing to actually do it on a person.”
“Okay. So,” Matt draws out, putting a tab in his book. “I could lie down, and you’d poke and prod and tell me what you’d feel if I was a patient with one of the things in your book?”
“Yeah, I guess. Would you be comfortable with that?”
Matt nods. “I need a break from these laws—my fingers can’t take it anymore.”
“Alright, then.”
You know to do this, Matt would have to take his shirt off, but you’re not quite prepared for when he does. You can tell that Matt is in shape just by looking at him, but seeing how sculpted he is, the defined dips and curves of his muscles on his taut and smooth skin, you’re not prepared for how your mouth waters. Laying down on the twin bed, he lifts his arms, folding his hands behind his head, resting all nonchalantly with a cocky smirk on his lips.
“You alright there, doctor?” he asks, shifting ever so slightly and making his muscles flex.
“I’m not a doctor yet, Matty,” you tell him, grabbing your notes before you get up.
“You don’t need those.”
“How do you expect me to tell you which uncommon disease that you fictionally have when I poke you in certain places? It’s not like you know the symptoms.”
“You use your memory, sweetheart, that’s how.”
Your cheeks burn hot at the nickname, but it’s enough to convince you to put down your notes. 
“Okay,” you start, moving forward as you retie your ponytail. “Let me start with something easy just to get going. Appendicitis. Appendix becomes inflamed from infection and fills with pus. Pain is caused in the lower right abdomen, usually starting right around here.” You apply light pressure near his belly button on his rock hard abs. How does he have abs this great? “Pain will lessen the pressure is applied, but will get worse when my fingers get removed.” I mimic my motion with my words.
“Ow, it hurts really bad,” Matt adds for effect with a pout, making you giggle. “Doc, you gotta help me.”
“Well, you don’t have a fever,” you play along, feeling his forehead with the back of your hand. “Not nauseous, either. Could just be gas. But, if you do later on, it hurts when you cough, walk, or laugh, and the pain shifts here and your abdomen becomes rigid—,” you continue, moving your fingers lower, “—that’s then we have an issue. An ultrasound will confirm it’s an appendicitis.”
“Easy enough.” Matt’s tone is cool, but the blush on his chest, neck, and cheeks say otherwise. “What’s one of the rarer ones?”
“Well, that’d be something like Hirschsprung’s disease. It’s when there’s a lack of nerve cell bodies in part of the bowel. People are born with it, but it might not develop until later in life. Pain can present anywhere.”
“Well, that doesn’t make diagnosis sound easy.”
“It’s not as common. One of the first things you’re told is to look for horses not zebras; what someone might thinks is uncommon is actually something common presenting differently.”
“Then what happens when it’s actually uncommon?”
“People end up going to multiple doctors,” you sigh. “Or, they realize it’s uncommon when it’s too late. And the sad thing is, it happens—it happens a lot more to female patients than male patients because . . . fuck, I don’t know, people think women are weak.”
“You sound like you’re talking from experience.”
“Cuz I am.” You sit down on the edge of the mattress, your shoulders slumping forward as you hang your head. “One of my closest friends in high school, she was so incredibly fit and healthy, but she hadn’t been feeling right. One doctor said it was the flu, a physician’s assistant said it was PMS, another said it might be something carcinogenic. Then one day our senior year when she was at home, she just collapsed. After a week, they figured out it was a neurological disease. It ran in her family, but it hadn’t manifested in anyone. And by the end of that week, she was gone.”
“(Y/N), I’m so sorry,” Matt says softly, sitting up and putting his hand on yours.
“I’m so afraid of turning into one of those doctors,” you breathe quietly. “I don’t want to worry anyone for no reason, to put them through unnecessary tests that insurance might not cover and they might not be able to afford. But I’m so worried that one day, I’m just going to convince myself that one of those zebras is a horse, and then someone else will lose their best friend.”
“We haven’t known each other for long, but I like to think that in the semester I’ve known you, I’ve gotten to know you well. So I know that when you become a doctor, you will treat every one of your patients with respect, kindness, and compassion. You’ll listen to them and their concerns, and do the absolute best to give them the care they need. If you think there’s a zebra in the room, I know you’ll trust your gut and approach it in the right way. It’s not gonna be easy, and it won’t be without its difficult times, but I have every last faith in you and your abilities.”
“I don’t think you know how much that means to me to hear,” you admit, your voice thick with emotion. “You really are going to be a great lawyer, Matt. And I’m not just saying that. A lot of the same nice things you just said about me apply to you, though. You’re kind, compassionate, and you just want to help. There’s nothing more admirable than that.”
You feel electricity move across your skin when he rubs his thumb over your knuckles. Your noses touch before you tilt your heads to the side so they slot better together, your lips millimeters apart before the door to his dorm opens.
“Guess who just got a date with Marci!” Foggy cheers triumphantly as he comes into the room, stuttering to a halt when he registers how you and Matt slide away from one another. “Sorry, I di—.”
“No—,” you start.
“Fog, we—,” Matt says over you.
“I should get going, anyways,” you say as you stand to gather your things. “I’ll see you in class tomorrow, Matt.”
“I’ll see you,” he says softly. “Text me when you get back to your dorm safe.”
“Will do. Night.”
As soon as you close the door to their room, you can immediately hear Foggy start profusely apologizing.
“Dude, I didn’t know! I’m so sorry—,” he starts.
“Fog, keep your voice down!” Matt hushes him urgently. “She can hear you!”
“She’s probably all the way down the hall at this point. Is that the hot med student you’ve been telling me about?”
“Fog—!”
“Don’t pull that ‘How would I know they’re hot’ shit—you always find the prettiest girls and ensnare them in your Murdock charm.”
You can’t help but giggle as you walk down the hall and start back to your place. So . . . Matt has talked about you to Foggy. You guess you can tick that off of your curiosity list. You wonder what exactly he’s told his best friend about. You’re so lost in thought and reliant on muscle memory that you don’t realize you’re back in your place until you slump your bag off your shoulders and it hits the floor. Pulling out your phone, you lean against the door and begin to text Matt.
“Your hot med student friend is safe in her dorm,” you type, grinning like an idiot as you bite your lip.
It takes him a little bit to respond.
“I’m glad,” he says with a little smiley face emoji. Another text bubbles before it disappears, reappears, and I have a new text on my screen. “I’m sorry for what Foggy said.”
“Don’t worry about it.”
“So you did hear it. Eavesdropper ;).”
“I heard enough of it.”
You grow nervous when he doesn’t text back right away. In an effort to shake off the discomfort at the potential crater you might just have carved into your friendship, you change into your pajamas and grab what you need to start studying for you other classes. Just as you get in the right study spot, your phone buzzes to life with a text.
“You’re not mad?” it reads. 
“At you? Impossible.” Your finger hovers over the send button, wondering if it would push the envelope too much for the night, but then you remember the initial text you sent over, getting enough courage to click down on the blue circle with the arrow. “If you need me for anything, I’m just a text away.”
“Good to know. There’s no way I’m making it through this without you.”
Does . . . Does he mean the test? The class? He is too flirty for his own good. But you know one thing for sure: you have a big, fat, undeniable crush on Matt Murdock.
Tumblr media
Permanent Taglist: @majesticavenger​ @steampowerednightvaler​ @themusingsofmany @just-the-hiddles​ @toozmanykids​ @dangertoozmanykids101 @clints-worldavengers @theburningbookshop​ @itwasthereaminuteago​ @peter1ismybrother@hellskitchens-whore​​ @dpaccione​ @catnip987​
266 notes · View notes
fanfiction-blep · 1 year
Note
I am so hooked on your writing!
What do you think Quaritch would think of a pure of heart, dumb of ass human s/o? Someone with zero military experience- just a welder there to maintain equipment who wants to touch every colorful and shiny thing they can! SFW or NSFW please 🥺
Shiny~ Navi Miles Quaritch X human!Fem/Reader
Tumblr media
Okay so this gave me slight neurospicy vibes. So i will put some of my own experiences as an ADHD person in here :)
Warnings: Reader being clueless and ending up in life or death situations? frustrated Quaritch. Light fluff. slight angst.
So you are more of an engineer than anything else. One of the few things that holds your attention is fixing equipment.
Your small nimble hands working quickly, without distraction.
however, if you are walking away, finishing up a job, or on rout the second anything moves in the corner of your eye. It has your attention.
Native animals in the treeline? yep they have you hooked. Floating glowing seed? your balancing them on your nose.
Everything is a friend until it proves itself otherwise. That can sometimes that can prove dangerous.
But you always have a tall blue man stalking closely behind you. Though you two had not been very public with your relationship it was plain as day when you were together.
You were as clumsy as you were smart. So his hands covering any sharp surface when he was around you was a regular occurrence.
you know the whole hand on the edge of the table thing? yeah he does that with anything that may hurt you, or that you may injure your head on.
One time you dropped a heavy wrench thinking you had a table near by, you did not. Before it could painfully hit your foot Quaritch was there to catch it. "Ye need to be more careful!" He would hiss at you, frustrated with your antics.
There has been one to many times in the filed that you would saunter over to a group of animals humming in joy when they noticed you. for the most part they were friendly.
However you did find that group of viperwolves, and yeah. Not friendly. You got a few scratches for sure. to put it lightly.
Quaritch did not let you get away without a scolding. "If ya gonna run off every five fuckin' seconds and force me to baby sit ya then i won't have ya on missions anymore" "Im sorry" you would whisper wincing as he cleaned the wounds on your arm. "I know baby, I know"
But a few weeks go by and your back at it again but this time with plant. Touching anything and everything. Not watching where you were going.
Fingers tracing along the delicate flesh of strange and new organisms.
Flying geckos catch your eye, spinning in rapid circles moving through the air. You chase after them mindlessly. Until a large pair of arms scoop you up. You look down and see a steep drop. You could have been really hurt.
"Stupid- Don't know why i bother-"
yeah you got cusses out real hard.
Eventually that was what he did, scoop you up and walk away. It was easier then letting you get yourself hurt.
the joke was made more than once that you were a child trapped in an adults body. the issue was, you weren't childish, or immature or clueless. Well maybe the later on occasion. You were just an air head.
one time some of the recoms decided to mock you in a slightly cruel manner. They got a laser pointer and hid behind a bunch of equipment. they shone the light in front of your face. waiting to see your head jump in the direction of the circular shape.
It did, and the excitement drained from your eyes as soon as their laughter rang out. Miles intervened quickly pulling the device away from them and crushing it beneath his boot. He placed his hand on the small of your back. ushering you away.
ready to sooth you and comfort you. however you needed.
291 notes · View notes
dendrophalaen · 5 months
Text
my thoughts on godzilla minus one
Tumblr media Tumblr media
tl;dr i had a religious experience (positive) and it may be my new favorite godzilla movie
i'm going to try to organize my thoughts lmao i have never done a film analysis or review
story
i went in knowing next to nothing, so i was very afraid this was going to be heavy on the imperialist propaganda and reminiscing on the "good old days" of the japanese military
however i was pleasantly surprised to see that it was quite anti-government :]
loved the delivery of the themes of "all lives being precious" and "living on for yourself as well as for the sake of others" – not hammy or blunt!
FORESHADOWING OF THE EJECTION SEAT? chef's KISS we love picking up what the movie is putting down and getting to see the payoff
speaking of foreshadowing:
dr. noda: [takes noriko's picture]
me: oh no she's going to die
i spent like the last quarter of the movie with a headache because i was clenching my teeth and holding in tears after noriko's death ("death") AND koichi planning to blow himself up and orphan akiko
and all the ex-navy guys rallying together to defeat godzilla
i am not immune to classic story beats
semi-related i thought noriko would be covered in radiation burns, but then i realized a depiction of that would probably be insensitive
also the guys measuring radiation in plastic costs? come on now i know we weren't fully educated in the risks of radiation but there must've been some sort of better ppe
characters
i enjoyed like every character which is rare for me in a godzilla film
koichi just can't catch a break. this man gained so much trauma in a short amount of time, like he doesn't have ptsd because the trauma is ONGOING. i think he's my favorite and it's very easy to root for him
his introduction is of him as a shaky baby-faced pilot and then you find out he was supposed to be a kamikaze pilot like goddamn
i liked noriko's assertiveness ("hey i'm staying in your house now :)") and her ability to see kindness in koichi and sumiko
her struggle of wanting to become independent is very relatable. you could see the bittersweetness in her eyes showing that she felt guilty yet grateful for koichi's support........
i was surprised how quickly sumiko agreed to taking care of akiko? but it makes sense since she was (is) a mother and could not bear to see another child suffer, and akiko gave her life a new purpose
i would've liked more focus on the female characters and i don't think it's fair to just blame it on the era :playdead:
i really liked the chemistry between dr. noda, captain akitsu, and mizushima
dr. noda in particular felt like a nice foil/parallel to serizawa from the 1954 movie; he's also a scientist but he's much more personable(?)/"human"
dr. serizawa was my favorite in 1954 but he was very anguished and set on making reparations by killing godzilla (and koichi could be a parallel to him in that regard)
noda focused on protecting the living, not avenging the dead
ough mizushima. being a Youth who feels useless sure hits home
i'd say tachibana is my least favorite just by comparison to everyone else, but he's honestly so valid for his whole deal
visuals and sound
very elegant color grading, costuming, and set design!
i don't know film girl help
GOOD SOUNDTRACK the music set the scenes so well
i joked about getting my eardrums blasted by godzilla but he really was that loud. as he should be
godzilla (design, abilities, etc)
SWEET JESUS THIS IS THE SCARIEST GODZILLA BY FAR
godzilla: [shows up in the first 10 minutes with blair witch shaky cam]
me: the filmmakers are not messing around they mean BUSINESS
the rampage on odo island was rightfully terrifying
i love his texture and face. the scrunkliness of heisei with the horrifying pain of shin
i think his head is a bit small for his body, like if it was 5% bigger it would be perfect
loved the visuals of his scales flaking off after getting bombed
the nuclear fallout when he used his atomic breath in tokyo was awe-inducing
great use of godzilla as a war allegory
i saw the movie in d-box so the shotgun-blast of heat ray was intense
also coolest godzilla death. sick decapitation
the plan to imprison him in bubbles and give him the bends felt a bit silly in the moment but highlighted how desperate everyone was for ANYTHING to work
really liked how godzilla was more like an animal or unstoppable force of nature without a clear motive
i mean the only emotion you could ascribe is probably RAGE
sidenote i did think it was a lil funny whenever an object was flung through the air from offscreen. there goes godzilla having another tantrum
116 notes · View notes
ellies-star · 1 year
Text
Tumblr media
something about july. pt 1
pairing. outdoors staff! ellie williams x pool staff f! reader. 
synopsis. ellie has been working at this summer camp for the last 5 years, and when she spots you for the first time blowing up pool floats with Dina, she knows she's in trouble. ellie and reader find themselves flirting every chance they get, pulling pranks and having a sweet summer fling. warnings. right now it's just fluff and wholesome, use of y/n, friends to lovers trope but eventual 18+. eventual mention and usage of substances, drunk/high kissing, and makeout woot woot.
an. lol so this is my first time writing a fic in a while. wanted smthn that would make you wanna kick your feet and giggle, so i present to you part one of summer camp ellie and reader <3 p.s. apologies in advance, editing as I go lol.
Tumblr media
It's 9:00 am on a Saturday in July, and Ellie pulls up to the campground that's already buzzing with excitement and chatter. Dust flies behind her truck as she drives along the dirt road and gravel through the camp. Window down, the summer breeze and smell of pine fills her car bringing a smile to her lips. Damn I missed this, she thinks.
She immediately recognizes her friends and fellow staff among the small crowd, they work hard to move tables and haul in groceries for this weeks meals, others are organizing gear and supplies for hikes– which she should be doing at this moment.
"You're late Williams!" Ellie looks to her left to find the source of the oh so familiar playful chide. The camp director approaches her car with a grin on her face. She slows down to pull up next to the woman, leaning her left arm out the window.
"Morning Maggie, beautiful start to the week, huh?" She looks at the older woman, salt and pepper hair in a wild bun, navy blue t-shirt with the camp's logo written across the front and back in a faded white. Her busy clipboard propped against her hip cladded in worn-out denim jeans. She embodies camp mom in every single way, and Ellie missed her like no other.
"It would be, if all of my staff got here on time!" She smacks Ellie's arm playfully with her hand. "We got new staff this year, and the boys are already tormenting them!" She turns around to point to Joel and Tommy under the roof of the mess hall on the left. The brothers laughing as they already finish tying one of the new outdoors crew members' shoes to the beam.
Ellie sticks her head out the window to shout to them. "Better hide the ladder once you're done!"
"Don't worry, already on it!" Tommy turns around almost falling off the thing, but shouts back with a grin.
"How could I forget, you're just as bad as they are." Maggie rolls her eyes. Ellie laughs at her response, getting more excited for what's in store. Joel looks passed Tommy, using his hand to shade his eyes.
"Get your ass over here Williams, these boxes ain't gonna move themselves!"
"I'm coming, hold your horses old man!" Ellie shouts back. She shakes her head and diverts her attention back to the lady with places to be.
"Hurry up now, and be nice to the boys! God knows those two won't. See you later chickadee." Maggie pats her car door to send Ellie off, before giving her a wink.
Ellie drives off to park her truck by the pool and other cars shaded beneath the line of ponderosa pine. It's still pretty early, but the sun's hot beams are brutal right now. Stepping out of the truck, she takes off her green flannel and tosses it onto her tattered passenger seat. Seconds after the slam of her truck door, she is greeted by a warm breeze and another friendly face.
"Ellie! You're here!" She turns around to see Dina peering over the wooden pool fence to say hello. Ellie instantly walks to the gate door to meet Dina for a sweaty hug.
"It's good to see ya D!" Ellie laughs squeezing her tight and taking in the smell of her freshly applied sunscreen. She pulls back, and Dina comments like everyone else she’s seen.
"You're like an hour late." Ellie scoffs.
"I know! Don't blame me, blame Florence." Ellie groans pointing to her overheated white 1999 Ford Ranger. Dina rolls her eyes in response, but gets a burst of excitement. She almost forgot what made her so giddy in the first place. She grabs Ellie's shoulders with force and locks eyes. There’s a shift in the air between them with a sense of seriousness. Ellie doesn't know what to think, but stands confused and leaning back slightly. "What is it Dina..."
"Ellie, we got new swim staff."
"I know, I met them at the last meeting?"
"No Ellie, you didn't meet this one." Ellie quirks a brow looking at Dina with a puzzled eye.
"Dina what are you talking about–"
"Ellie she's cute, and gay." Dina emphasizes, cutting her off to nod her chin to hint what's behind her– or more importantly who.
"Again, what are you talking about?" Dina turns around and pulls Ellie to her side to reveal the sight by the other end of the pool.
As a few other new staff members begin to move away from the shed, behold there you are barely out of reach of the pool structures shade, glistening in the sun. Your skin tanned and kissed by freckles, and exposed in your yellow bikini top and denim shorts. Your hair tied up in messy ponytail, loose pieces stick to your back from sunscreen and sweat.
"oh, that's what you're talking about..." Ellie's eyes widen. Dina looks at Ellie and giggles like a school girl.
It's funny, while Ellie gawks at you, you look quite silly bent over struggling to blow up pool floaties alongside Jesse. She can hear you arguing with him over how many blow up balls versus rings you need.
Dina knows what she's doing, and already feels the need to play matchmaker.
Grabbing Ellies hand and giving her a devilish grin, she begins to pull her along the edge of the pool towards the two of you. "Jesse look whose here!" Dina announces giggling.
Ellie's heart quickens, her nerves sinking in. The thing is, she hasn't talked to a pretty gay girl in, let's be honest, a while. And on top of that, she's also an over thinker. So she has indeed already exhausted every encounter or issue that could errupt after talking to you.
"What are you doing?!" Ellie whisper panics trying to pull away without looking too suspicious, Dina just snickers in response as they both now stand in front of the two pool staff attempting to blow up a giant turtle floaty.
You hardly notice the two girls that come up, you are too caught up in your mission to find the other air pump in the ridiculous wooden chest of a mess overflowing with pool toys and goggles.
Jesse looks up before his face falls into a big smile. "Aye you finally made it!" He beams while standing up. Ellie tries to focus on giving him a hug, but all she can think about is who this mysterious girl in a small yellow bikini is.
Your back was to the three of them before you turn around. You briefly scan the over the two girls before locking eyes with the one you've never seen before. You first notice her tank top, Patagonia baggies and dirty blue vans. Her shoulder length auburn hair was tied half up half down, but a few pieces escaped framing her face. Freckles sprayed across her nose and cheeks, and her green eyes never left yours.
Everything about her screamed gay, and hot.
Dina and Jesse watch as the two of you stare blankly at one another, unsure what to say– Ellie is afraid to take a breath from the looks of it, her cheeks are showing the slightest shade of pink.
"Y/N this is Ellie! We grew up going to camp together with Jesse, and now she's been working in outdoors for about 5 years now!" Dina grins after her introduction, nudging Ellie's arm with her elbow to say hello.
But all she could think was holy shit, cute girl cute girl cute girl...
"Uh, hi yeah I'm Ellie, nice to meet you." She sticks her hand out, showing off her right forearm; covered in the most gorgeous tattoo you've ever seen.
"Hi Ellie, i'm Y/N." You smile, shaking her hand– it's a little sweaty which you blame on the heat, but she blames on you. Your eyes flicker back to her arm. "I really like your tattoo! It's really pretty." You beam as you let her hand go.
You're really pretty. She makes a note to herself to never wear a long sleeve around you ever.
"Oh thanks, I got it a few years ago." She replies, unsure of what to add. God why do pretty girls make my brain go dumb?
Just as Dina was about to intervene, Tommy calls for Ellie over the fence. "Ellie, Joel needs your help planning the first 3 day hikes, Mia can't go!" He shouts before walking back towards the outdoors tent.
She turns her head back and shouts that she's coming before turning back to look at you, a small smile forms on her lips. "I gotta go before Joel kills me, but uh– it was nice meeting you."
You offer a smile and a "you too" in return as she heads back towards the pool gate. She looks back one last time and you give a little wave.
Of course this small interaction made her chest flutter, and knees weak. She fought every fibre in her body to not look back at you. As she walked towards the group of boys all she could think to herself was: I'm in trouble for sure.
161 notes · View notes