#I will make a post with all my links so everyone can check at them!

[ahmadturk-family]

🚨 Urgent Clarification Regarding Our Fundraising Campaign 🚨

⚠️ Please take a moment—this post is important and urgent. Do not ignore it.

To all our incredible supporters,

I’m writing to urgently address some confusion surrounding our new fundraising campaign. I want to be absolutely clear—this campaign is 100% legitimate. There have been concerns that this new campaign is a scam, despite us explaining everything in detail before the previous one was closed.

🔹 Why did we start a new campaign? We’ve already explained the reason in this video and this vedio and provided a detailed update on the original campaign here. Please take a moment to check both if you haven't already.

🔹 We are the same people, the same family Our situation hasn’t changed—we are still here in Gaza, and we still need your generous support. Every donation you made before made a difference, and we need your help again.

✅ And this is the testimony of one of the specialists, where I communicated with them personally: @funds4gaza @dlxxv-vetted-donations

✅ In addition to Nabulsi and the guy Hussein al-Din they have already documented my campaign: @nabulsi @el-shab-hussein

💡 How can you help? Please support the new campaign just as you did the previous one. Your kindness and generosity have carried us through tough times, and we are asking for that support again. Every contribution, no matter how small, brings us one step closer to safety and security.

🖼️ Update from the original campaign Here is a screenshot of the update we posted on the old campaign to clarify our situation:

🙏 Thank you from the bottom of our hearts. Please, donate to the new campaign and help spread the word.

Make sure to fill in the following:

[Link to the old campaign]

[Link to the new campaign]

[Link to the explanatory video] and here

Image of the update from the old campaign.

This layout provides clear places for each resource!

Please share this message widely so that everyone who cares and those who support the cause can stay informed about the campaign and its progress.🙏🏻

@nabulsi @palipunk @sar-soor @neptunerings @plomegranate @vakarians-babe @mesetacadre

@hack-saw2004 @neechees @spacebeyonce

@shattered-glasswork

@magnus-rhymes-with-swagness @malcriada

@heritageposts @feluka @appsa @meshitsukai @acepumpkinpatrick @captions-blog @dykesbat

@the-bastard-king @neptuneringzz

@apollos-celticswan @el-shabazzgifted

@brutaliakhoa @turtletoria @timetravellingkitty

@schoolhater @brokenbackmountain @dykesbat

@northgazaupdates2

@queerstudiesnatural @palestine-info-uncensored

@kordeliiius @kotoshino @busysleeping

@freepeople @futomimi @ibtisam @longlivepalestina

@palestine-info-uncensored @fallahi

@vakarian-shepard @plomegranate @stil-macher

@gaza-evacuation-funds

[blackpearlblast]

list of GFMs for families trying to evacuate gaza

making a list of all of the fundraisers of people who have reached out to me directly on here in order to have them all in one place. all of them have either been vetted by other users or i verified them personally by checking their other social media accounts (like twitter or instagram) to confirm. everyone here definitely needs support, a lot of their family members are injured or in need of medical care that is not available in gaza. i am also linking their tumblr accounts so that you can follow them to keep up with their campaigns.

Ezzideen Shehab - @drezzideen his close friend and campaign runner is @boshradaoud1 - €23,727/75,000

Haya Orouq - @haya-orouq19 - $55,180/70,000 (USD)

Nesma Ahmed - @nesmamomen - $55,756/80,000 (USD)

Dina - (Nesma's sister) - $265/20,000 (CAD)

Hala - @hlabarka22 - $7,277/50,000 (CAD)

Sahar El Tibi - @eltibisahar - €8,925/30,000

Haneen Atya Altalla - @haneenatya - $31,661/70,000 (AUD)

Sujood Odeh - @sujoododeh - £27,691/70,000

Fatma Bassem - @fatmabassem - $18,515/40,000 (USD)

Donia Tanani - @doniatanani - €76,117/100,000

Nozha Emad - (Donia's sister) - €2,249/18,000

Said Tanani - (Donia's brother) - €33,759/50,000

Mohammed Emad - (Donia's family) - €1,073/100,000

Abdullah - @amhdes90 - $7,447/47,000 (USD)

Amal and Ruba Abushaban - Amal's account was terminated but her sister Ruba is @rubashabansblog - €12,987/50,000

Mahmoud ElTibi - @mahmoodeltibi - €9,076/60,000

Heba Maqadma - @hebaalmaqadma - €60,915/80,000

Fadi Sharif - @fadisharif11 - $25,232/62,500 (USD)

Mohammed Bardaweel - @mohbardaweel - €3,948/37,000

Ahmed N. Abubaker - @ahmednabubak - €25,868/85,000

Alaa Al Khateeb - @alaagaza - £20,457/26,000

Ahmad Shaban - @ahmd-iyd - £6,146/150,000

Omar - @omarsobhi - €4,253/20,000

Wesam and Tahani Shorbaje - @wesamshorbaje-2 and @tahanishorbaje2 - $8,093/50,000 (USD)

Fahed Shehab - @fahedshehab - €5,416/50,000

Hani Alhajjar - @skatehani - €14,365/50,000

Amneh Sharif - @amnehsharif - $4,550/150,000 (USD)

Mohammed Talatene - @mohammed-123 - €7,530/20,000

Bilal - @bilal-salah0 - €21,938/70,000

Amjad Sido - @amjadsido - €1,333/30,000

Firas Salem - @firassalemgaza - €17,414/65,000

Mahmoud Balousha - @bba3lo - €5,654/50,000

Amal Abu Shammala - @amalisam96 - €46,170/50,000

Madleen - @mado-o-on - $45,991/70,000 (USD)

Iman Eyad - @imanblogs - £1,787/60,000

Deaa - @familydeea - $22,453/90,000 (CAD)

Laila Shaqura - @lailashaqoura - €2,033/35,000

Wafaa Alnhl - @wafs-posts - €15,309/50,000

Shahed - @shahednhall - $662/50,000 (USD)

Alaa Ayad - @hello-alaa-universe-blog - $2,438/50,000 (AUD)

Momen Alostaz - @momenalostaz - €7,781/70,000

Tawfik Satoom - @tawfiksatooom -$11,555/40,000 (USD)

Mahmoud Saleh - @mide404 - €1,754/20,000

Ahmad Alturk - @ahmadturk00 - €5,915/70,000

Bahaa Elhosary - @bobelhosary - €15,577/30,000

Malk Zaeem - @malkzaeem - $14,413/50,000

Mahmoud Helles - @hillesmahmoud - €15,752/20,000

Karam Al-Nabih - @karamrafeek - €7,115/20,000

Ahmad Waleed - @ahmadwaleeed - $3,106/10,000

please also see @el-shab-hussein's full list of verified campaigns here, most of the campaigns here were verified by him or other tumblr users such as sayruq, fairuzfan, ibtisams, and others. please note my ability to vet campaigns myself is limited to if someone has an active social media account (that clearly shows that they are from gaza) from before october of last year that links to their campaign. please do not consider me a resource on this, i made this post only to make sure i did not lose track of the campaigns people had personally reached out and asked me to share.

[shadowfoxsilver]

Some tips and tricks on how to spot scam accounts in general. This isn’t a detailed explanation as I have more info on my other blog but here is some general things to go by and what to look out for overall.

The pinned post is only a few days old or even a few hours old. The text may occasionally be multicolored for the link.

The ask they sent you seems catered to a specific issue or event and looks very odd if you read it throughly. Text might seem out of place or make no sense at all by a health standpoint.

They sent you an ask after following you and have no prior interactions and isn’t someone you’ve met before. This is usually prompted when interacting with a trending post or sharing a post related to certain topics.

The blog doesn’t have very many posts. It’s usually limited to a few posts from a trending tag, a popular topic, or catered to pass at a simple glance if you don’t scroll far enough down. Most posts are made the same time as the pinned and shared seconds apart.

Even if your bio says no aid asks, the account will send you one anyway because they don’t read or don’t care they just want your money and will keep spamming asks until you share the post or block them.

Sometimes the same ask is sent from multiple accounts all using the same story and setting as the account that sent it to you at a different time. Any errors in the text don’t get fixed and it’s usually a quick way it’s a scam.

The accounts usually base their blogs overall theme around whatever is going on at that moment more often then anything else.

Sometimes the ask is about sharing their pet aid post. Any images used may be stolen off somewhere else so it’s advised to ask them questions back and see what they can tell you and if it matches.

On occasion they’ll say to answer privately because they don’t want anyone else to see the ask.

In general, most strangers asking you for money in your inbox found you from searching tags and you need to check and ensure their being honest as scammers unfortunately exist. Not everyone asking for money is a scammer! Just do your research.

[lieahsblog]

i’ve run out of smart words and metaphors, just please please help this father from gaza evacuate his son for treatment. the goal is $15k please help them reach this ASAP.

EDIT: UPDATED campaign link for Fadi has been posted so keep scrolling. I also posted the campaign link of razan(see pinned) who’s mother needs treatment. Razan’s campaign has fallen under the radar so please share and donate. Please scroll and read the whole post for the crucial info. thanks for sharing!

EDIT: CAN YOU ALL PLEASE AMPLIFY MY PINNED AS WELL!! PLEASE SHARE THIS POST BUT ALSO MY PINNED POST!!!!!!! ITS URGENT SO DONT IGNORE. DONT KNOW HOW MANY OTHER WAYS TO TELL YOU. RAZANS FAMILY STILL NEEDS TO GO TO EGYPT SO PLEASE SHARE MY PINNED AND DONATE!!!!! THERE NEEDS TO BE DONATIONS, REBLOGS ALONE CANT PAY FOR THEIR REGISTRATION TO LEAVE. DONATE PLEASE

edit: are u guys even reading the edits. AMPLIFY RAZANS CAMPAIGN. ‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️

UPDATE TO EVERYONE REBLOGGING: Fadi and his family have evacuated to egypt now. They still need to cover living expenses AND his medical expenses for his son so this is Fadi’s new campaign: https://www.gofundme.com/f/brain-surgery-of-a-sixyearold-child-due-atrophy?utm_campaign=p_cp+share-sheet&utm_medium=chat&utm_source=whatsApp

this is Fadi’s p@yp@l to help with their living expenses: https://www.paypal.com/donate/?hosted_button_id=GLVYEA82FPMX2

MORE URGENT INFO: I would like to add that another family needs your help. I’ve made several posts about Razan’s family(including her mother who needs treatment) and this campaign has fallen under the radar. their goal is $50k and they have not raised even half. we really need to pick up the slack, so i would like to please ask everyone to donate to razan’s campaign AND find a friend to match your donation!! one you have done so, please make your own post about razan’s campaign and share it with all your mutuals. we need this campaign to have so much more visibility so please join me in amplifying and #floodthedash4razan!! let’s work together and help razan and her family. give some love, support and donations towards razan’s campaign‼️‼️ I would like to direct everyone to please AMPLIFY and share Razan’s campaign(please also checked my pinned where you can see more about her campaign!!) i will also share her campaign in this post, again please show some support and amplify and donate to her:

Thank you all for sharing!

[nerdystarlightlove]

Hey howdy hey, neighbors! ❤️

I made some ACNH custom designs for Welcome Home! <3 I've become really invested in the ARG, and it inspired me so much that I just had to make something for it! I'm still working on Frank, Barnaby and Poppy, but I was too excited to wait until all of them were done, so please take these! :0D

(Also: I know the name of the Custom Design Creator is different from the name in my bio, and that's because I made these designs on my sister's profile, which is the only profile on our island with connection to the internet and stuff like the Custom Design Portal. I just felt the need to clarify! <3)

Most importantly, all of the artwork - not to mention the wonderful Welcome Home ARG as a whole - belongs to @partycoffin! Their work is seriously so amazing, and I highly recommend checking them out!

If you're considering getting into Welcome Home, please be aware that it's a horror ARG with elements such as gore/blood, heavy eye contact and staring, unreality/derealization, and puppets/mannequins. It's still being developed, but if any of these may trigger you, then it's probably best to avoid it so as to keep yourself safe!

That's all for now, friends! Bye! :D

Edit: Frank’s Custom Design is now done! It can be found using the link below! ❤️

Edit: Barnaby and Poppy are finally here, meaning that the neighborhood is officially complete!

Also! Some of you have mentioned that you can't access these because you don't have Nintendo Online, so if you'd like me to post pictures of the patterns themselves in order to replicate them on your own account, then let me know and I'll be more than happy to do so! ❤️

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[rafeyscurtainbangs]

Rafehub.com - Rafe Cameron Plink Library

+18 Minor DNI

Pornstar!Rafe Cameron - P🔗 Library

Welcome to RafeHub.com

This p!link library was made with my lover @rafesthroatbaby

if you love pornstar!Rafe check out the sexy au created by our baby @starkeyisthelastname

The titles were “written by Rafe” to give it a typical porn-esque vibe. The white text is a little backstory 💋

⭐️ Back shots 💦💦💦 🍑Your first video with Rafe

⭐️ stretching u like only i can let me ruin you 4 everyone else

⭐️ i love teasing what’s mine let me play with your pussy while daddy gets you ready for his cock Rafe easing you into it after making you sore from your last shoot

⭐️ Am i too rough? I’m sorry. I’ll take it nice n easy 4 you baby. I’m gonna try to make it all fit i promise. 🤡 cum back for part 2 where i fuck this slut into the mattress

⭐️ two girls one rafe 😈 After a night of partying, you and Rafe bring another actress back to his house to play

⭐️ they love to share me i guess i’ll keep them both

⭐️ Making a mess on the couch. How many times do i make her squirt?? 😜 Rafe’s been stalking your videos since. He didn’t know you could squirt. Now he’s desperate to make you squirt multiple times on camera.

⭐️ Messy girl ❤️‍🔥 gonna need a shower after this shit 🥵

⭐️ Let The Pussy Destroyer satisfy your breeding kink ♥️ The only actress Rafe finishes in unprotected is you. He can’t help but whisper the dirtiest shit in your ear about how he’s gonna end your career because he fucked a baby into you. But what he gets off on the most is how he’ll never have to watch you fuck anyone else again.

⭐️ daddy dicking her ⬇️

⭐️ Let me destroy you - size kink king 🍆 she’s takin this dick like a champ Rafe is clearly obsessed with you and his followers are getting jealous

⭐️ I love using your tight pussy such a perfect fucktoy for me

⭐ What Rafe sends to you after you send him your nudes 📸

⭐️ had to sneak away from her boyfriend to get fucked by daddy. Do you think he’s doin this shit like me?? 😂Shooting with Rafe after he tells you that you can fuck whoever… You mean nothing to him. He didn’t realize how wrong he was ‘til it happened. His jealousy also went into overdrive after he found out that the other actor was an ex of yours. Of course he keeps that shit to himself.

⭐️ you just don’t stop cummin do you?

⭐ mine 📸 Rafe’s petty-ass posting this GIF online and sending it to your ex

⭐️ cum give daddy a hand and stroke me til I’m emptyDenying Rafe pussy because he won’t use his words and tell you how he feels when you can tell he’s annoyed

⭐ covering her with my load

⭐️ atta girl swallow daddy’s dick

⭐️ not gonna lie this chick fucked me look at her creamin on my big dick Fucking Rafe on camera after rumors circulate about him and another mattress actress. He put in an extra effort after getting his feelings hurt and now he regrets it completely

⭐️ she says she hates me… turns out she just needed some good dick

⭐️ she loves gettin slapped and fucked dumb Getting fucked rough after ignoring Rafe’s calls

⭐️ keep screaming for me. You think I’m gonna stop? 😂

⭐️ Babygirl couldn’t wait until the movie ended so i fucked her like the impatient slut she is Rafe invites you over for a movie. When you ask him if it’s a date he brushes you off because he’s too scared to get attached. “Nah, princess. We’re just hanging out. Thought we could relax and shoot some shit when we got bored.”

⭐️ my little anal queen’s so good 💦🍑 clenching and tightening around my dick

⭐️ 🩷My tongue and fingers are magic princess lay back and let daddy Rafe make you feel like a pretty little slut🩷 First video after Rafe finally tells you how he feels

⭐️ Trying new angles while I stretch out that perfect pussy 💯

⭐️ she came 2 play 🥵 little promo 4 you filthy slut. comment below it u want some more ⬇️⬇️⬇️⬇️ You both love money and sex. You don’t want to stop shooting, so you make a couples OnlyFans account instead, putting out a few promos on Twitter

⭐️ 🎀little miss innocent before she met me🎀

⭐️ U got me stroking my shit… can’t stop thinking about you Leaving Rafe for the weekend while you go on vacation with your friends. He’s so pussy whipped you have him playing with himself

⭐ Her 🤍📸 Rafe posting and watching some softer GIFs when you’re gone because he misses his babygirl

⭐️ Had to pull over cause she looked too fuckin good Rafe picking you up from the airport and he couldn’t even wait til you got home

⭐️ she loves that cameron cum 👑 think she’s the one

⭐️ think she likes her new gift ⛓️‍💥😈 Shooting content for your OnlyFans - switching it up with cuffs and masks

⭐️ heard you sluts liked masks

⭐️ look at you all tied up with your legs wide open and your dripping wet pussy throbbing waiting for some cameron cock

⭐️ Be a good girl and cum with Daddy while he plays with your toys 😈

Like, reblog, and comment to show us some love 🤍 @rafesthroatbaby inbox is open for any love you want to send her way as well!!

my masterlist 🔮

[sejianismodding]

☠️ REMINDER: Double-check the OP for updates!

Best you get to know me right away. https://answers.ea.com/t5/Bug-Reports/OPEN-Spine-distortion-on-male-Sims-with-female-frame/td-p/13895791

[BG+] BUGFIX - Update 7/23/2024 broke Sim bodies. This fixes us. 🌺

⚔️ This affects everyone who installed Update 7/23/2024.

🚀 Initial Release - 7/30/2024

🔄 8/8/2024 - [✔️] Glasses were fixed, eyelashes were broken, and our spines are still broken. This mod is still required.

🎁 SFS - http://www.simfileshare.net/download/4829912/

🎁 CF - https://www.curseforge.com/sims4/mods/bg-bugfix-for-patch-240723

✒️ EAxis broke or improperly modified 18 Deformer Maps that affect the shape of our bodies and specifically our spines. Male sims with Feminine Frames will see their spines raising out of their backs, Female sims with Masculine Frames will see their spines sinking into their backs and Female and Male sims with Default Frames will experience the aforementioned issues when intentionally or unintentionally (because of EAxis' continued use of incorrect PartFlags) wearing clothing made for the opposite frame. This mod restores the old Deformer Maps and fixes all of us.

🗺️ Progress & Discussions Post: https://www.patreon.com/posts/109088001

🗺️ Modding Announcements Post: https://www.patreon.com/posts/10929150

💬 I Want To Believe™ that EAxis will officially fix us eventually. I explained the problem and the solution on AHQ. I will "refresh" these files when they do, if they actually modify the files and don't just restore them like I have. It might be a good idea to keep this in your Mods folder permanently now that we know EAxis can screw with us like this. If it happened once, chances are it can happen again.

💜 Thanks for the engagement and the reblogs and ♪ you're welcome! EAxis is taking too long and seeing my sim that way was making me sad and angry. If it wasn't for a random Body Preset mod giving me some insight and two of my not-yet-updated simmer friends graciously exporting and sharing a ton of files from 1.107.151.1020 with me until I found the culprit, this fix might not have happened so soon. I'm currently working on AnimXGenWear but when I've got some time I will add a tutorial to the Progress & Discussions post linked above showing you how to do this in the future in the event I go MIA. Keep in mind that for right now, unless you've got access to 1.107.151.1020 files, you cannot do this because the Deformer Maps are still broken. Cheers!

💜 @xandezsims said I could nick the animated thingamajig. Danke!

👾 I should have left this in. In case you noticed it, the Glasses Distortion described HERE possibly cannot be fixed by mods. I tracked the culprit to the actual EXE file.

👹 FIVE (5) updates, TWO (2) new Kits, ONE (1) upcoming FOMO Event, ONE (1) announced Expansion Pack and still no fix for our bodies. I've gone the extra mile now and listed all 18 Deformer Maps in my most recent comment on the Bug Report: https://answers.ea.com/t5/Bug-Reports/OPEN-Spine-distortion-on-male-Sims-with-female-frame/m-p/14053376/highlight/true#M293677

I think I've got my short-form formatting now! 😺

[empty-movement]

Chiho Saito’s 1999 Revolutionary Girl Utena Original Illustration Collection

IT’S HERE. IT’S DONE. IT’S FINISHED. NOW…IT’S YOURS. Happy Holidays, my friends.

Vanna here! I have posted some already about this project, and the responses I got, public and otherwise, have been absolutely incredible. Y’all have been reblogging and hyping this before it even finished…I haven’t felt so encouraged about an Utena project since the musicals! (Yes, streams soon, I promise.) You can read the other post to get more details, and catch my post here with more details about the process if you’re interested. The long and short of it?

This is the first artbook I ever scanned. I did it in 2001. In Photoshop, using multiple scans per page that took hours to process. But it was 2001. A half megabyte file that was 1250px wide was considered extremely hardcore and impressive. That’s just always been the business I’m in when it comes to Utena art, you know? 

It’s now the latest artbook I’ve scanned, and so much of the process, and effort involved, is unchanged. What has changed, is the result. Welcome to your new desktop background. Your new phone background. Your new poster print. 

What I’ve done here is attempt to create definitive digitized images of Chiho Saito’s work as offered by this book--I have removed the print moiré of the original scans, and used my literal decades of experience to try and tease out as much information from them as possible. Without being physically in front of the original artwork (which is a thing I’ve had the great fortune to get to do) this is The Most Chiho Saito you are ever going to get. I’ve tried my best to make sure there is a way to get it that works for everyone:

Do you just wanna scope 'em out? Look at some disaster gays? Grab your favorite one or two? This is the path for you! Check out the ‘compressed’ (not very) 10k ‘web friendly’ (not really) copy at the Bibliothèque, the media archiving wing of the Something Eternal forums at Empty Movement*. All the following links are also available from here. Do you want these copies? All of them? Don't just grab them individually, friend. This batch is 375MB and can be downloaded as a zip of the individual files here on our Google Drive.

Do you like digital archiving? Are you looking for a copy that preserves the archival quality of the effort but sits nice and comfy in a single file? This is for you. A minimally compressed 10k, 513MB version worked into a PDF is now up, shiny and chrome, on the Internet Archive. Do you like the idea of the minimal compression, but want the individual files in a zip? Yep I did that too, here's the drive link.

Are you looking to print these in a larger size? This is probably the only reason on Earth you’d ever want them, and yet a bunch of you are going to go straight for these. Here are the zero-compression JPG full size copies, most of them are 15k across, like simply a ridiculous size. Pick your fave and download it from our Google Drive! 

I am genuinely really proud of this work.** I was able to tease out so much new detail from these…her incredible layering techniques, the faintest brush of her highlights, and the full range of her delicate hand at whites and blacks… details commonly lost in digitization. I sincerely hope you find something here that you’re looking for, as an artist looking for inspiration, as a weeb looking for a desktop, as an archiver excited to see incredible 90s manga artwork saved forever in the digital realm. I feel like I have already said so much about them, and could keep going, but you know what? This work speaks for itself. Enjoy, use, explore, and definitely tell us what you think!

We love y’all. ~ Vanna & Yasha

* AHEM ASTERISK AHEM

You might be wondering what any of that is. Something Eternal? Biblewhatawhat??? EmptyMovement.com? You might even have done a double take at the word ‘forum.’ And you should!!!

I have a confession. This artbook was my ‘side project’ as I worked on this, *the main project.* For a couple years I’ve been banging around with a new domain, and originally I had other plans for it, but Elon Musk ruined my Twitter and Discord is well along on its way to enshittification, and well….we joke on the Discord a lot about ‘reject modernity, embrace forums’ and you know what? We’re right. So Yasha and I are putting our money where our mouths are once again, and doing something insane. We are launching, in 2023, a website forum. Obviously, this is not the official ‘launch’ per se, but I cannot announce the artbook without directing you to the forum, since it sits on the attached very cool gallery system. Oops! Told on myself. Another post more focused on the forum will be forthcoming, but if you are just that motivated to get in right away, you absolutely can! (This will help stagger new arrivals anyway, which is good for us!) If you would rather wait for the ‘official’ launch, by all means that’s coming, including a lengthy screed about how and why we’re doing this. In either case, remember: this is a couple weebs trying to make internet magic happen, we are not website developers by trade. Give us grace as we iron things out and grow into this cool new website thingie…hopefully along with some of you! :D

If you do join up, naturally, there is a thread about this project!

** If you like this kind of content, consider helping us pay for it! We do have a Patreon! If you’re wanting to use these in some public-facing distributive way, all we ask is for credit back to Empty Movement (ohtori.nu or emptymovement.com, either will work.) 

I would like to say ‘don’t just slap these files on RedBubble to get easy money’ but I know that saying this won’t effectively prevent it. Y’all that do that suck, but you’re not worth letting it rain on the rest of this parade. :)

[mewtwoandme]

I was hoping this would all blow over, but since it's continuing to happen, now with people attacking other artists of the commewnity. I'm putting out my two fucking cents! Cause this whole art/character theft and pointing fingers, who stole what from who bullshit it driving me up the fucking wall!!

Long story short, it started with me and one other blog whose name I won't mention publicly. Despite the horrible light they tried to paint me in, I don't want anyone going to this person and ganging up on them. This person had some serious bitterness towards more "popular" artists and claimed that I've made characters similar to theirs and once used a pose they apparently used before (which was a very common pose, considering it was a reference from the game version of mega Y). Since then, they had desperately tried to conjure up evidence, narrowing down to the most miniscule detail how I've been stealing from them when I hadn't even known their blog existed until I was forcefully thrown into that unnecessary drama with the unhinged call-out posts they've made. With this being said, I'd like to point out that they never came to me or addressed this concern with me in the first place. They had every opportunity to privately DM me if they had suspected I was "stealing," but no, simply because they already made up their mind that I was a thief, that was a good enough reason to lack common fucking sense and decency, making what should have been a private issue public, going on to villainize and dehumanize me. And apparently, it hasn't stopped with me either, cause recently I've been seeing other artists in the community having to deal with this where people are being white knights on high horses, pointing fingers on how one artist's mewtwo looks "the same" if not "totally identical" as another artist's mewtwo. I refuse to believe it's a coincidence. But what makes me disgusted is that since TC's post, apparently it's had the opposite effect on some people and they're hopping on this blame bandwagon like it's some damn media trend!!!

This is NOT okay! Nothing about this kind of behavior is funny! It's upsetting to all of us. We dont need you causing problems where there isn't any, thinking you're doing us a favor! The majority of us are adults for gods sake! We are old enough where we don't need other people coming to us being tattle tails saying this person did this and that. That's what little children do! If you suspect any form of theft, I think I speak for ALL creators in this commewnity that we'd prefer you DM us privately saying something like "Hey, I think this person is copying you, might wanna look into it." And if possible, provide a link to the art in question, for which we would kindly thank you for making us aware and we'll handle it ourselves from there. Just a brief, yet SIMPLE interaction...that's all we ask!!! Don't even come at me with "Well, it's scary attempting to talk to an artist that's well known." Or dare I say ~pOpUlAr~ If you claim that taking the first step to send me a quick DM makes you nervous, yet you have no problem making public call outs in posts or asks, belittling and degrading what could actually be innocent artists doing nothing wrong, literally leaving yourself open to all kinds of comments and opinions from all kinds of people....I'm sorry but your anxiety isn't as bad as you say it is then, if being rude and ignorant in a public post/ask is easier for you. If you come to us, shaming someone else who 9/10 probably isn't doing anything wrong, thinking you'll be in our good graces for doing so, sorry, you're not going to be told, "Good job!" with a pat on the back and given a lollipop! You're just being an asshole.

Quick reality check for everyone who's made it this far before I end this train wreck of a rant:

People can have similar ideas that coincide with one another! There's only so much you can do when a whole community is focused around drawing the same character! We mainly draw mewtwos and mews, you're bound to find a plethora of similar colors, patterns, and designs because of it! Creativity only goes so far when trying to stay true to a character and not stray too far. It's not a crime to take inspiration from other artists' characters, we actually encourage this! It makes us feel good that you liked something we've done and you want to incorporate it into your own designs! It makes us happy that we inspired you! The line is crossed when someone does a literal copy/paste of a character down to the exact detail, and they call it their own original creation. That my friends is what stealing actually is!

[embracing-the-ineffable]

Beware clickbait accusations

Hi fandom, here's what happened yesterday: A reporter named Rachel Johnson, who is the sister to Boris Johnson and a big terfy supporter of JK Rowling, released a 4-part true crime podcast featuring two women accusing Neil Gaiman of SA. Yesterday. The day before the UK elections. This post explores the possible political links in more detail.

CW: this post is free of graphic details, but if you follow these links, there may be explicit descriptions of sex, kink, and bdsm, plus mentions of mental illness and suicidal thoughts.

I want to believe and support survivors, and I also want to base my thoughts and actions on facts. I thought the xitter livestream commentary from Not Becky for all 4 episodes was very insightful. There's also a first episode transcript without extra commentary. (Edit: released after I wrote this post: the full audio plus transcripts for all four episodes of the podcast are now available to download here, or you can read all four transcripts in your browser.) I have since concluded (pending more time to think and read and learn, or any new information, of course):

This seems like the worst kind of clickbait, an unjustified mess that will hurt everyone involved (except possibly a few politicians who might benefit somehow, we'll see). The evidence the "reporters" present directly contradicts their accusations. They're counting on people reading headlines and not digging any deeper.

They tried to make something sinister where there was apparently consent and a caring relationship. Have they exploited one or both of these women? S, in particular, is described as vulnerable and with a history of unspecified mental illness. They have all of the message history between S and Neil, and her messages make the sexy stuff between the two of them sound enthusiastically consensual. There are even messages (multiple!) where she specifically says everything was consensual. Here's one:

They're playing horror music in the background to try to make us feel horrified, even as S reassures us that things were consensual. It's emotional manipulation by the reporters.

The times S sounds upset during the interview are the times she talks about Neil leaving her behind or not paying attention to her. Not the times she talks about consent violations. Her stories during the interview are inconsistent, and they contradict her messages with Neil and with others. Maybe we'll get better information from a more reputable news source, or maybe not, I don't know. I also don't know why anyone who cares about her would have advised her to do this interview.

Then they tracked down lots of other women who know/have dated Neil and they all had glowing things to say, except one other lover from 20 years ago, K. She described some bad sex, and then pointed to a time in their 2-year relationship when she felt something wasn't consensual and he thought it was. And after their breakup, they continued to text and flirt, for decades.

This podcast "exposé" feels like explosive clickbait with political ramifications. The evidence here doesn't support a pattern of poor conduct so much as establish Neil as a fellow well-meaning human with imperfect judgement. That doesn't mean the accusations are all made up; intimate partner violence is complicated, and the responsibility for checking in and getting regular enthusiastic consent from partners is very real, especially when kink or bdsm are involved.

I don't know what the right balance is here between supporting survivors, thinking critically, assuming good intentions, and waiting for better information, but I feel confident that this podcast alone is not enough to condemn anyone aside from the irresponsible journalists who inflicted it on the rest of us.

PS/edit: I'm tagging my relevant posts (mostly reblogs) with #ineffable grief, and you can see all of them here.

[marlenesluv]

Sly Fox, Dumb Bunny. (OP)

summary: being the mclaren admin, you’re quite close with the papaya boys, one more than the other…

note: never had a redhead/strawberry blonde fc, but i love red hair, so this is for all my redhead/strawberry blonde babes 😗 also this seems short :( i’m sorry, ill try to post again in a few!

based on this idea i had a while back -> post link

fc: bella anderson (bellaanderrson on insta)

pairing: oscar piastri x mclaren admin!fem reader

type: smau

warnings: very slight suggestive comment, not bad tho

masterlist here -> masterlist link

^ check my list for all posts! ^

liked by: oscarpiastri, landonorris, and 89,193 others

y/n.user: media day vibes + a photo kika insisted i include 😐

view comments…

francisca.cgomes: you look so pretty❤️🤗

↳ y/n.user: you looking in a mirror? bc yes you are

f1updates: favorite posts from the best admin in f1 🙏

oscarpiastri: look at me on that scooter

↳ y/n.user: scootah 🦘🇦🇺

↳ oscarpiastri: if you and lando could stop making fun of me now

↳ landonorris: you know we never will mate

papayaedits81: brooo, i love this trio sm :’)

user3: she’s too pretty to be stuck with these men ugh

↳ user6: you mean the hottest men on earth??

↳ user3: they aren’t that hot

↳ user6: *GASP* GET. OUT.😖

mclaren: slay queen

↳ danielricciardo: y/n we know it’s you

↳ mclaren: no…..

.・。.・゜✭・.・✫・゜・。.

liked by: landonorris, oscarpiastri, and 372,924 others

mclaren: 🧡💙double podium weekend💙🧡

view comments…

user5: somehow, y/n eats every time with her photos and posts

y/n.user: 🧡🧡🧡🧡

f1edits: y/n commenting on posts she makes is too good

4ln81op: PODIUMMMMMMM LFGGG

user9: WOOOOOHOOOOOOOO

oscarpiastri: cool photos!😎

↳ mclaren: thank you, mr. piastri 🫡

f2postsss: boom, double podium

opfanpage3: oscar looks so good in theseee

papayaboys: love these pics sm!! y/n, once again, you slayed this up

.・。.・゜✭・.・✫・゜・。.

your instagram story:

seen by: oscarpiastri, lilymhe, and 82,193 others

.・。.・゜✭・.・✫・゜・。.

liked by: oscarpiastri, logansargeant, and 92,203 others

y/n.user: preoccupied🌹

view comments…

f1updatepg: WOAH????

user7: hold up now, pump the breaks. WHO is that man???

paddockposts: y/nnnnn spill who this is????

landonorris: i know something everyone else doesn’ttttttt

↳ y/n.user: lando😳 zip it

↳ carlossainz55: he told me already….

↳ charles_leclerc: lol………..

↳ y/n.user: STOPPPPP

op81: oscar linking but not commenting?? fishy

francisca.cgomes: mwahahahaha i am matchmaker

y/nfanpage7: anyone else thinking it might be a driver??

↳ f1edit0: yea but who? i don’t wanna assume lando/oscar but she is closest to them, yknow?

↳ user4: i was thinking maybe logan idk

.・。.・゜✭・.・✫・゜・。.

texts with oscar:

.・。.・゜✭・.・✫・゜・。.

liked by: logansargeant, y/n.user, and 368,130 others

tagged: y/n.user

oscarpiastri: i would say she’s judy hoops because zootopia is one of her favorite movies, but she’s more nick wilde 🧡

view comments…

y/n.user: does that make you judy hoops?

↳ oscarpiastri: i’ll be judy if you’re nick, babe

↳ y/n.user: so i’m sly and you’re dumb?

↳ oscarpiastri: sure, but only you can call me dumb bunny🤷‍♂️

↳ pierregasly: y’know hes down bad when he’s into this shit

↳ francisca.cgomes: you’re talking? really

↳ y/n.user: LMAO

f1wags: HOLD UP. WAIT A MINUTE😳😳😳 I LOVE THIS

user5: this is calling me lonely in every language

formulawags7: WOAH keep it in your pants there oscar, talking bout “only you can call me dumb bunny” OK

op81edits: oscar having a gf just makes him more bold and i’m loving it

papayaedit9: they actually are so cute together stopppp

.・。.・゜✭・.・✫・゜・。.

oscar on a podcast, clip of him talking about you:

(interviews name: matt)

matt: “well, mate. i know we are running low on time now, but we are going to end it off with some fan questions.”

oscar: “awesome.”

matt: “alright, i’m not going to lie, a lot of people are very curious on how you and y/n started dating. who initiated it? how long?”

oscar: “um…yeah. kind of a long story, i’ll make it shot though.” *laughs* “when i came to mclaren last year, i actually had a crush on her and lando found out fairly quick. he started telling me her favorite foods, shows, hobbies, stuff like that. like, for example, one of her favorite shows is pretty little liars, so i binged that whole show just to try to talk to her about it.” *laughs and takes a sip of his water*

matt: “wow, man. thats a lot of seasons. did you at least enjoy it?” *laughs*

oscar: “honestly? yeah…it was quite entertaining. and i got a few conversations in with her about it.”

matt: “that’s really nice, i don’t think i’d have the attention span. now, how long have you guys been together?”

oscar: “well, i announced it last friday, and it’s thursday…probably around two months, i’d say.”

matt: “why did you guys decide to wait a bit?”

oscar: “we were a little worried about what my pr manager would say and we didn’t want either of us to get in trouble. but y/n was mainly worried about the fans. she didn’t want to upset them, but, i don’t really care. i mean, if a fan can’t understand and respect your relationship….”

matt: “then they really aren’t fans, are they? well, you two are absolutely adorable. tell y/n i say ‘hi’ and i send her good wishes for this upcoming year. you guys are the cutest, and i’m sure fans will agree.”

oscar: “thank you, mate.”

.・。.・゜✭・.・✫・゜・。.

your instagram story:

seen by: oscarpiastri, pierregasly, and 93,199 others

.・。.・゜✭・.・✫・゜・。.

(reposts, comments, and likes are appreciated!^-^)

[praisetheaxolotl]

The Arsonist Theory, Part 1: Mandibles!

Eight years ago, a few weeks shy of the day itself, I wrote something called The Arsonist Theory. It was my last theory post before making this blog, and looking back, it was disorganized, and I could have presented it better.

So, with new evidence, I'm doing just that.

The core of the theory is this: You don't blame the arson itself for a fire. You blame the arsonist that set the fire in the first place. There is a secret third piece of the puzzle here- not the act of arson, not the fire itself, but something more.

Therefore, consider this: Bill was not the sole perpetrator of the Euclidean Massacre. Rather, he was a weapon used to commit it.

Like the original, this will be a four-part theory, just to make it more digestible. I'll refer back to the original on occasion, but most of it will be new information.

Oh, and-

MAJOR, MAJOR SPOILERS FOR THE BOOK OF BILL UNDER THE CUT. THIS INCLUDES THE TEXT ITSELF AND SOLUTIONS TO CIPHERS.

With that out of the way, let's go.

In another post, I mentioned that the specific wording of "Saw his own dimension burn" having a very passive connotation to it, plus parts of the glitched page, shown here- make it incredibly likely, if not certain, that the massacre was an accident on Bill's part.

Bill's main intention was to show everyone what he had seen all along-- show them that he wasn't crazy. But that's not what happened.

Also, just as an aside- part three of the original theory has some examples of exact wording being a thing to pay attention to in matters surrounding Bill. It mostly concerns his deals with others, but in a Doylist sense, it tells us: exact wording is important with this character, so pay attention.

But let's put a pin in that for a second.

On the page teaching us how to trick everyone into loving us, there's a portion about conversation topics:

The cipher in the candy heart says "LIES," by the way, and it's the only cipher on the page- immediately setting this portion apart from all the others. Bill says here that one conversation topic on a date-- while meeting someone-- is the very specific term, "mandibles."

Say, where have I seen that recently?

Huh... that's interesting! What a specific word to come up twice, in these specific contexts! Remember what I said about exact wording? Sure you do, you have a very good memory, I admire that about you!

But that's not everything I noticed.

All that glitching? You can actually see text peeking out at certain points. And what does that text say?

"Nice to meet ya!"

Over and over and over again.

There's nothing else in my mind that can make this make sense to me. There was someone else there. He met up with someone.

But that's not all- I still have three more posts of evidence to write.

Check back here for links to them- they should all come out within the next day or two, and I'm gunning for all of it to be out before the countdown on thisisnotawebsitedotcom hits zero.

Part 2: We get it, the billboard is a metaphor

Part 3: Journey To The Vicious Spiral Nebula

Part 4: Blame The Arson, Not The Fire

[feeder86]

Feeder 86: The Top Ten

Can you believe that the Feeder86 ‘Orginal Gainer Stories’ blog will soon be posting the two hundredth story? I thought of many ways to celebrate. But then I stopped and realised that I would probably be best using the time to address one of the questions I get asked about most frequently. Which of the stories do I personally like the most?

This was not an easy list to make as I very rarely go back to re-read my own work after I have finished editing and posting them. This is not because I do not like them, but because I always see bits that I want to change. Nevertheless, this project was the perfect opportunity to revisit a few oldies that I remember being very proud of at the time. 

Hopefully you will see this list for what it is: a glimpse into how I write, my motivations and drive; rather than just a self indulgent pat on the back for myself. Yuck!

So, with that being said, let us begin...

#10 The Feeders’ Formula: This tale certainly had to be placed into the list. After all, it is the one that kicked off ‘Original Gainer Stories’ all those years ago. There are many amazing examples of instant body weight transformation stories out there. I felt that I needed to write this one as my contribution to the genre. It went down well at the time. I swiftly wrote a Part Two, then followed it up with others (The Feeders’ Formation, The Feeders’ Formalities, The Feeders’ Foreclosure, The Feeders’ Forecast, The Feeders’ Former Years), becoming something of an ongoing saga in recent years; focusing on the different Feeders from that very first meeting. As a writer who sometimes struggles to find the ending, these are wonderful to write as they all have the same inevitable conclusion. There is also so much freedom to be had when you’re working with characters who are pretty much pure evil. I know so much more about the Feeders than I’ve ever written down, so it is great to tease out those little details with each new installment. The newest of these tales (The Feeders’ Foreplay) was the darkest yet, but seems to have provoked a very favourable reaction from many. Who knows what the Feeders may get up to next? I do! And you can find out too, once we start a whole new sweeps season of stories this April! Come with me into The Feeders' Fortress!

#9 Only One: Where do I start? Only One has my absolute favourite type of feeder. Ben is big, sexy and very in control. He’s one of those rare types of guys who always stays on top and is a step ahead of absoultely everyone he meets. Who wouldn’t fall for him? I certainly did! In fact, I loved him so much that I wrote an entire prequel for him (and none of you even noticed!) Check out Rewire if you want to see how Ben became the man we know and love.

#8 The Wright Boys: The idea of a weight gain that cannot be stopped or controlled is a tempting one for many. How much easier would it be if you didn’t have to second guess your choices or face the pressure to lose weight? This was the first tale of what I see as ‘The Curses’ saga that eventually bled into many other stories (including another one on this list!) and culminated in Wright vs Beckett. However, this story remains my personal favourite of these. If you’re a fan of looking for crossovers between my stories, these are some of the most explicitly linked. I followed it up with a spin-off tale (The Wright Boys: DNA), but continue to have ideas about how I could go back to these boys in the future. Watch this space.

#7 Making Monsters: The title of this story really does give away how I felt about it at the time. This is quite the saga, spread over into not just two, but three parts! It began as a story that was very similar to Blackmailed; a tale that I had written previously about a guy voyeristically enjoying seeing his friend fatten up her boyfriend. However, this story evolved even further for me, with Tommy’s love of eating and gaining weight being both his greatest love, and his biggest shame. His denial only heightened the tension for me, and, when he does eventually give in, the gains feel all the more satisfying as a result.

#6 The Pig Feed: It’s not easy to write a gainer story where there isn’t another character spurring the events along and encouraging things. In this tale however, that role is given to a very tasty and surprisingly addictive pig feed mixture that Steve gets himself hooked on. It’s a story that I really enjoyed writing and still feel very happy with. I have considered writing more stories around this interesting feed. However, I am yet to do so; deciding (for now at least) that things are perhaps best left as they are. But, feel free to let me know your thoughts on this.

#5 Farm Boy: Whether you grew up in a big city, or a small rural community, like Hayden in this story, we can all relate to having desires and attractions that those around us don’t understand. And, thanks to how well connected we are these days, we now know what it’s like to realise that you’re not actually alone, and the whirlwind of excited emotions that follow. I enjoyed writing this story because I, quite simply, fell completely in love with Hayden. As kinky as he was, he still retained that fresh faced innocence throughout. If any of my characters were destined to be together forever, I imagine that these two would be my top choice.

#4 Keeping a Crush: This is one of those stories that I wrote in a matter of hours, and I was so pleased with it when I was done. Getting the train to go to work is not necessarily something that many Americans have to do, and so the location had to be switched to the UK (quite refreshing, I thought!). For me, it’s one of those really rare instances where placing very solid restrictions on the structure of a story (In this case, having it all take place during the commute to and from work) and finding that it actually elevates the sexual tension and mood. All scenes take place in public settings. All conversations could, in theory, be overheard. These days, so many people meet online and flirt for weeks by messaging back and forth, before they even see each other for the first time. Nowadays, for better or for worse, the actual, real fantasy is finding a connection with someone you just see in the real world; perhaps with a person you literally just met on the way to work...

If you’ve not read this one, I really would highly recommend it.

#3 To the Max: Stories with a magical element to them are either loved or hated. However, I find that this tale walks that line very successfully. Ned gets his hands on a love potion and makes straight guy, Max, fall for him. I’m sure we’ve all been there with that fantasy! However, it is in the consequences of inviting someone into your life, someone that you actually know very little about, that the entire eroticism of this story is based. I won’t spoil it for those who have not read it, but believe me when I say that things soon start getting very interesting indeed…

#2 Tommy’s Two Hundred. Don’t recognise this one? Well, that's because none of you have read it yet. 

Now, I’m not just saying this because I want you all to come back for the two hundreth story, but this is genuinely one of my absolute favourites. For my big milestone stories in the past, I have written something specifically for that event (Wright vs Beckett, The Seven Feeders of Finn). However, this is just a tale that I adored writing and decided to hold back for you all, especially for this occasion. It’s a story of domination and submission within a fairly open, but very kinky, relationship. Strapping Hunter plays the part of a very controlling feeder, making me break many of my own rules and stretching my boundaries to the absolute limits. You’ll either love him, or you’ll hate him. That’s all I’m going to say…

Also, this story is going to be the first Feeder86 story that will be fully illustrated. It’s all thanks to the amazing talents of Spellwell9 who was given an advanced copy and asked to imagine the characters in four different scenes. I cannot wait for you to see this!

Put it in your diary. All will be revealed from Friday 5th April…

#1 F80 Control: This is perhaps a controvercial choice (especially as my #1). I have previously admitted that this story strays a little from its purpose of being a gainer story. In other words, I get very caught up in the background story that is being told. However, I feel that the science fiction genre is surprisingly underused in tales of weight gain. Yet, the combination of Aritificial Intelligence and submission seemed, to me, to be the perfect blend. It really is a beast of a story if you can follow it all the way through to its conclusion. 

With the advent of improved artificial intelligence software in recent years, I felt the time was right to develop the world further, with the addition of F80 Ctrl Alt Del; a spin-off tale set slightly before the main story. Then, unable to help myself, I followed this up again with another companion story, F80: Kidnap and Control. 

The reason I chose this universe as my favourite is because this is where I am happiest writing. With AI, I don’t need to consider the morality or motivations - I know exactly what their aims are and I can see multiple ways in which it will cause conflict with humanity (and their waistlines!) I would also love to write more for this world one day, and I even left a little unused subplot in the last story that I think would provide the perfect starting-off point for another chapter. Will I ever write it? Well, we’ll have to wait and see…

So, there you have it! The the complete list!

This was a much harder exercise than I expected when I first embarked upon it. Stories like: Jiggle the Jock, Meticulous, Rule Number One, Freaks, Leftovers I and II, Ethan: The Secret Feeder and, not fogetting The Consequences I, II and III all crept in and out of the list, unfortunatley missing out on the final cut. There are many, many others, of course. But this list cannot go on forever...

So, why not tell me which ones were your favourites? Feel free to write in the comments and post a link to any other stories that you have enjoyed from myself, or from other authors. Hopefully, if we all work together, this could become a great resource for people in the future, filled with signposts and reccommendations.  

Also, don’t forget the Feeder86 Contents page where you can find links and descriptions of all the 200 stories posted so far (as well as plot outlines for upcoming tales as well). Please continue to enjoy the vast catalogue of stories, and even have a go yourself! I love supporting the many new gainer fiction writers who contact me. So please do get in touch if you need advice, or to talk through your ideas. Let’s all encourage a whole new generation of people to get typing away! I’m sure you will cheer them on just as much as I will.

Thank you to everyone who supports the stories blog here on Tumblr. Keep checking in every Friday througout April for a whole new sweeps season to celebrate this milestone. Stories will include: Tommy's Two Hundred, Train for a Gain, The Feeders' Fortress and The 1% (a companion story to The 5%). For now, I thank you all for taking time out to sit and read the very bizarre tales that sprout from my mind. You are all wonderful.

Happy 200 stories!

Feeder86

[puckbunnyera]

Just Friends | Luke Hughes

• ──────────────♡────────────── •

pairing: luke hughes x reader genre: fluff word count: 2.3k warnings: none summary: maybe you were never really just friends

notes: it's been less than 24 hours since i posted my first fic and i've already received a few asks for a part 2 so here it is. i'll link the first part here. thank you to everyone who has taken the time to read it, like it, reblog it, etc. i'm always really nervous to post my own writing so any type of interaction with it feels good to see.

also, i know the timelines of the games played in both fics don't align with the actual events in real time but we are just going to ignore that for the sake of the plot.

• ──────────────♡────────────── •

I sigh as I stand in front of my bedroom mirror, doing one last fit check before Luke arrives. I'm nervous. I come to this realization as I smooth out the nonexistent wrinkles in my shirt. Why? I couldn't tell you. It's been almost two months since the night I met Luke, and we've talked and texted almost every day since. We've even hung out multiple times since then, but I always seem to get all nervous and jittery anytime he presents the offer. My thoughts start to consume me to the point that I'm almost tempted to text him and ask for a rain check, but before I can fall too deeply into them, my attention is stolen by the two girls lying on my bed behind me.

"I still can't believe you're dating The Luke Hughes." One of my friends says causing me to turn my back towards the mirror to look at her.

"We aren't dating." I scoff. "We're-"

"Right, you're 'just friends'." My other friend interrupts, rolling her eyes and using her fingers to make air quotes as she says the words.

"We are." I shrug, moving to sit in my vanity chair so I can put on my shoes.

"You don't have to believe us if you don't want to, but he totally has the hots for you."

"It's so obvious. Any time he has the chance to get away from his job, he's calling, texting, or coming to see you. Even if it's only for a short amount of time. Those aren't typical behaviors of a guy who wants to be 'just friends'."

They continue to go on and on as if they're trying to convince a jury that they're innocent of a crime. The sound of my phone dinging from beside me on the table finally brings their rambling to an end. I pick up to find a text from Luke.

From Luke🏒: i'm here

To Luke🏒: omw

"I would love to stay and continue this conversation," I smile sarcastically as I stand up, "But my friend is waiting for me downstairs." I make sure to add extra emphasis on the word friend.

They both giggle and bid their goodbyes as I walk out of the room. When I make it downstairs to the lobby of my apartment building, Luke, in all of his handsome glory, is waiting patiently by the door.

"Ready to go?" He questions once I'm standing in front of him. I nod in confirmation and he opens the door for us, placing a gentle hand on my back to lead me out.

"What's the plan for today?" I ask once we're settled into the car.

"I need to drop off a couple of things at the dry cleaners since my brother forgot to do it," He gestures to the items in his backseat. "But then I figured we could go to dinner, catch a movie, and then maybe grab some dessert before I take you home."

"Sounds good!" I reply with a smile, with which he returns one of his own before putting the car in drive and pulling away from my apartment building.

Things are going well today. Really well. We're having fun and Luke is being as sweet as always. However, that's the only problem. Despite the stance I took in the argument with my friends, I can't help but let their words get to me. The whole evening, I've been reading too deeply into every little thing he does. Every door he holds open for me, every chair he pulls out for me, every accidental brush of our hands when we walk side-by-side. I'm trying not to let it show, but when Luke's voice rattles my thoughts and pulls me back down to Earth, I know I'm failing.

"Are you okay?" He asks as we sit in the car, waiting for the red light to turn green. "You've been pretty quiet today."

"Really?" I ask, genuinely confused because I hadn't noticed that change in my behavior. When he responds with a solemn nod, guilt rises in my chest. "I'm sorry. I didn't realize I was. It has nothing to do with you." Yet it has everything to do with him.

"Did something happen?" He pushes further.

"No, just have a lot on my mind with work and all, but I'm okay. Promise." I give him a soft smile in hopes that it will give him enough reassurance to drop the conversation. Thankfully he does, but the look in his eyes shows clearly that he doesn't believe me. "So my friends were telling me that you have a home game coming up in a couple of days against your oldest brother's team. Are you excited?" I change the subject quickly.

"Yeah," He nods, a smile gracing his features. "My parents are gonna be in town to watch us face off against each other. All three Hughes brothers on the same ice. I'm hoping it will be as exciting as everyone and the media are making it seem." He chuckles. "I'm also just really excited to see Quinn. We haven't gotten to see each other much since I moved out to Jersey and the season started. I think it'll be nice to have us all back together again, even if it's just for a couple of days."

"I bet it will be."

"I'm glad you brought this up because I've been meaning to ask you something."

"What is it?"

"Would you maybe want to come to the game?"

"Do you want me to come?" I'm praying the hopeful look in my eyes isn't obvious.

"Yeah," He nods. "I really do."

"Then I'll be there." I assure him. "The girls were talking about purchasing tickets anyways, so I'll tell them to make it three tickets instead of just the two."

"Don't worry about it. I got it covered."

"Luke, you don't have to do that." I shake my head, readying myself to argue.

"I know I don't have to, but I want to." The look he gives me makes me forget any rebuttal I had previously prepared. "Plus, I already got the tickets and the seating arrangements set up."

"And you just knew I was gonna say yes?" I reply, crossing my arms.

"No, but I was hoping you would."

"I guess some dreams really do come true." I joke.

"I guess so."

We continue to talk and joke around for the remainder of the drive. It goes by a little too quickly though, because before I know it, he's putting the car in park in front of my building. Being the gentleman that he is, he walks me all the way up to my apartment door. It's not until I have unlocked and opened the door that he finally says goodnight, placing a soft peck on my cheek before walking away. Once he has disappeared into the elevator and I'm sure he's gone, I close and lock the door.

As I'm getting ready for bed, I become aware of the slight ache in my cheeks from smiling so much. As soon as my head hits my pillow, the realization dawns on me. I am in love with Luke Hughes.

• ───────────────────────────── •

I'm still in shock at the fact that he really went all out with the tickets. My friends seem to be as well considering that they still haven't managed to pick their jaws up off the floor yet. Never in my life would I have ever expected to be seated in one of the arena's luxury suites. I feel a little bad the more I dwell on it. There are more deserving fans that could be sitting here, yet some girl who knew nothing about the sport two months ago had them handed to her at no cost.

"Hi, you must be Y/N." An unfamiliar woman's voice pulls me from my pity-party.

"Oh, hi." I greet her as I turn in her direction.

"I'm Luke's mom, Ellen." She smiles and pulls me into a quick but gentle embrace. "And this is my husband, Jim." She gestures to the man beside her.

"Nice to meet you, Y/N." He offers a hand for me to shake.

"You as well." I accept it before introducing them to my two friends, who are not-so-discreetly eavesdropping on the conversation.

We all find a seat and fall into casual conversation. Just getting to know each other and talking about this, that, and the other. Once the teams begin to make their way onto the ice, our attentions shift away from each other and onto the players.

Having admitted to my lack of knowledge of the sport before the game started, Jim and Ellen kindly explained the game to me so I would know what is going on. By the end of the first period, I'm clued in enough that I don't need it anymore and eventually, I become just as immersed in the game as the rest of them are.

It's in the second period that Luke scores a goal and we all stand up, cheering loudly with the crowd. The excitement is so high that I don't even shy away when Ellen happily pulls me into a tight hug before pulling away and continuing to cheer for her youngest son. Third period seems to go by in a flash and then the game is ending with a 6-5 win for the Devils, both Jack and Luke having contributed to the score with goals of their own.

Once the final buzzer goes off, my friends bid their farewells before heading out to go home. However, I hang back with Ellen and Jim upon the request of Luke. I follow the two down from the suite until we make it to where the locker rooms are located, waiting in the hall for the three brothers to emerge. We stand around conversing for about ten or so minutes before the men finally make their appearances.

They all embrace and greet each other as I stand back and watch with a smile. They really are a beautiful family. Once they all break away, Luke turns his attention towards me. He steps forward and reaches for me, pulling me into his arms.

"Congratulations." I speak softly as I wrap my arms around his broad shoulders, his wrapped around my waist.

"Thank you." I can hear the smile in his voice.

Time escapes me as I stand in his arms. I'm not even sure how long we've been holding onto each other. It's his brother's voice that finally has us separating.

"You must be the infamous Y/N." Quinn steps up, a smug grin on his face. "I've heard so much about you."

"I've heard a lot about you as well," I respond politely, despite the blush I'm sure I'm sporting due to his teasing tone. "It's nice to finally meet you."

"Will you be joining us for dinner?" Ellen asks from where she stands, now next to Quinn.

"Oh, um," I look to Luke for an answer. He nods, a pleading look in his eyes. "Yes, I would love to." I finally reply.

With that being said, we all begin to exit the arena and head to the parking lot. We're almost to the vehicles when Luke gently grabs my hand and pulls me to a stop. Once his family is out of earshot, he begins to speak.

"This might seem random and sudden, but I've been thinking about it for a while." He starts, looking away nervously and lifting a hand to scratch the back of his neck. "And feel free to say no because I don't want you to feel like you have to say yes just because I'm asking. Or if you feel like you need time to think it over, feel free to take all of the time you need. Actually, maybe I-"

"Luke," I say his name softly, placing my hands on his reddening cheeks and forcing his gaze back to mine. His rambling comes to a halt. "Breathe."

"Sorry." He inhales deeply before releasing his breath. "I was wondering, would you be my girlfriend?"

It's my turn to take a deep breath. Out of all the things he could have said, I was not expecting this. I take a moment to gather my thoughts as a smile begins to pull at my lips.

"I would love to." I nod, my smile growing larger resulting in his own.

"Well," He takes a step closer to me. "Since you're my girlfriend now, does that mean I can kiss you?" His question flusters me but I try hard not to show it.

"Do you want to kiss me?"

"Really fucking badly."

"Then kiss me, Luke."

And so he does. His lips crash into mine in a soft but passionate kiss. As if he has waited a lifetime to do it. It's gentle yet desperate. As we finally part, he pecks my lips a few more times before pulling away completely. He opens his mouth to say something but is stopped by Jack shouting from where his family is waiting by the cars, surely having seen the whole display.

"If you two lovebirds are done sucking faces in the middle of the parking lot, I would like to leave now. I'm fucking starving." He teases.

We both turn our gazes in time to see Quinn smack the middle brother in the back of the head and both parents shaking their heads at their son's antics. Luke chuckles at the scene as he intertwines his hand with mine and begins to walk to the car. My heart flutters as I finally admit the obvious to myself. Maybe we weren't ever just friends. I mentally roll my eyes as I climb into the back seat, already picturing the two squealing girls in my head and the endless amounts of I told you so's that I'm sure to hear when I fill them in. However, when Luke slides into the car next to me and interlocks our hands once again, I can't bring myself to care. I think I like this little life.

[buckysegan]

With all my gratitude, hope and returned adoration - Part Two

Summary: John writes back to his friend from home and we hear from our friend across the way. John x She. Word Count: 1.2k. A/N: we are def rolling with some historical inaccuracies in regards to letters here but sue me. he deserves it. pstttt also should we name her? do you all want to send me random john prompts. my baby isn't ok and i'm not ok. Part one linked here. Part three linked here.

John was sure he wasn't sweating a normal amount as he looked down at the piece of paper that Buck had offered him. It had taken two whole days of questions from the man for Bucky to even decide that he was going to reply. He’d been offered the hope, what more could he ask of her. Could he ask more? There had been a return address on the letter which Buck had insisted was there for a reason and she had opened herself out for a reply from him but the Major couldn’t help but be unsure.

It was an odd feeling for him, before the war he hadn't been unsure of anything and since he’d been here? Well he hadn’t been sober enough to doubt anything that he had done. These days though Bucky felt like he doubted every single thing. The thing was, he wasn't sure that he could afford to doubt this, to look past the life line that had been offered to him. Not when each day he could feel his mind draw a little further toward the edge no matter how much he or Buck tried to keep it in check.

With a sigh he pulled the pen into his hand, eyes locked on the page for a moment before he began to scrawl.

Dear Friend From Home 

You’re gunna have to forgive me because I ain’t going to be as good as this as you are. I’ve written so many letters this war you would think that I’d have gotten a handle on it by now but I find myself at a loss when it comes to what to say to you. 

I think the first thing I got to say is thank you. I don’t know if the words I can put on paper are ever going to really tell you how much your letter meant to me. See I was a certain type of man that didn’t think much to pen pals. I figured that I’d be ok, you know, that with my boys I’d have what I needed to make it through the hard days but watching the letters for everyone else roll in has been harder than I thought it might. 

There are things that I can’t tell you cause I don’t know who might read these letters, and where I am I can’t get you no picture but I can tell you that my favorite dish is a meat and potato pie, simple I know but really I’m a simple hearty kind of guy. What makes me laugh, you asked? That’s kind of simple for me too, just good company, myself sometimes, Buck, he’s my best friend, he makes me laugh a lot. What makes you laugh? I’d like to know that. 

May I know where you are? I know that might be a big ask but you said I could ask anything I know and if I get out of here…we get some leave, I’d like to know where I need to ask for me leave to be. Then I can show you what I sound and look like and know that in return. 

If this letter doesn’t reach you for a while, know you’ve been with me the whole time. 

With all my gratitude, hope and returned adoration

Major John Egan 

“What if she doesn’t get it?” He found himself questioning quietly to Buck as he handed over the letter to make it out of camp. His best friend settled him with a soft look, one that always made Bucky feel like he had some worldly knowledge the rest of them had missed out on, that assured him everything was going to be alright. “You just gotta have hope she will John, she’ll get it.” 

With a huff Bucky nodded, pulling his hat on as he watched his letter vanish from his view all together. “Alright well I can’t sit here and wonder, I’m off to play baseball or something.”

The letter that Bucky had so carefully handed over changed hands many more times, some fingers as rough as the pilots, some dirtier, some softer, but the last set of fingers to slide the letter from her post box had perfectly manicured fingers. Her flicking of her post was greedy as she looked for the same thing that she had every day since she’d posted her own letter.

At first, her hopes of finding what she was looking for had been unrealistic; she knew that, it hadn’t even been long enough for her letter to be received, let alone for him to get one back to her, then the other girls at the centre, they’d gotten letters back, notes, anything. That was when she had allowed her hope to return, for a moment at least. Days without anything had turned into weeks and then weeks had turned into months. Anything could have happened, that was what she tried to tell herself, he might not have gotten her letter, he might have thought it was weird and had chosen not to reply. That thought was enough to miff her, he could have at least said thank you. When she had decided no one could be that mean, her diminishing hope had turned to worry, what if he hadn't been able to receive her letter.

Flicking through each white envelope today, she almost missed it, how she didn't know because it was clearly different from the rest of them, maybe she hadn't wanted to look. "Not…" Trailing off she flicked back to the second to last letter, her eyes taking in the scrawling of her address, her eyes checking the postage before she was taring inside. "It's here, he wrote it's here." She called through the halls to the other girls that she lived with, all of which had been holding their breath with her. "Oh god I can't read it, what if he's telling me I was weird!" She cried, thrusting the unopened letter into the hands of her eager friend.

"Don't be dramatic, he's going to be throwing down his gratitude at you being a doll, you should have attached a picture with it I told you!" Meg beamed easily back at her, the same sense of reservation missing from her actions as she tore into the letter so that it could be read to the group. "Dear Friend From Home. You’re gunna have to forgive me because I ain’t going to be as good as this as you are. I’ve written so many letters this war you would think that I’d have gotten a handle on it by now but I find myself at a loss when it comes to what to say to you." That was enough, pulling the letter from Megs hands she was quick to scramble away from the group once more, locking herself into her room as re-read the opening line herself, the tears in her eyes only welling even further as she continued.

An ache in her chest formed as she read the words once more, taking in each strike of his pen where he had corrected himself or smudge from whatever he'd had on his fingers. The state of the letter was enough to make her wonder, but at least for now, she knew her friend was ok. He was alive, and he wanted to hear more from her. It couldn't have been normal, to feel this level of emotion for a man that she had never met, but she had found herself here regardless and in the middle of so much uncertainty, she wasn't going to question the pull she felt across the way to England.

Pushing from her bed she moved to her desk, paper pulled from her stationary pot, the quicker she could post this the quicker it could get to him.

"Dear Major Egan,

I'm delighted to hear I'm with you. I hope you know, that you've been with me too…"