#Leukemia Therapy

[dianemillers]

yea i had a feeling Gregory would die during the wedding, that was a nice montage at least he died peacefully in his sleep rather than go through the progression of ALS (which GH would inevitably portray terribly given the recent track record)

[living-with-cml]

A rollercoaster that isn’t fun

Sometimes I really miss writing my (loosely) semi-autobiographical, Steve-has-cancer story and the outlet it provided - especially after emotional, rollercoaster weeks like this one. Got my haircut for the first time in 5 years(!) because I actually have enough hair to cut now. Woohoo! Had to have a diagnostic test and they had me get an immediate follow-up ultrasound before I even left the premises. Thankfully, it turned out to be nothing, but cue the mini heart attack. And I’m now gearing up for my leukemia checkup in a couple hours. All has been good on the cancer front, so I’m not really worried. It’s still stressful to go through, though and sometimes I wish I could get off this particular ride. Most unfun ride ever! But thinking positive!

[airbrickwall]

View this post on Instagram

A post shared by Lincoln Jesser (@lincolnjesser)

[allkindsofadvocacy]

Find Me Friday: Alina & Mariah!

Logo that says Reece’s Rainbow Special Needs Adoption Support in blue, below a blue & yellow paint stroke rainbow graphic with a yellow Ukrainian trident symbol on the right half. In this series, each Friday I’m able, I want to share a different child or group of children who are available for adoption and listed through the adoption advocacy website Reece’s Rainbow. Please note, names used on…

[drpriya]

Immunotherapy works by harnessing the body's immune system to recognize and eliminate cancer cells. There are several approaches:

Checkpoint Inhibitors: These drugs block proteins that inhibit immune response, unleashing the immune system to attack cancer cells.

CAR-T Cell Therapy: Chimeric Antigen Receptor T-cell therapy involves modifying a patient's T cells to express receptors targeting specific cancer antigens, enhancing their ability to fight cancer.

Monoclonal Antibodies: Engineered antibodies target specific proteins on cancer cells, marking them for destruction by the immune system.

Cancer Vaccines: Personalized vaccines stimulate the immune system to recognize and attack cancer cells by presenting specific tumor antigens.

Cytokines: Interleukins and interferons boost immune response, aiding in the destruction of cancer cells.

Adoptive Cell Transfer: This involves extracting, modifying, and reintroducing

immune cells into the patient to enhance their cancer-fighting capabilities.

Immunotherapy offers a targeted and potentially long-lasting response, with fewer side effects compared to traditional treatments.

Early detection of cancer is crucial for successful treatment with immunotherapy. The eligibility for immunotherapy often depends on the type and stage of cancer.

Early Stages: In some cases, immunotherapy may be used in combination with other treatments like surgery, chemotherapy, or radiation therapy for localized cancers.

Advanced Stages: Immunotherapy is increasingly considered for advanced stages of certain cancers. Checkpoint inhibitors, for example, are used in metastatic melanoma and some lung cancers.

Biomarkers: Some cancers with specific biomarkers (e.g., PD-L1 expression) may be candidates for immunotherapy regardless of stage.

Clinical Trials: Ongoing clinical trials explore the use of immunotherapy in earlier stages and for various cancer types.

Early diagnosis through screenings, regular check-ups, and awareness of potential symptoms increases the likelihood of successful treatment with immunotherapy or other approaches. However, the appropriateness of immunotherapy varies based on individual cases and ongoing research.

Get the best treatments for cancer at the best hospitals in India. Also get full body health checkups done at the best hospitals in India.

[kenresearch1]

The Transformative Growth of the US Acute Myeloid Leukemia Market

Buy Now

What is the Size of US Acute Myeloid Leukemia Industry?

US Acute Myeloid Leukemia Market is expected to grow at a CAGR of ~ % in 2022 and is expected to reach ~USD Mn by 2028. The US Acute Myeloid Leukemia market is the rapid advancement in precision medicine and targeted therapies. The emergence of innovative treatments tailored to the genetic and molecular characteristics of individual AML patients has transformed the treatment landscape. Targeted therapies, such as FLT3 and IDH inhibitors, capitalize on specific genetic mutations driving AML, resulting in higher response rates and improved outcomes compared to traditional approaches.

Precision medicine's ability to identify the most effective treatment for each patient not only enhances therapeutic efficacy but also reduces unnecessary treatments, mitigating side effects and improving overall quality of life. This paradigm shift is bolstered by technological progress in molecular profiling techniques like next-generation sequencing, allowing for accurate genetic profiling and treatment customization.

Furthermore, regulatory support and accelerated approval pathways for targeted therapies have expedited their availability to patients. Pharmaceutical companies' increasing investment in research and development of novel agents, along with collaborations between academia and industry, leads to grow this market even more.

Click here to Download a Sample Report

US Acute Myeloid Leukemia Market by treatment type

The market is segmented by Treatment type into Chemotherapy, Targeted Therapy, Hormone Therapy, Immunotherapy and Others. Targeted Therapy is the dominant segment in the US Acute Myeloid Leukemia market in 2022. Specialty Centers, dedicated to the diagnosis, treatment, and management of specific medical conditions like AML, offer a concentrated and specialized approach to patient care. Their dominance in the AML market is driven by their unique capabilities to provide comprehensive and tailored treatments that address the complex needs of AML patients.

US Acute Myeloid Leukemia Market by end -user industry

The market is segmented by End-User into Hospitals, Homecare, Specialty Centers, Pharmacies and Others. Among these, Specialty Centers are the dominant End-User in the US Acute Myeloid Leukemia market in 2022. Specialty centers have a higher level of expertise and experience in treating specific types of cancer, including acute leukemia. They typically have specialized medical professionals, including hematologists and oncologists, who are well-versed in the latest treatment protocols and research. These centers are equipped with state-of-the-art diagnostic and treatment facilities that are specifically tailored to the needs of leukemia patients. This can include advanced imaging technologies, specialized laboratories, and access to cutting-edge therapies.

Click here to Download a Custom Report

US Acute Myeloid Leukemia companies market by Region

The US Acute Myeloid Leukemia market is segmented by Region into North, South, East, West. The dominance region is North in the US Acute Myeloid Leukemia Market in 2022. the North region often benefits from a higher level of funding for medical research, including AML. Federal funding agencies, private foundations, and pharmaceutical companies frequently channel resources into institutions within this region, allowing for greater research capabilities and clinical trials infrastructure.

Competition Scenario in US Acute Myeloid Leukemia Market

The US acute myeloid leukemia market was characterized by the presence of several prominent pharmaceutical companies and biotechnology firms striving to establish their presence and gain a competitive edge.

Larger corporations, smaller biotechnology companies making significant contributions to the AML landscape. Companies like Agios Pharmaceuticals and Daiichi Sankyo were gaining attention for their novel therapies targeting AML-associated mutations. These players are often at the forefront of introducing precision medicine approaches to AML treatment, taking advantage of advancements in genetic profiling and molecular diagnostics.

The competition is further intensified by research collaborations and partnerships between pharmaceutical companies, academic institutions, and research organizations. These collaborations aimed to combine resources, expertise, and insights to accelerate the development of effective therapies.

What is the Expected Future Outlook for the Overall US Acute Myeloid Leukemia market?

The US Acute Myeloid Leukemia market was valued at USD ~Million in 2022 and is anticipated to reach USD ~ Million by the end of 2028, witnessing a CAGR of ~% during the forecast period 2022- 2028. Pharmaceutical companies have been actively researching and developing novel therapies for Acute Myeloid Leukemia, with a focus on improving patient outcomes and reducing the side effects associated with traditional treatments like chemotherapy.  The approval of new drugs, such as FLT3 and IDH inhibitors, has offered fresh therapeutic avenues for specific subsets of Acute Myeloid Leukemia patients with genetic mutations.

The future outlook for the US Acute Myeloid Leukemia market is anticipated to be influenced by a combination of factors including advancements in treatment options, evolving regulatory landscapes, and a growing understanding of the molecular basis of Acute Myeloid Leukemia. The market has been witnessing a shift towards personalized medicine, with increasing emphasis on targeted therapies and precision medicine approaches.

Furthermore, the integration of innovative technologies like next-generation sequencing (NGS) has enhanced our understanding of Acute Myeloid Leukemia’s molecular complexities, allowing for better patient stratification and treatment selection. This trend toward molecular profiling and personalized treatment regimens is likely to continue shaping the market landscape.

However, challenges persist. Despite progress, Acute Myeloid Leukemia remains a difficult-to-treat disease with a high relapse rate. Overcoming drug resistance and developing effective strategies for patients who do not respond well to existing therapies remain critical areas of focus.

Additionally, the cost of novel therapies and access to these treatments could also impact their adoption and availability. The regulatory environment, including expedited pathways for drug approvals, continue to influence market dynamics.

[svu-barisi]

Help my fur baby please

I'm in a little bit of a financial hard spot and could use some help with get my fur baby some vet care this year. Any help is appreciated.

[mindfulcells]

Unleashing the Power Within: A Patient's Guide to CAR-T Therapy

Discover the potential of CAR-T therapy to unleash the power within: Explore ongoing trials, FDA-approved products, and side effect management. #carttherapy, #celltherapy, #cartcelltherapy, #immunotherapy, #USFDA, #FDAapproval, #lymphoma, #lymphomaawareness, #leukemia, #leukemiaawareness, #Myeloma, #myelomaawareness,

Welcome to MindfulCells Blog, your patient ultimate guide to CAR-T cell therapy, a groundbreaking form of immunotherapy revolutionizing cancer treatment. Discover how this incredible FDA approved CAR T treatment harnesses your immune system’s power to combat cancer cells and transform lives. CAR T therapyIt combines cell and gene therapy – T cells and CAR T cells are a type of white blood cells…

[freeinfo1]

New Target Identified to Prevent Blood Cancer: Groundbreaking Research in Translational Medicine

New Target Identified to Prevent Blood Cancer: Groundbreaking Research in Translational Medicine

Yet again translational medication has gained amazing headway in the battle against blood malignant growth. A new report by a group of regarded specialists has distinguished another objective that might hold the way to forestalling blood malignant growth. The pivotal discoveries of this study can possibly alter the area of oncology and open new roads for the improvement of successful medicines for blood problems.

Grasping Blood Malignant growth

Blood disease, otherwise called hematological danger, is a sort of malignant growth that begins in the phones of the blood and bone marrow. It incorporates different sorts, including leukemia, lymphoma, and various myeloma, which can devastatingly affect the body's capacity to create sound platelets and battle contaminations. Blood malignant growth influences a large number of individuals overall and postures critical difficulties to the two patients and medical services suppliers.

Distinguishing Another Objective: A Unique advantage in Blood Disease Exploration

The new review distributed in a main clinical diary has distinguished a clever objective that can possibly forestall blood disease. The examination group, drove by famous researchers in the field of translational medication, used state of the art methods and directed careful tests to uncover this pivotal revelation.

As per the review, the recently distinguished target is a particular protein that assumes a urgent part in the turn of events and movement of blood disease. This protein, which was already obscure with regards to blood disease research, has been viewed as profoundly communicated in disease cells and is engaged with advancing cancer development and endurance. The discoveries of this study have revealed new insight into the sub-atomic systems hidden blood malignant growth and have opened up intriguing opportunities for the improvement of designated treatments.

Suggestions for Blood Disease Treatment

The distinguishing proof of this new objective has huge ramifications for the therapy of blood malignant growth. The review discoveries propose that by focusing on this protein, it could be feasible to restrain the development and endurance of disease cells, accordingly forestalling the movement of blood malignant growth. This addresses a pivotal methodology that might actually reform the area of oncology and change how blood malignant growth is made due.

The analysts accept that this revelation could prepare for the advancement of novel treatments that explicitly focus on this protein, prompting more powerful and less poisonous therapies for blood malignant growth patients. The expected advantages of such designated treatments are enormous, as they could essentially work on the anticipation and personal satisfaction for patients fighting blood malignant growth.

Future Bearings and Effects on Accuracy Medication

The distinguishing proof of this new objective has extensive ramifications for the field of accuracy medication, which plans to convey customized and designated treatments in view of a singular's novel hereditary cosmetics and illness attributes. The revelation of this original objective might actually act as a diagram for the improvement of accuracy medication approaches in blood malignant growth treatment.

With additional examination and approval, this recently distinguished target could make ready for the advancement of inventive helpful procedures that outfit the force of accuracy medication to forestall blood disease. This might actually change the scene of blood malignant growth treatment and proposition new desire to patients who are battling with this staggering infection.

The Significance of Blood Malignant growth Exploration

Blood malignant growth is a complicated and testing illness that requires consistent examination and development to work on quiet results. Throughout the long term, broad examination endeavors have been devoted to figuring out the basic systems of blood disease and creating powerful medicines. The new disclosure of another objective in blood malignant growth research can possibly alter the field and achieve critical headways in the counteraction and treatment of this staggering illness.

Divulging the New Objective: Protein X

The notable review recognized a formerly obscure protein, we should refer to it as "Protein X", that has been viewed as profoundly communicated in blood disease cells. Protein X is accepted to assume a crucial part in the turn of events and movement of blood disease, going about as a vital controller of cancer development and endurance. Through careful trial and error and high level procedures, the examination group had the option to uncover the essential job of Protein X in blood malignant growth pathogenesis.

Sub-atomic Systems of Protein X in Blood Disease

Further examination uncovered that Protein X interfaces with different flagging pathways and sub-atomic pathways that are basic for the endurance and multiplication of blood malignant growth cells. Protein X is accepted to advance the development and endurance of disease cells by enacting specific flagging fountains and repressing others, prompting uncontrolled cell development and avoidance of modified cell passing.

Besides, the review discoveries recommend that Protein X may likewise assume a part in the improvement of medication obstruction in blood malignant growth cells, further convoluting the administration of this illness. The mind boggling sub-atomic components through which Protein X works in blood malignant growth cells are as yet being effectively explored, with progressing endeavors to disentangle its careful capabilities and connections.

READ FULL ARTICLE

[jcrmhscasereports]

 De novo acute B-cell acute Lymphoblastic Leukemia with BCL2/IGH and BCR/ABL1 rearrangements by Pier Paolo Piccaluga in Journal of Clinical Case Reports Medical Images and Health Sciences

ABSTRACT

T(14;18)(q32,q21) and t(9;22)(q34;q11) translocations, leading to BCL2/IGH and BCR/ABL1 rearrangements, respectively, are common genetic aberrations in hematological malignancies. Particularly, t(14;18)(q32;q21) is the genetic hallmark of follicular lymphoma, while t(9;22)(q34;q11) is commonly rearranged in acute lymphoid leukemia (ALL) and chronic myeloid leukemia. Nevertheless, their association has never been described. We report the first case of acute lymphoid leukemia (ALL) in which both BCL2/IGH and BCR/ABL1 rearrangements were present. The patient presented with pre-B ALL, achieved molecular complete remission with intensified chemotherapy, then reinforced with autologous stem cell transplantation, relapsed after a few months, and unfortunately died 17 months after diagnosis. Of note, only BCL2/IGH but not BCR/ABL1 was detected at relapses.

Key words: B-acute lymphoid leukemia, BCR/ABL1, t(14;18)(q32,q21), BCL2, Philadelphia chromosome, apoptosis, Imatinib, targeted therapy

INTRODUCTION

The t(14;18)(q32;q21) translocation is the most common translocation in B-cell malignancies; in particular, it is found in about 90% of follicular lymphomas, being the chromosomal hallmark of this tumor, and in about 20-25% of diffuse large B-cell lymphomas(1–4). Only a few cases of de novo B-acute lymphoid leukemia (B-ALL) carrying t(14;18)(q32;q21) have been described(5–13). Most of these cases presented with additional chromosomal abnormalities, often involving band 8q24 and/or MYC rearrangement and had a very aggressive clinical  course(5,6,8,9,12). Central nervous system (CNS) involvement seems to be a frequent event, despite of adequate prophylaxis. The association between t(14;18)(q32;q21 ) and BCR/ABL1 rearrangement has never been described in ALL. We report on a de novo B-ALL carrying both t(14;18)(q32;q21) with  BCL2/IGH fusion and BCR/ABL1 rearrangement.

METHODS

Cytogenetics 

Short term cultures from bone marrow samples were performed at diagnosis and during the follow-up. Metaphases were analyzed after G-banding with Wright’stain. Karyotype was described according to the International System for Human Cytogenetic Nomenclature (ISCN 1995)(14–16).

FISH

FISH was performed on fixed cells. Directly labeled BCR and ABL probes (Vysis, Inc), producing a split of red signal when ABL is involved in genetic rearrangements. FISH data were collected with a fluorescence microscope (E 1000, Nikon Instruments) equipped with a CCD camera and Genikon software (Nikon Instruments). Two hundred nuclei/cells were analyzed for each experiment.

Molecular evaluation of BCL2/IGH rearrangement

Molecular evaluation was based on nested PCR(17). Mononuclear cells from BM and PB samples were obtained by Ficoll-Hypaque density gradient centrifugation. Genomic DNA was isolated from mononuclear cells using the QIAamp DNA mini kit (Qiagen, Hilden, Germany)(18). DNA integrity was assessed by amplifying a 510 bp fragment of the Beta-globin gene. Samples positive for Beta-globin were then investigated for the BCL2/IGH rearrangement using a nested PCR specific for MBR and mcr breakpoints. The first round of amplification was done using 1 microg of genomic DNA and the following primers: 5’–CAGCCTTGAAACATTGATGG–3’(forward, for MBR), 5’– CGTGCTGGTACCACTCCTG–3’ (forward, for mcr) and 5’–ACCTGAGGAGACGGTGACC–3’ (reverse, for the JH consensus region). An initial denaturation step of 5 min at 95° C was followed by amplification for 30 cycles (denaturation: 40 sec at 95° C; annealing: 40 sec at 55° C (MBR) or 58°C (mcr); extension: 50 sec at 72° C) and final extension for 7 min at 72° C. Reamplification of a 1 microL aliquot from a 1:50 dilution of the first PCR product was then performed using the internal primers: 5’–ATGGTGGTTTGACCTTTAG–3’ (forward, for MBR), 5’–GGACCTTCCTTGGTGTGTTG–3’ (forward, for mcr), 5’–ACCAGGGTCCCTTGGCCCCA–3’ (reverse, for the JH consensus region), and the following

PCR conditions: initial denaturation step of 5 min at 95° C; amplification for 35 cycles (denaturation: 40 sec at 95° C; annealing: 40 sec at 56° C (MBR) or 59°C (mcr); extension: 50 sec at 72° C); final extension for 7 min at 72° C. All PCR experiments were performed in 50 microL final volume containing 1U of Taq Gold DNA Polymerase (PE Applied Biosystems, San Francisco, USA), 10x PCR buffer, 100 mM of each dNTP, 2.5mM MgCl2, and 1 microM of each primer. Samples were tested twice, and both positive and negative controls were included in all experiments. A patient-specific positive control was also included in every follow-up experiment to compare the BCL2/IGH fragment length with the PCR product obtained at the time of diagnosis. Amplified products were visualized on a 2% agarose gel stained with ethidium bromide. The sensitivity of the assay for the detection of BCL2/IGH rearrangement was routinely =10-4.  

Molecular evaluation of BCR/ABL1 rearrangement

RNA extraction was performed by phenol/chloroform using bone marrow mononuclear cells obtained by Ficoll-Hypaque density gradient centrifugation. One microg of total RNA was reverse transcribed using random hexamer primers and MMLV reverse transcriptase; briefly, RNA was prewarmed for 10 min at 70°C and subsequently cooled for a further 10 min at 25°C. The RNA solution was then incubated for 42 min at 45°C in a 20 L reaction mixture containing 10 mM Tris

HCl (pH 8.3), 50 mM KCl, 5.5 mM MgCl2, 1 mM of each deoxyribonucleotide, 20 U of RNAsin

(Pharmacia, Upsala, Sweeden), 25 microM random hexamers (Pharmacia, Upssala, Sweeden), 10 mM of DTT (Pharmacia, Upssala, Sweeden), and 100U of MoMLV reverse transcriptase (BRL, Bethesda, MD). After incubation, cDNA solution was diluted 1:5 to 50 microL final volume. The cDNA integrity was assessed by amplifying a 296 bp fragment of the ABL1 gene. Samples positive for ABL1 were then investigated for the BCR/ABL1 rearrangement by qualitative PCR. Five microLs of cDNA were PCR-amplified using the following set of primers: EA500 5’ TGTGATTATAGCCTAAGACCCGGAG 3’, and R112 5’ TTGTCGTGTCCGAGGCCACC 3’. Thirty-five cycles of PCR were performed as follows: denaturation (30 sec at 96°C), annealing (30 sec at 60°C), and extension (30 sec at 72°C). Samples were tested twice, and both positive and negative controls were included in all experiments.

Amplified products were visualized on a 2% agarose gel stained with ethidium bromide (19).REF

Case report

In July 2020, a 40-years-old woman, presenting only with moderate fatigue, was diagnosed with pre-B ALL, L2 subtype. The peripheral blood count showed: Hb 9.3 g/dl; WBC 17x109/L; PLT 56x109/L. The bone marrow aspirate was hypocellular with 80% of lymphoid blasts. The karyotype was: 46,XX, del(6)(8q21q25), t(9;9)(p11;q22), t(14;18)(q32;q21)(10/20). The immuphenotype, assessed by flow cytometry, was: CD19+, CD22+, TdT+, CD20-, CD3-, CD10-.

The molecular analysis carried out by PCR confirmed a BCL2/IGH rearrangement (mcr breakpoint) but also unveiled a BCR/ABL1 (E1-A2 /p190) rearrangement. Thus, FISH analysis was also performed. The probe for BCR/ABL1 dual fusion gene gave two green signals and two red signals as expected from samples not carrying the ABL1 rearrangement. Molecular analysis was then repeated confirming the previous results. We administered a standard induction therapy (doxorubicine, vincristine, L-asparaginase, and prednisone plus imatinib), and an intensified consolidation therapy (idarubicine and high dose cytarabine) obtaining a molecular complete remission (CR). Particularly, neither BCL/IGH nor BCR/ABL1 rearrangements were detected. Other 2 consolidation courses were then administered (BFM-B regimen, including vincristine, ifosfamide, methothrexate, teniposide, high dose cytarabine, and dexamethasone; and BFM-A regimen, including vincristine, doxorubicine, cyclophosphamide, high dose methothrexate, and dexamethasone) associated with imatinib. Bone marrow harvest and autologous bone marrow transplantation were then performed, lacking a HLA-matched donor. Twelve months after the first documentation of CR, the patient relapsed. The bone marrow aspirate was hypercellular with 90% of leukemic cells. The karyotype was: 46 XX, t(1;5)(p32;q31), del(12)(p11;p13)(14/15); the molecular analysis conducted by PCR showed the BCL2/IGH rearrangement, whereas there was no evidence of the BCR/ABL1 fusion transcript. Salvage therapy with liposomal daunorubicin and intermediate dose cytarabine (23) was then administered, obtaining a second molecular CR (disappearance of BCL2/IGH). Two months later, a second relapse occurred. The karyotype was: 46 XX, t(1,5)(p32;q31), del(12)(p11;p13)(29/30). The molecular analysis showed again only the BCL2/IGH rearrangement, without evidence of the BCR/ABL1 fusion gene. Despite of neuro-meningeal prophylaxis, there was clinical evidence of CNS involvement. Compassionate treatment with campath-1H, 30 mg/dose, for 5 doses, was administered i. v., obtaining a peripheral blood blast clearance, but not a CR. The patients eventually died 17 months after diagnosis due to leukemic progression.

DISCUSSION

BCR/ABL1 and BCL2/IGH rearrangements are common molecular abnormalities in B-cell malignancies. In particular, the BCR/ABL1 rearrangement is the most frequent genetic aberration in adult B-ALL(20–22). On the other hand, t(14;18)(q32;q21) with BCL2/IGH rearrangement is the most common abnormality in tumors derived from peripheral B-lymphocytes, whereas it is absolutely rare in B-cell precursor malignancies (24). However, while the biological role of BCR/ABL1 in acute leukemia is at least partially well known(25), the significance of BCL2 in ALL is still largely indefinite. BCL2 overexpression, without BCL2/IGH rearrangement, is frequent in ALL, and does not seem to be associated with a poorer prognosis (26). On the contrary, t(14;18)(q32;q21) and BCL2/IGH rearrangement are a rarity in ALL, but are associated with very aggressive tumors. Morphologically, the described cases are often L3, according to their immunophenotype of mature B-ALL, with Burkitt-like features. Notably, in all cases, complex karyotypes were observed, with almost constant involvement of the 8q24 locus and MYC deregulation(5–13). Sequential emergence of molecular abnormalities has been proposed in these cases, with progression from indolent (BCL2/IGH positive) to aggressive (BCL2/IGH and MYC positive) B-cell tumors (5–13). Therefore, they most likely represented leukemic variants of high-grade B-cell lymphomas with “double hits”. On the clinical ground, most of the patients presented with rapidly worsening general condition, fever, fatigue, night sweat, and weight loss; massive bone marrow and blood involvement, nodal and extra-nodal infiltration were also present. Clinical course was aggressive, with a median overall survival usually below than 12 months(5–13).

To the best of our knowledge, the association between t(14;18)(q32;q21) and BCR/ABL1 rearrangement has not been previously described in ALL. Nevertheless, a case of co-existing

BCR/ABL1 and BCL2/IGH rearrangements was reported in a MDS case(27). Our patient presented with a pre-B ALL, L2 subtype, carrying the t(14;18)(q32;q21) and other additional chromosomal aberrations, such as del(6)(q21;q25) and t(9;9)(p11;p22) but lacking 8q24 involvement; the BCR/ABL1 rearrangement was documented only by molecular analysis. Clinical course was aggressive, with recurrent relapses, CNS involvement, and death within seventeen months. Interestingly, at relapse, the patient presented a different karyotype [t(1,5)(p32;q31), del(12)(p11;p13), quite common as secondary abnormalities], still showing the BCL2/IGH rearrangement. Furthermore, during the clinical history of the patient, other chromosomal aberrations appeared. The relationship between the molecular events, and even a possible sequential appearance cannot be established. No peculiar morphologic or immunophenotipic patterns can be identified, to be easily associated to either one translocation, and the bad prognosis could be conferred by both the main genetic alterations; however, a dominant role of BCL2/IGH should be hypothesized, since it was always present during all disease phases. In this regard, based on the lack of cytogenetic evidence of Philadelphia chromosome we cannot exclude that BCR/ABL1 rearrangement constituted a sub-clonal lesion, cleared out by the more specific targeted therapy (chemotherapy plus imatinib).

Certainly, the treatment of t(14;18)(q32;q21) positive ALL remains a major problem, as conventional therapy are scarcely effective. Probably, the highly proliferating phenotype is made highly insensitive to chemotherapy by the antiapoptotic effect of BCL2, as observed in high-grade B-cell lymphomas with double hits.

The present case, besides its unicity, also confirmed the importance of molecular testing after cytogenetic analysis in human leukemia. Future experiences and hopefully trials will be useful to improve the current treatment of t(14;18)(q32;q21) positive ALL by adopting more rationally targeted therapies such as BCL2 inhibitors (eg venetoclax), peroxisome proliferator-activated receptor-gamma ligands (28), or others.

For more information: https://jmedcasereportsimages.org/about-us/

For more submission : https://jmedcasereportsimages.org/

[medicomunicare]

Enveloping leukemia: from gene variations to "fiery" cytokines, no rest 'til the enemy is sent to the depths

Enveloping leukemia: from gene variations to “fiery” cytokines, no rest ’til the enemy is sent to the depths

Cancers can grow when tumor cells are not identified or destroyed by the immune system. Autoimmune diseases, on the contrary, occur when the immune system attacks our own cells, mistaking them for foreign cells. According to a new study from the Garvan Institute of Medical Research, some gene variants associated with leukemia can produce ‘rogue’ immune cells that drive autoimmune diseases,…

[mindblowingscience]

UCLA scientists have identified a protein that plays a critical role in regulating human blood stem cell self-renewal by helping them sense and interpret signals from their environment. The study, published in Nature, brings researchers one step closer to developing methods to expand blood stem cells in a lab dish, which could make life-saving transplants of these cells more available and increase the safety of blood stem cell-based treatments, such as gene therapies. Blood stem cells, also known as hematopoietic stem cells, have the ability to make copies of themselves via a process called self-renewal, and can differentiate to produce all the blood and immune cells found in the body. For decades, transplants of these cells have been used as life-saving treatments for blood cancers such as leukemia and various other blood and immune disorders.

Continue Reading.