Tumgik
#1500 followers?!? how?!?
gracieheartspedro · 8 months
Text
holy shit
Tumblr media
1,500!!!! I am so beyond grateful for every last one of you! for you who follow me for the pedro reblogs, the last of us content, or my writing- thank you, thank you, thank you.
y’all mean the fucking world to me. every day i’m so grateful to be apart of this little side of the internet.
i always want to spend a moment to thank EVERYONE who’s shown love on my preview for your needs, my needs. this new story has been a labor of love and I’m really enjoying creating this universe for our favorite peepaw, Joel Miller. it’s coming, I promise!
I want to make sure it’s exactly how I want it. it will be multiple parts, too! rahhh!!!
again, thank you all for coming to my blog and showing me love and all the constant support! I love y’all so much. if you ever need a friend, i’m here, my messages and asks are always open!
for now, i’m logging off! my partner’s birthday is today and I want to spend time with him.
okay, bye, and enjoy my new fav pic of pedge ❤️
Tumblr media
over and out!
8 notes · View notes
edenfenixblogs · 4 months
Text
URGENT FOR MY BRAIN:
Is anyone here good at mashing up songs???????????
I noticed a similarity between two songs and I’m not good enough at music to mash them up and see how they work together but I NEED TO KNOW
I’m not joking. Please.
19 notes · View notes
technolilly · 1 year
Text
Spoilers are like little angels to me. I chew and chew and chew and finally once they are small enough they go through my bloodstream straight to the tips of my fingers and I can see the stars. You know how it is.
11 notes · View notes
mossymorels · 2 years
Text
Tumblr media
im so normal about him
60 notes · View notes
leninisms · 1 year
Text
idk why i still follow the moral philosophy tag because all it does is piss me off
5 notes · View notes
elvisabutler · 1 year
Note
I am so excited for these fics now!! Do you know a rough date when they're going to start?
Tumblr media
i'm delighted you're excited! that's honestly what i set out to do with things like this. bringing excitement and joy to our little fandom! as far as my rough date. hypothetically i'm aiming for the tail end of this week? so maybe saturday? i would say tomorrow but i'm starting off with cuckolding so it's a lil tricky. plus i have a lil frat austin thing coming out hopefully tonight.
i will say in reference to the anon who chose marking for wil ohmsford, you are getting shuffled around so i can get the right feel but not hold up the entire line.
9 notes · View notes
geeky-politics-46 · 2 years
Text
Holy shit you guys. You're seriously gonna make me cry. It's been a weird holiday season with one of my cats about to pass & my dad's health not doing great. Plus hooray for seasonal depression, lol. This is a wonderful gift to get though & I can't think of better people to share it with. Thank you so much for believing in me.
Tumblr media
11 notes · View notes
royposting · 4 months
Text
posts that are like referring to all of the messages in your inbox with thousands of notes like. imagine ppl interacting with u on this webbed site lol
0 notes
incognitopolls · 1 month
Text
We ask your questions so you don’t have to! Submit your questions to have them posted anonymously as polls.
4K notes · View notes
desireisqueer · 1 year
Text
so i was wondering how many blogs does the average tumblr user follow cause i was thinking do i follow a lot of blogs or do i follow a lot less than many others do so now im doing a poll
please rb for larger sample size and im sorry if the options are bad!!!
11K notes · View notes
thefallling · 1 year
Text
Dearest fellow tumblrinas, Do I have a poll for you!
Got curious.
Anyways please reblog for larger sample size
If you do I'll give you a big hug :D (with consent)
(ok just now realizing it says "less that 100" I mean less than! oopsies
12K notes · View notes
hellsitegenetics · 7 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: according to democracy, yes
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.
Tumblr media
2K notes · View notes
pucksandpower · 7 months
Text
Of Roomates and Revenge
Lewis Hamilton x fake girlfriend!Reader
Featuring Max Verstappen, Lando Norris, Charles Leclerc, Pierre Gasly, Esteban Ocon, and Nico Rosberg
Summary: in which your search for a free place to stay leads to helping one half of Brocedes live out his petty fantasy for revenge … and falling in love while doing so
Tumblr media
Tumblr media Tumblr media
Tumblr media
Cat and Apartment Sitter Needed (Monaco)
Compensation: €1500/week plus all the Red Bull you can drink
I’m a world-traveling young professional who is rarely home. My two beautiful and rambunctious bengal cats need someone to stay with them in my Monaco apartment whenever I’m away for work.
The ideal candidate will be an experienced cat person who is prepared to deal with a lot of energy, chaos, and shenanigans from these two little terrors. They knock everything off every surface, wrestle at 3am, and will likely attempt to smother you while you sleep. If you can handle that, we’ll get along just fine.
In addition to caring for the cats, you will need to keep my place relatively tidy (i.e. no crushed Red Bull cans or fast food wrappers everywhere), collect any packages or mail that arrives, and randomly turn a few lights on and off every evening so the neighbors don’t get suspicious.
The position is ideal for a mature student, digital nomad, or someone between living situations who wants an amazing place to stay for free in one of the world’s hotspots.
Drop me a line if you think you can handle the cats from hell and wouldn't mind living in a 230 m² penthouse apartment with a private terrace, floor-to-ceiling windows, and a badass view of the Mediterranean. Preference goes to non-smokers who follow directions well and won’t throw ragers when I’m gone.
Send a brief intro, your experience with cats, and a couple photos attached. Urgently need someone for various stretches starting mid-February.
Do NOT contact me with unsolicited services or offers.
Tumblr media
Live-in Cactus Caretaker Needed (Monaco)
Compensation: €1000/week, free snacks, and you can play my Xbox
I’m a young dude who’s rarely home because of my job that involves a lot of international travel. I have a single cactus plant that I promised my mum I would keep alive until she visits again. The thing is ... I have absolutely no idea how to care for plants. Like, I nearly killed it the first week by forgetting it existed.
What I need is someone responsible who can essentially live in my swanky Monaco apartment whenever I’m gone and keep my tiny cactus friend alive.
Duties would include:
Watering the cactus like ... once a month? Twice a month? I don’t know how often it needs water
Not letting the cactus die in any other way (pretty sure they need sunlight too … I think)
Keeping the place tidy (I’m a bit of a mess)
In return, you’d get:
A sick apartment all to yourself with a stunning view, giant TV, and full kitchen (please for the love of god be careful in there ... I almost burned the place down trying to make a grilled cheese once. Seriously, I'm not exaggerating. I almost went up in flames over a silly sandwich. If you can't even operate a microwave, we may have problems. There’s only room for one idiot like that in Monaco — and it’s me)
Unlimited snacks/drinks from my well-stocked pantry
Free rein over my gaming setup (just don’t break anything)
First dibs on any events/reservations I can’t make
The ideal person is responsible, shows they can follow basic instructions for cactus care, laidback since you’ll be alone a lot, and trustworthy enough not to wreck the place or throw illegal parties. Having a green thumb would be great, but frankly if you can manage not to kill the one plant, that’s good enough for me.
Send a brief bio about yourself and your qualifications as a cactus/housesitter if interested! I’m gone quite frequently starting in February so could use someone ASAP.
No scammy offers or soliciting, please!
Tumblr media
Roommate Needed to Drink Wine and Listen to My Woes (Monaco)
Compensation: Free rent in a nice apartment, plus all the wine you can drink
Are you a good listener? Do you enjoy dry red wines and occasional bouts of tears and venting? If so, I’ve got the perfect living situation for you!
I’m a youngish guy with a high-stress job that involves a lot of traveling. When I’m home in Monaco, I tend to unwind by polishing off a couple bottles of nice Bordeaux or Burgundy while complaining about work, my colleagues, and my rival who is giving me really mixed signals.
What I need is a roommate who doesn’t mind a little drunken blubbering here and there.
You’ll get:
Your own bedroom in my spacious 2BR/2BA apartment in the La Condamine district
Rights to my kitchen, living room with large TV, piano, and music recording equipment
Access to the building’s pool, sauna, fitness center, and lounge areas
As much wine as you can drink (and more)
In exchange, you’ll be expected to:
Listen to my periodic rants and rave sessions without judgement
Preferably nod along or offer supportive-sounding feedback like “Yeah, that’s really tough man” or “Wow, they sound terrible”
Refill wine glasses as needed
Maybe rub my back or pat my head if I’m really going through it
The ideal candidate is a decent human being who can empathize with the high-pressure struggles of a young professional trying to make it in a cut-throat career.
You’ll need a decent amount of free time and lots of patience. Prior experience as a life coach, therapist, or sympathetic drinking buddy is a plus.
If you can handle crying guys after a few too many glasses of Châteauneuf-du-Pape, inquire within! Include a little about yourself and why you would make a good non-judgmental wine friend. Merci!
Tumblr media
Expand Your Search? Similar Opportunities:
Impartial Referee Wanted for Parking Lot Brawls (France)
Compensation: €400 per event
Two athletic young men in their late-20s are looking for a level-headed third party to oversee and officiate their semi-regular parking lot boxing matches. Yes, you read that right — we’re talking straight-up fisticuffs in the back alley behind the Circuit Paul Ricard.
A little background: We’ve been frenemies/rivals since we were kids — constantly competing in friends, employment opportunities, you name it. There’s a healthy amount of hatred between us that simply can't be resolved through words alone. Every few months, we feel the need to just take out our pent-up aggression on each other's faces.
Up until now, it’s been an unregulated shitshow with no real rules or oversight. We’re looking for someone impartial who can:
Set some fair ground rules around where/how we can strike
Ensure no prop weapons get involved (last time he tried to scalp me with a wrench)
Officiate and declare a winner once one of us is knocked out or quits
Ideally have some basic first-aid skills in case of a nasty cut or broken nose
We will pay €400 cash at the start of each bout. You’ll get a free show of two extremely fit dudes wailing on each other until there’s a clear victor.
Loser exits with his tail between his legs, winner gets to gloat for the next couple months until we run it back.
If you can be a neutral third party and aren’t squeamish about a little blood, send us your info with some details about yourself and your experience resolving conflicts (legally or not). First come first served — our next fight is tentatively scheduled for mid-May!
No flakes or perverts, please. Serious connoisseurs of violence only.
P.S. Don’t be scared to give out penalties (one of us is used to that)
Actor or Actress Needed to Annoy Ungrateful Ex-Friend (Monaco)
Compensation: €2700 per week, free luxury accommodations
I’m a successful guy in my late 30s looking to hire someone to pretend to be my significant other for a few months. Before you get the wrong idea, let me explain ...
I had a major falling out with a former best friend who stabbed me in the back years ago. We live in the same apartment building, just one floor apart.
I’m trying to show him how amazing my life still is without him … and maybe make him jealous in the process.
That’s where you come in. I need you to move into my penthouse temporarily and act as my gorgeous new boyfriend/girlfriend.
Your main duties would include:
Loudly introducing yourself to said ex-friend by knocking on his door and being line “Hi, is [insert my name] here?” Then pretend to be embarrassed and apologize when he tells you that you’re at the wrong apartment
Hang out in the hallway near his place and have very loud fake conversations detailing our imaginary passionate nights together (rated R)
Post cringy coupley photos on your social media of us dressed up going out, cuddling on my yacht, etc
Ideally you’re an aspiring actor/actress or just a really convincing liar. Being somewhat loud and dramatic is a plus. You’ll need to be willing to play along if my petty ex-friend tries to confront us.
In return, you’ll be living in a lavish penthouse with all the amenities for free. You’ll have your own private suite and can hang out on the oversized balcony, by the pool, or in the media room when you’re off the clock. Might also be able to introduce you to some high-profile people if you’re trying to network.
Oh, and my bulldog will provide plenty of cuddles.
If you can pull off a remarkably realistic fake partner act and aren’t afraid of a little light deception, hit me up! Please include a couple photos plus a bit about yourself and your acting experience. Aiming to start mid-April.
I’m an equal opportunity employer — girlfriend, boyfriend, nonbinary partner, you name it. All genders welcome to apply for the role if you’ve got what it takes! Only preference is that you have especially luscious hair … for reasons.
No weirdos please.
Tumblr media
Hi,
Okay, I have to admit — your ridiculous request to hire a fake girlfriend to make your ex-best friend jealous is quite possibly the pettiest thing I’ve ever heard. And I absolutely love it.
I’m literally the perfect person for this role. Petty vengeance is my middle name (well, not really, it's actually Y/M/N ... but you get the idea).
A little about my qualifications:
Took some theatre electives in university so I can really sell the dramatics
Lots of experience putting on an Oscar-worthy performance faking ... well, you know ... thanks to my douchebag ex-boyfriend who couldn’t be bothered to learn how to pleasure a woman 🙄
Not afraid to get LOUD and will happily reenact our “passionate nights” at earsplitting volumes in that hallway
Can pull off playing dumb if your friend tries to interrogate me about you (“Oh [whatever your name is]? Yeah he’s just the best at ... stuff”)
No shame in my pettiness game — I once spent my weekly paycheck on a Cameo just so an ex’s favorite celebrity would call him a dingleberry
In terms of looks, I’ve been told I have just the right amount of “hot” to make your poor pal jealous without it being too unbelievable. I’m attaching a few photos for reference.
Let me know if you want to meet up for a glass of wine and we can workshop some juicy storylines for our imaginary romance. Perhaps I was a former fling you rediscovered? A hot younger thing giving you a new lease on life? The possibilities are endless!
I’m a pro at faking it, so selling our relationship will be a piece of cake. Your ex-friend will be bright green with envy by the time I’m through!
Let’s make him regret the day he double-crossed you, babe.
Cheers,
Y/N
Tumblr media
r/offmychest
u/NotBritneySpears · 16h
My ex-best friend’s new girlfriend is the WORST!
I really need to get this off my chest. My upstairs neighbor’s new girlfriend is, without a doubt, the most insufferable human being on the planet. She’s loud, obnoxious, and seems to take immense pleasure in tormenting me for some reason.
A little background: I used to be really close friends with my neighbor. We had a big falling out a while back over ... well, it’s a long story. We don’t talk anymore and there’s a lot of resentment between us. Clearly the universe is trying to get back at me now with this new girl.
This chick has made it her personal mission to give me a play-by-play account of every single intimate encounter she has with him. And I mean DETAILED accounts. The other day I was just trying to enjoy my morning coffee and I hear her incredibly shrill voice from right outside my door:
“Oh he was an ANIMAL last night! The things he did with his tongue, I thought I was going to pass out!”
Like, seriously? Keep it to yourself, weirdo! That’s just the tame stuff too. Sometimes she’ll go into pretty graphic detail describing body parts and positions that I really didn’t need a mental picture of.
Here’s the thing — she quite obviously positions herself to be as close as possible to my apartment without actually trespassing — I mean, she doesn’t even live on my floor for god’s sake! So every word comes through crystal clear. I’ve confronted her about it a few times and she just plays dumb, like:
“Oh gosh, I’m so sorry if I was being loud! We just get so carried away sometimes, you know how it is,” with this stupid ditzy valley girl voice and hair toss.
I don’t know if my former best friend put her up to this or if she’s just a massive troll in her own right. But it’s like psychological warfare at this point. Literally ANY time I’m home, I have to listen to her yap about their Sex Olympian-level escapades.
My wife even heard them once and thought I was playing porn at an insane volume! She doesn’t believe me that it’s just this deranged lady running her mouth constantly.
I’m half-tempted to start recording her rants and blast them back at full volume to give them a taste of their own medicine. Or maybe start describing lurid details of my own (admittedly not quite so colorful) sex life in retaliation.
I don’t know, maybe I’m being oversensitive. But living under these two insufferable assholes is a waking nightmare. I need to move or something because this is massively affecting my peace of mind. Who knows if they will ever get bored of tormenting me and move on.
Rant over. Thanks for letting me vent about the neighbors from hell.
⇧ 1629 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/chronicgossiper · 12h
Damn, that sucks man. Your neighbor and his gf sound like immature assholes trying to get a rise out of you. I’d look into noise complaint options or even see if you can get them evicted for harassment.
⇧ 387 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/chronicgossiper · 11h
Seriously? You really think the landlord would evict someone over this? It’s not like they’re blasting music at 3am. Sounds more like passive aggressive pettiness than anything illegal.
⇧ 271 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/chronicgossiper · 10h
Idk, having to listen to people loudly describe their sex acts against your will seems like it could qualify as harassment or creating a hostile environment. Worth exploring at least if they won’t stop.
⇧ 236 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/NotBritneySpears · 9h
Eviction isn’t really an option here since we all own our apartments and there’s no landlord dictating that. It’s not that type of building.
⇧ 184 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/nosyandproud · 8h
Did your former friend move into that building first or did you move in knowing he lived there?
⇧ 319 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/NotBritneySpears · 7h
He was there first, I bought my place a few years after him when I could afford it. Never expected he'd pull something this childish.
⇧ 253 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/NotBritneySpears · 6h
So you willingly moved into the same building as your ex-best friend that you aren’t on speaking terms with? That’s just asking for drama, dude.
⇧ 261 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/NotBritneySpears · 5h
It’s a great building in an amazing location. I wasn’t going to not pursue the opportunity just because he lives there too. It’s a big place, I didn’t think we’d be running into each other much.
⇧ 207 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/NotBritneySpears · 4h
Still seems like a weird decision to willingly insert yourself into his orbit like that if the relationship was so fractured. Probably should’ve seen some fallout coming.
⇧ 195 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/nosyandproud · 3h
Yeah exactly, why would you move somwhere your ex-friend lives if you two clash that much? Kinda put yourself in this situation.
⇧ 172 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/NotBritneySpears · 2h
Okay, let me be clear — he and I were best friends for over a decade before we had a colossal falling out a few years ago. We’re not just some casual ex-buddies who don’t get along. We were legitimately very close for most of our lives until things went nuclear between us. When I decided to move into the building, our friendship had been over for a while already. I really didn’t anticipate he’d take things to this vindictive level years later. I’m not going to miss out on my dream home just because of what happened between us.
⇧ 204 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/NotBritneySpears · 1h
This is getting juicyyy, do tell about what caused the falling out!
⇧ 138 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/NotBritneySpears
Not really trying to dredge up old drama, that’s a whole other can of worms. The girlfriend situation is annoying enough as is.
⇧ 102 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/NotBritneySpears · 51m
Fair enough, you gave context. Still think you two need to have an adult conversation about boundaries. Purposely trying to loudly narrate their sex life at you is unhinged.
⇧ 126 ⇩ | Reply | Give Award | Share | Report | Save | Follow
r/relationships
u/yourusername · 19h
I’m catching real feelings for the guy who hired me to be his fake girlfriend to get revenge on his ex-friend ... help?
Buckle up folks, because I’ve got one hell of a tangled situation to unpack here. This is going to be a long one.
About a month ago, I responded to this Facebook Marketplace ad from a guy (let’s call him L) looking to hire someone to pretend to be his new girlfriend. The goal was to make his former best friend/downstairs neighbor jealous after a brutal falling out between them.
I know, I know, it sounds ridiculous. But the benefits were good and I’d be living in his insane luxury penthouse in Monaco rent-free. More importantly, I really vibed with L’s pettiness and desire to get deliciously pathetic revenge on his ex-friend. My last boyfriend was the actual worst, so I was absolutely here for any slightly insane Karen antics.
Anyway, we hit it off immediately at the “audition” over drinks. L is brilliant, successful, gorgeous, and fucking hilarious in a sarcastic, unfiltered way. We both have a wicked mean streak and frankly get off on emotionally messy situations. It was like looking into a mirror — two beautiful trainwrecks finding each other in the wreckage.
From night one, we had crazy chemistry. The back-and-forth banter was electric, we finished each other’s sentences, etc. I felt so comfortable around him despite the bizarre circumstances. I assumed it was all fun and games to toy with his former best friend.
But over the last few weeks of loudly chronicling our “sex marathons”!outside said ex-friend’s door and doing phony coupley things around the city, I’ve realized my feelings are ... complicated. L and I CONNECT on a deeper level, in addition to just being partners in crime. We’ll be tangled up watching movies and he’ll make some perfectly timed quippy comment that has me cackling until my abs hurt. Or we’ll get deliriously wasted and end up baring our souls about our upbringings, dreams, fears — everything.
I’ve never been so open or comfortable around someone before. Our walls are gone. And the most messed up part? Some small, perverse part of me loves the strange intimacy we’ve manufactured through this farce. How much closer can you get than meticulously co-creating a fictional relationship?
In the beginning, I think we were both just in it for the laughs and pettiness factor. But something shifted for me recently. One night we were drunkenly rehearsing how I was going to describe our latest imaginary tryst to his ex-friend and ... I don’t know, I couldn’t stop staring at his lips while he was talking. His face was so close to mine and I felt breathless. In that moment, I wanted nothing more than to ditch the script and really kiss him. I had to physically stop myself from lunging forward.
Later, when I went back to my room, I was hit with a crushing wave of realization — I have actual romantic FEELINGS for this basketcase who hired me to play-act as his girlfriend! What the actual fuck?
Guys, I’m in too deep. How did I let this happen? L is technically still my employer and this whole operation has an expiration date. His former friend is already growing visibly annoyed, so Phase 2 (feign a dramatic breakup, I move out, L moves on with his life) is likely coming up very soon.
Do I just bury my feelings and end this gig without saying anything? Do I risk the humiliation of confessing my heart to someone who was only pretending to want me around? Or should I just go for it and make out with him next time we’re tangled on the couch? I’m spiraling here!
The pettiness that brought us together may also tear us apart. Or maybe I’m just a sad clown who read too much into a fake relationship. Someone slap me with a reality check, please! I need perspective from the outside.
Tl;DR - Developed legit romantic feelings for the guy who hired me to be his fake girlfriend as part of his weird revenge plot. Not sure if I should come clean, keep it professional, or start actually making out with him for real. This was NOT part of the deal!
⇧ 2085 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/judgingloudly · 18h
Oh honey, you are in a MESS. This is like a bad romcom plot but IRL. I think your only real option is to fess up and tell L how you’re feeling. Contrary to popular belief, the fake dating trope doesn’t always have to stay pretend!
If he doesn’t feel the same way, at least you put it all out there and can move on with some dignity intact. But who knows — from how you describe the crazy chemistry and connection, he might feel relieved you said something first! Don’t let this fire burn out without taking your shot. Oh and definitely keep us updated, I’m invested now!
⇧ 956 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/judgingloudly · 17h
I agree with this take. You already acknowledged you’re in too deep emotionally. Might as well put those cards on the table and let the chips fall where they may. Shooting your shot is always better than letting the “what if” eat away at you forever!
⇧ 762 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/livefordrama · 16h
I’m sorry but I simply must ask — how did you land a gig like this? And does he happen to have any more openings for a fake girlfriend? Asking for a friend …
⇧ 319 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/yourusername · 15h
Honestly it was a random Facebook ad looking for exactly this — a girl to move in and fake date this guy to drive his feuding neighbor up the wall. I applied semi-joking but he picked me!
As for openings, not that I know of ... yet. I may have to quit soon depending how this all plays out, so will keep you posted if my spot opens up!
⇧ 584 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/yourusername · 14h
Omg please do! I would 100% take on a role like this, it sounds like a total riot.
⇧ 203 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/unpaidtherapist · 13h
Girl, I think you already know what you have to do here. Is keeping things professional and never admitting your feelings really an option at this point? You’re clearly enamored with this guy and he seems to reciprocate the intensity at least platonically so far. I say GO FOR IT!
Just pull him aside one day, say “hey this isn’t just an act for me anymore, I really like you and need to know if there’s a possibility for us or not.” If he’s as caught off guard and freaked out as you’re implying, a direct conversation is needed to get those cards on the table. Don’t die wondering “what if?” That’s my advice.
⇧ 651 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/everydayopportunist · 12h
This is so wild, I’m living for this drama! Seriously might need to pursue some similar gigs myself, apparently that’s where all the romance happens these days 😂
⇧ 182 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/devilsadvocate · 11h
I’m sorry but I have to go against the grain here — please do NOT make a move or confess any feelings! This guy hired you for a very specific job under very specific pretenses. Catching real feels was not part of the deal at all. Selfishly throwing that at him out of the blue would be so unfair after he opened his home to you. I worry he could feel betrayed and violated even if he did secretly like you back.
My advice? Give it a few weeks, see if these feelings persist or if it was just a passing crush brought on by the intimacy you’ve found yourselves in. If it’s still intense after cooling off, then maybe consider looping him in. But don’t go nuclear until you're absolutely sure. You could risk imploding a good work situation and friendship over a temporary infatuation. Tread very lightly!
⇧ 398 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/devilsadvocate · 10h
I’m with this take, OP shouldn’t jeopardize her living situation if her feelings might be fleeting. Taking a step back and giving it more time could provide clarity. It’s easy to get caught up in the fantasy.
The more prudent move is to wait until the “job” wraps up before considering opening that can of worms. If feelings persist minus the contrived closeness, she’ll know it's real. But springing it on the guy now seems wildly unfair and could blow up in her face.
⇧ 254 ⇩ | Reply | Give Award | Share | Report | Save | Follow
r/AmITheAsshole
u/veganGOAT · 15h
AITA for turning down my fake girlfriend after she admitted feelings, only to want her back days later?
I think I may have tremendously fucked up in a spectacularly messy way. Let me walk you through the tangled web I’ve woven ...
A couple months ago, I (39M) hired this woman to essentially move into my apartment and pretend to be my new girlfriend. I know it sounds batshit crazy … but I was trying to make my ex-best friend/neighbor jealous after a bitter falling out between us.
She was the perfect partner for this ruse — sarcastic and spunky, with a hint of unhinged energy. We bonded instantly over bottles of wine and throwing deliciously overblown “loud sex” performances in the hallway to drive my ex-friend nuts. What was meant to be a transaction quickly bloomed into a legitimately fun, effortless friendship.
Soon after, we started having real sex. It sort of just … happened, albeit very awkwardly at first. Like “well this is weird, want to try it for real just to see?” And what do you know, we had insane chemistry between the sheets too! We were soon sleeping together nearly every night, always swearing afterwards that it was “just for fun” and didn’t mean anything more.
But I started catching feelings. She was hilarious, confident, beautiful — everything I could ever want in a partner. We had connected on a deeper level through the medium of batshit pettiness. And our physical intimacy only amplified that bond.
Cut to a couple weeks ago. We had just finished a particularly athletic round and were cuddled up, spent. Out of nowhere, she pipes up nervously: “Hey … I think I’m really falling for you. I don't want this to just be sex or games anymore. I want to really try being together.”
I froze. The words I had been longing to hear suddenly terrified me in that moment. My throat clenched up as a wave of panic crashed over me (yes, I’m well aware of how stupid this was in hindsight). After an agonizing pause, I managed to choke out: “I’m sorry, but I can’t do that. This thing between us was only ever supposed to be fake. I don’t think of you that way.”
I could actually see her face crumble. She quickly mumbled “okay” and slid out of my bed, wrapping a sheet around herself to cover her dejection. I swear I heard muffled sobs through the wall once she was back in her guest room. I felt like a piece of shit.
The next few days were some of the most awkward, brutal tension I’ve ever experienced. She was now acting like a scorned woman just doing her job, no intimacy whatsoever. We could barely make eye contact.
It took seeing her so closed off, so cold, for me to realize how much I desperately missed her warmth, humor, friendship. How much I longed for the easy intimacy we once had, both emotional and physical. I tried a few times to apologize or explain myself, but she brushed me off — utterly walled off to protect herself.
After days of wrestling with my suppressed feelings, I realized that I was in love with this wonderful woman. Hiring her as a fake girlfriend was one of the best things I had ever done because it brought her into my life … and now I didn’t want to let her go. She was becoming my person, even if she had started out as a farce.
But here’s where I really need some impartial perspective — AITA for freezing up and rejecting her confession?
I didn’t meant to tank her feelings so callously. I think I just ... panicked in that moment. The idea of committing to a real relationship terrified me in ways I didn’t expect. My career keeps me constantly on the go, always jet-setting to the next thing. Could I really give a romance the time and energy it deserves right now?
Part of me also felt massively conflicted about the circumstances. I’m literally paying her to pretend to be my girlfriend as a sort of ongoing petty revenge. If I admitted I wanted to actually date her, wouldn't that blur consent lines in some messed up way? Like, is she just going along with it because she’s on the payroll?
I know these both sound like flimsy excuses, but they were very real fears racing through my mind in that moment. Fears that made me impulsively reject her, despite how utterly gone I was.
Now, days later, those same hangups don’t seem so insurmountable. Maybe she and I could make something work, travel schedules and all. And if she reciprocated feelings, it would be a starting point — not her just placating me for a check. We could rip up the old arrangement and start fresh.
But I haven’t confessed any of this to her yet out of gut-wrenching cowardice. She’s still giving me this cold, professional shoulder. I don’t know how to begin recanting my idiotic reaction and opening up about the REAL reasons I panicked — the commitment fears, the moral dilemma, all of it.
Part of me wonders if I even have the right to try and pursue things with her at this point? I absolutely shattered her feelings for my own hangups just days ago. AITA for potentially stringing her along further by trying to retroactively take it all back? Maybe I’ve missed my window and should just let this phase of my life be over before it gets even more painful and messy?
Ugh, I’m rambling now. The crux is — AITA for how I recklessly rejected her in that moment? Do I even have a right to try and make amends after that thunderous fumble? Or should I just take the L, chalk it up to collateral damage of being in the world’s most messy pseudo-relationship, and move on?
⇧ 5843 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/juryofone · 14h
YTA, but only because you handled the initial rejection in the worst way possible. Your reasons for hesitating are somewhat understandable. But you really dropped the ball in communicating that to her in the moment.
Instead of calmly explaining where your headspace was at, you just blurted out a kneejerk rejection that crushed her feelings. No wonder she went ice cold — that had to sting like hell! If you had taken a breath and talked it through with more nuance, maybe you could’ve reached an understanding.
The good news is, you’ve now realized how much you DO want this woman in your life as more than a pretend romance. I don’t think you’re an AH for having those feelings or wanting to pursue her again, provided you make a sincere, thoughtful effort to apologize for your tactless approach before.
My advice? Explain the real reasons you froze up, how torn you felt over everything, and make it clear you still have feelings. But lead with a heartfelt apology for how horribly you botched it at first. If she’s willing to give you one more chance after that, DO NOT blow it.
⇧ 1267 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/juryofone · 13h
I agree with this take. He’s not an AH for the situation, but majorly the AH for the WAY he handled rejecting her. That had to sting badly after putting herself out there. The mature thing is to own up to that and properly communicate where his head was at.
⇧ 849 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/juryofone · 12h
Yeah, going straight for “I can’t do that, I don’t think of you that way” after she bared her soul was so harsh and unnecessary. He could have let her down wayyyy more gently if he was that conflicted about it all. She must’ve felt like a fool!
⇧ 532 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/neutralpartier · 11h
NAH — I get that you panicked in the heat of the moment and why this whole situation is heavy with ethical quandaries. The reality is, you two started off pretending but real feelings developed, and that’s okay! It happens. The moral issue only remains if you knowingly took advantage of or manipulated her feelings while she was on your payroll. Since you seem just as confused as she was, I don’t think any lines were really crossed.
The way forward is to rip off the bandaid once and for all. If you have mutual feelings now, figure out if you want to date as equals. If not, it’s time to part ways amicably while you both still can. But don’t keep paying her while catching feels — THAT would make you an AH.
⇧ 1078 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/glasshalfempty · 10h
ESH ... look, you suck for how you handled rejecting her confession. That was really hurtful and avoidant no matter your internal struggles. She sucks for going into this thinking it was all pretend, catching real feelings, and expecting you to want to be serious too. You PAID her to be your fake GF and made that clear.
My suggestion is to have an honest discussion about whether you can BOTH separate the transactions from reality. If you’re both all-in on trying for real, great! But one of you is going to get burned if expectations don’t align. And please, for the love of god, stop paying her!
⇧ 915 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/glasshalfempty · 9h
This is exactly what I was thinking too! Way too messy ethically to keep paying her as the lines blur between fantasy job and real romance. Either take the plunge and date properly or go separate ways for good.
⇧ 492 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/glasshalfempty · 8h
Agree but like ... is this even real? How does someone end up hiring a fake girlfriend to make their former best friend jealous? That alone sounds like a bad romcom plot.
⇧ 487 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/criticaloverthinker · 7h
I’m calling cap on this whole wild story. Childhood besties turned feuding enemies living in the same building? A fake girlfriend who moves in as part of an elaborate revenge plan? It’s all too unbelievable.
⇧ 603 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/struggling-with-reddit · 6h
I’ll play along and rate, but no way is this post legit lol. Having a fake girlfriend you eventually catch feelings for while pranking your neighbor? What’s next, one of you is actually royalty or a secret millionaire? Too much happening here.
⇧ 394 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/struggling-with-reddit · 5h
Hahaha I know right, the excessive details and backstory gave it away as creative writing practice or something. No judgment from me, it was an entertaining read at least!
⇧ 356 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/struggling-with-reddit · 4h
Next thing you know, OP will be claiming he’s Michael Schumacher or something 😂
⇧ 317 ⇩ | Reply | Give Award | Share | Report | Save | Follow
r/AmITheAsshole
u/veganGOAT · 8h
UPDATE — I’m the idiot who rejected then realized I loved my fake girlfriend … and she took me back!
When I made my initial post a bit over a month ago about this whole fake girlfriend situation, most of you understandably called it outrageously far-fetched.
Which, fair. How does someone actually end up hiring a woman to fake date them just to make their neighbor jealous? It does sound ripped straight from a Nicholas Sparks fever dream.
Well put on your straight jackets, because this ridiculous saga is 100% real. And I’ve got an update that’s even crazier than the original tale ...
After reading the feedback on my initial post (and getting a whole lot of shit from some friends too), it became crystal clear that I had to make things right. I put her through the emotional wringer by callously rejecting her in the moment, when her feelings were just as tangled up as mine were. I owed her a sincere apology and a proper explanation of why I froze — with no more deflections or excuses.
So I wrote her a long letter. I laid it all out there. How torn I felt about the ethical and emotional complexities of our arrangement. How her vulnerability awoke my own fears about commitment, my transient lifestyle, and whether I could realistically be the partner she deserved. Mostly, I repeatedly owned up to being a thoughtless prick who shattered her trust out of pure pathetic self-preservation.
But above all, I made one thing clear — despite my bumbling, I had fallen for her too. Completely and utterly. She had cracked through my defenses and healing her hurt became the only thing that mattered.
I ended the letter by owning up to the fact that she now held all the power. While she had moved into this arrangement under certain pretenses, I had violated that implied contract. The ball was entirely in her court now. I would abide by whatever decision she landed on — friendship, an amicable parting of ways, or taking the terrifying gamble of trying to make this the real deal.
When she emerged from her room the next morning, I could barely look at her. I was a sweaty, nauseated wreck, steeling myself for the worst. She sat down next to me in silence and unleashed the longest, most blistering dressing down of my life. How I had made her feel so small, so foolish, so painfully vulnerable. Words like “coward” and “asshole” were thrown around. But you know what phrase stung most?
“I wish you had told me all of this up front instead of dealing with it like a child. I could’ve understood where you were coming from.”
It was a dagger — she was absolutely right. My dumb automatic rejection utterly betrayed the openness and intimacy we had built. Still, she didn’t dismiss me entirely. She would need some time to think, but asked that I stand by for an answer.
The limbo period was … not fun.
After four excruciating days, she came to me again. This time, she was almost shy, like her old self. She told me she had thought it over extensively, and ultimately my explanation and full-hearted apology won her over. I may be an idiot, an asshole, and a bit of a mess (her words), but I was an honest idiot with a good heart under all the bravado. And that’s what had drawn her to me in the first place.
So with the understanding that we would both need to work on our communication skills and respective hang-ups, she was in. We would press the reset button altogether, end our old arrangement, and try to make this relationship happen for real — messy origins be damned.
That was exactly a month ago today, and things have never been better. Sure, we still lean into some harmless (and vaguely unhinged) pettiness with my former friend from time to time. Some habits are too fun to quit cold turkey. But ultimately, I’ve never been so grateful for the insane set of circumstances that brought this amazing woman into my life. We may have started as an acting exercise, but we took a leap together into something beautifully real.
And yeah, I still have to hear shit from literally everyone about how our romance origin story is the most unbelievable meet-cute of all time. But I’ve learned to lean into the absurdity. After all, what’s life without a little chaos and a perfect partner to share in the pandemonium?
Thanks to everyone who offered candid advice on my original post. You may have received an update sooner if not for all the people accusing me of faking it! All I can say is … this is my blissfully ridiculous reality now.
⇧ 1376 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/juryofone · 7h
Well hot damn, I have to hand it to you — this saga is even wilder than the original post let on! I went from being totally skeptical of the whole outrageous situation to being fully invested in this insane romance. Love that she put you through the wringer a bit before taking you back. You absolutely deserved that and more after treating her like you did.
But huge props to you for manning up with that apology and giving her the power to make the next move. That vulnerability and respect for her feelings despite your own doubts is what true partnership is all about. I have a feeling you two chaotic bastards are going to be just fine as a real couple now that all the crazy pretenses have been stripped away. Wishing you both nothing but more pandemonium and pettiness together!
⇧ 895 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/neutralpartier · 7h
I’m officially obsessed with this love story. You went from hiring a woman off to punk your neighbor, to breaking her heart over catching feelings, to doing the MOST to grovel your way back into her good graces, to ACTUALLY SUCCEEDING. It’s romcom gold! I need this to get optioned for a movie immediately.
⇧ 702 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/glasshalffull · 6h
As wild as this story has been from start to finish, this update has me straight up emotional! The groveling, the way you explained your fears, her roasting you for days before mercifully taking you back … my heart. Love that she cut straight through the bullshit by calling you an idiot AND acknowledging your good heart. That’s the ideal balance.
I’m so invested in this nonsense and need regular updates on how things progress from here. You better not blow it after all this chaos or I’ll be leading the charge to vandalize your apartment!
⇧ 629 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/romanticempath · 5h
What a journey! To go from manufacturing a fake relationship purely for petty vengeance, to developing REAL emotional stakes, to breaking each other's hearts quite viscerally, to finding your way back together through sheer vulnerability? Incredible stuff.
I laughed, cried (a little, don’t judge), and cringed throughout this entire saga. Thank you for bringing us all along for the insane roller coaster. I wish nothing but ridiculous happiness for you and her moving forward!
⇧ 583 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/fairytaledreamer · 4h
I’m sorry but I still can’t get over the fact that this is somehow a real series of events? You’re a madman and this is truly unhinged (but also incredible). How did ALL of this unfold before your 40s?
Romcoms have been put to bed. Welcome to 2024, where people actually hire fake GFs to get revenge on their scorned former friends, develop legit attachment issues, torpedo everything in a panic, grovel for redemption fit for cinematic history, and somehow STILL end up together in some sort of demented happily ever after!
All I can say is cherish the chaos you've manifested. I can’t wait to see what bonkers plotlines await the two you. Start recording everything for the biopic!
⇧ 514 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/fairytaledreamer · 3h
“Cherish the chaos” is absolutely the perfect sign off for this update. I’m deceased at this whole wild drama, but also soooo invested! Cannot wait for the inevitable Netflix mini series. Thanks for the laughs, drama, and emotional whiplash!
⇧ 409 ⇩ | Reply | Give Award | Share | Report | Save | Follow
r/offmychest
u/NotBritneySpears · 21h
My ex-bestie’s wedding to his obnoxious girlfriend was a nightmare … and so was their wedding night (unfortunately)
You’ll have to bear with me on this one, because I’m still reeling a bit from one of the most cringey, uncomfortable, and downright baffling weekends of my entire life. I need to get this off my chest before I have a full mental breakdown.
A couple years ago, I made a post venting about my former best friend’s new girlfriend at the time. For those who missed the saga, she was an insufferably loud woman who seemed to take immense pleasure in loudly narrating her sex life with my former friend right outside my apartment door. It was psychological warfare, plain and simple.
Well, I’m sure you can all see where this is going based on the title. Against all odds and reason, this woman and my ex-friend somehow stuck it out … until he put a ring on it last year. Which leads me to the first in a cascading series of mind-numbing events — receiving a wedding invitation from the happy couple!
Now, let’s be clear — I have not spoken to my former best friend in almost a decade at this point. Not since our cataclysmic falling out (a story for another day). We were thick as thieves until our bond was shattered beyond repair. For him to invite me to his wedding with the woman who crudely mocked their intimacy for my benefit was … certainly a choice.
On one hand, why on EARTH would you invite the person whose heart you deliberately stomped on so many years ago? It felt like a cruel joke, rubbing salt in an open wound that never fully healed. A reminder of their domestic bliss and my bitter ostracism.
Yet on the other hand, maybe there was a subconscious part of me that would have felt insulted if he didn’t invite me after so many shared years? As if he had utterly erased me from his life without a second thought? The thought gut punched me too in an admittedly unhealthy way.
Long story short, I RSVP’d yes … half out of morbid curiosity and half out of a deeply unwell desire to not get excluded from such a significant life event. In hindsight, a foolish decision that kicked off a horrifically uncomfortable series of events.
The wedding itself was … a lot. An over-the-top spectacle at an insanely expensive venue. My miserable self stuck out like a sore thumb surrounded by all the adoring couple’s friends and family. I sat through mushy vows reaffirming their “unlikely origin” in the “most unexpected yet fortuitous way” … while trying not to puke.
So yeah, sheer cringe start to finish. Little did I know the worst discomfort was yet to come!
In perhaps the most on-brand grand gesture of the entire weekend, the groom rented out an entire boutique hotel for all out-of-town guests to stay at after the reception. That way we could all keep the party going nearby before he whisked his new bride off to parts unknown on their honeymoon the next day.
Ever the gracious host with a penchant for the spectacle, he let wedding guests draw for their room assignments out of an actual top hat. I somehow managed to get seated right next to his parents who, while cordial enough, knew me as the ex-best friend responsible for so much fractured history.
But wait, there’s more! Wouldn’t you know, the universe is supremely messed up because I ended up with the room directly underneath the newlywed suite. Yes … I spent their wedding night listening to a live-streamed porn broadcast courtesy of the paper-thin walls and floors.
Dolphin sounds didn’t even BEGIN to cover the unholy noises raining down from above around 2am. I’m talking full-on screams of unbridled passion echoing off the walls at maximum volume. Mind you, this woman had become infamous for over-enunciating their coitus for my benefit previously. Now it was a frighteningly real-life rendition that no noise-cancelling headphones could drown out.
I finally had to flee my room to the lobby. I ended up crashing on one of the lobby couches until an employee politely asked me to leave around 6am. Disheveled, disoriented, and officially diagnosed with PTSD from the sounds I cannot unhear.
So yeah … not exactly a therapeutic reunion that could have allowed my ex-friend and I to bury the hatchet. If anything, this wedding was one massive “screw you” that opened up all the same unresolved wounds. I need about 20 years of intensive therapy to move on.
I also need to find a new place to live because I can’t bear returning to that cursed apartment building.
⇧ 1052 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/chronicgossiper · 18h
Dude, I think you need to get some serious perspective here. Your ex-friend getting married and going on a honeymoon has absolutely zero to do with you. That level of self-centeredness is off the charts.
Why in the world would this guy plan an entire wedding — one of the biggest days of his life — around secretly tormenting you again over ancient history? That makes no sense. He invited you as a polite gesture after years apart, probably hoping to start burying the hatchet. The room assignments were random by your own admission.
As for the … “noises” … look, they were on their wedding night. Maybe overenthusiastic, but 100% to be expected between newlyweds. It’s not some psychological ploy, just poor planning on their part for thin walls. You’re projecting like crazy if you think that was directed at you specifically.
At a certain point, you have to realize the universe doesn’t actually revolve around your grudges or history with this person. They’ve clearly moved on to live their best life. It’s on you to stop obsessing over them and do the same.
⇧ 978 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/chronicgossiper · 16h
I agree, this is just pure paranoia from OP. No newly wedded couple is sitting around thinking “how can we sneakily stick it to your ex-best friend during our wedding festivities?” That’s deranged thinking.
They invited you to be polite, you drew an unlucky room assignment near their suite, and then biology happened on their wedding night. Hilarious and awkward coincidence? Yes. Intricately designed fuck you from the bride and groom? Come on now, that’s giving them way too much credit.
⇧ 816 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/NotBritneySpears · 13h
Maybe you all have a point, and I am still holding onto way too much resentment and baggage from our falling out. My intention wasn’t to imply they orchestrated an elaborate sting operation around their wedding. More just a general sense that the universe has a funny way of reminding me about them at highly inconvenient times over the years.
⇧ 283 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/NotBritneySpears · 12h
Even that line of thinking is incredibly self-centered though. Why would random coincidences or them just … living their lives be the “universe’s way of reminding you” about your failed friendship? That makes it sound like they should perpetually be walking on eggshells and avoiding certain life events just because you can’t get over the past.
Look, it sucks that things fell apart so badly between you two. But they have clearly moved on, as you should too. This obsessive framing of their marriage as some universal affront to you is … not healthy, my dude.
⇧ 485 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/nosyandproud · 10h
The wedding itself sounds like it was in poor taste for sure, so I can certainly understand feeling aggravated and triggered being there as the scorned former friend.
That said … you’re borrowing A LOT of trouble by assuming any of their private wedding night activities were purposely being broadcast to you specifically. Projection level 1000 there.
At the end of the day, these people have built a whole entire life and future together now that quite literally has nothing to do with you anymore. You looking for “signs” that they’re still fixated on you is just self-involvement. For your own mental health, you have to let go of whatever happened and see them as background characters in the story of your life now.
⇧ 491 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/realitychecker · 7h
OP, you need to take a step back and realize that the sheer logistics involved in purposely torturing you at their wedding are just not plausible. Do you really think they were like:
“Alright honey, for our wedding night I was thinking we should make sure your former friend gets the room directly below ours! That way when we really get after it, he’ll be able to hear every excruciating moan and body smacking sound in haunting detail! That’ll show him for being your friend a decade ago! Mwahaha!”
Come on, mate. That’s delusional cartoon villain level scheming you’re attributing to them. Occam's Razor — they just wanted to consummate their marriage in privacy and didn’t account for the thin hotel walls. The world doesn’t actually revolve around your history with this!
⇧ 463 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/realitychecker · 5h
Lmaooo the idea of them sitting around strategizing the most psychological warfare possible on their wedding night is killing me. “Yes honey, we simply MUST reenact scenes from our noisiest adult films for your ex-best friend’s terrible pleasure!”
⇧ 418 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/buildingbridges
OP, it seems like you really miss having your friend in your life if I’m reading between the lines here. Getting invested to this level over random coincidences at his wedding doesn’t come from a place of hatred, but hurt and longing for that bond again.
My advice? Use this weekend as a wake-up call to stop obsessing, reflect on whatever caused your rift, and decide if you want to properly reconnect. If not, you need to rip that band-aid off for good and stop torturing yourself over what will never be again. Or the walls between you two will just get thinner and thinner ...
⇧ 204 ⇩ | Reply | Give Award | Share | Report | Save | Follow
r/ask
u/amateurdetective · 15h
I think these juicy Reddit posts actually interconnect … but I need your help cracking the code
I think I’ve stumbled onto something wild here and I need the Reddit hive mind to help me piece this tangled web together. Are you ready for some batshit conspiracy-level connecting of barely-there dots? Too bad, I’m going in anyway.
So, over the past few years, I kept seeing these extremely juicy, dramatically-written posts pop up every few months that seemed … oddly interconnected despite being in different subreddits.
Hear me out:
First there was the unhinged post in r/offmychest from a guy ranting about his former best friend’s obnoxious new girlfriend. Dude was griping about how this woman would loudly recount the smutty details of her sex life with the ex-friend whenever she was in his general vicinity, seemingly just to mess with the OP. We’re talking legitimately disturbing stuff about feeling “psychologically tortured” by her oversharing.
Fast forward a few months and I stumble across a wild post in r/relationships from the perspective of this same “obnoxious” girlfriend! Except her story painted a whole different, unhinged picture — she was hired on FACEBOOK MARKETPLACE by the former friend to literally move in and fake date him as part of an ongoing revenge plot against the OP from the first post. She rapidly develops legitimate feelings for the guy and it becomes a messy will-they-won’t-they romcom situation.
But THEN there was a follow-up post from the fake boyfriend’s side in r/AmITheAsshole about him realizing he caught feelings too before nearly blowing it, followed by another saga-capping update about them deciding to pursue a real relationship against all odds and absurdity.
Are you seeing the parallels here? These three posters each gave one side of an absolute dumpster fire of a convoluted love triangle situation that seemingly intersected. And based on the intricate backstories, my crackpot theory is they all emanated from the same formerly tight friend group that experienced a bitter falling out.
The insane attention to detail, literary flair, and geometry of it all almost had me utterly convinced these were all fictionalized creative writing exercises posted separately across Reddit … but building on the same unhinged storylines each step of the way.
I’m utterly obsessed with mapping this all out into one cohesive narrative now. My working theory is something like this:
Some guy hired an actress to pose as his fake GF and torment his former friend as revenge for some past betrayal
The two fake partners rapidly caught real feelings amid the ruse, he panics and nearly torpedoes it
Meanwhile, the ex-best friend is losing his mind overhearing the fake girlfriend’s loud performances and comes to Reddit for advice, not realizing it’s all a ploy
After a saga of miscommunication, the fake boyfriend comes clean and the couple decide to actually date for real
Capping things off, the former friend is forced to attend their wedding where he’s subjected to one final night of unholy noises
Does it all track? Or have I completely unraveled the conspiracy and stumbled onto a drastically personal set of circumstances being workshopped on Reddit? If so, that’s some ludicrously elaborate storytelling!
I need to know if I’m onto something here or completely off my rocker. If the former, I’ll burn every last calorie mapping out a master record of events across all the posts. If the latter … someone needs to drop their juicy fanfic writing prompts because these were WILDLY entertaining reads.
Help me connect these dots or point me towards any other potentially linked tales! This has been a public service aneurysm brought to you by pure boredom.
⇧ 681 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/scepeticbynature · 14h
Wow, you’ve gone full Sherlock Holmes with this. I’m dying at how insanely detailed your working theory is in tying together these random Reddit posts into one cohesive narrative. This is either a brilliant piece of performance art … or you need your meds adjusted, my friend.
⇧ 231 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/scepticbynature · 12h
Hahaha exactly! The amount of time and brain power OP has devoted to mapping this out is beyond obsessive. I don’t know whether to applaud the commitment to the bit or get them professional help.
⇧ 102 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/amateurdetective · 10h
I’m sorry, did you actually read through the posts in question? The intersecting pieces of random, elaborate backstory between all three distinct voices is way too specific and layered for it to be an accidental alignment. There are unambiguous throughlines about:
A pair of feuding former childhood best friends
One hiring a woman off Facebook to pose as his fake GF and torment the other as revenge
Said fake relationship descending into a very real emotional entanglement for both parties
The eventual fallout of the ex-friend having to bear witnessing the real couple’s wedding and chaos that followed
Like that’s such a bizarrely specific plot keeping consistent across three different users’ lenses! So you’re either pointing out the artistry of someone doing an incredibly elaborate creative writing exercise across multiple subs … or these people are just leading unbelievably unhinged lives. And part of me hopes it’s the latter? It’s too batshit crazy not to be true!
⇧ 286 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/amateurdetective · 9h
Or, and hear me out … it’s all an internal dialogue you’re having with your numerous Reddit personalities to work out your own unresolved relationship issues. We’re all just incredibly intricate fragments of your aching psyche!
⇧ 257 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/opinionatedtruther · 7h
Lmao you are both nuts, but I have to side with OP on this one. The chances of these being all interconnected fabricated stories is way too perfect to be an accident. All the tiny threads and recurring backstories/character details woven between wildly different subreddit posts? That’s not a coincidence.
I could buy it maybe being some extended Reddit fanfic experiment between a couple of redditors seeing who can craft more engaging characters and drama while world-building off each other’s plot threads. Like a weird form of collabing through the confined lens of Reddit posts. It would be pretty genius if so.
But for it to be entirely real with all the coinciding details scattered across entirely unrelated posts like that? I’m sorry, but there’s just no way. That’s beyond the scope of believability for me. OP may be bungling the conspiracy, but they’re onto something for sure!
⇧ 237 ⇩ | Reply | Give Award | Share | Report | Save | Follow
u/amateurdetective · 6h
THANK YOU, someone gets it! And to answer your other theory … while I can’t 100% rule out some sort of viral Reddit fanfic experiment, I struggle to believe even the most creative writers would be capable of improvising THAT intricately interconnected of a storyline stream-of-consciousness style like that.
Like each voice and perspective they inhabit remains remarkably consistent across such wildly different contexts (relationship drama, life events, ethical debates, and updates). It would take incredible skill to stay in the headspaces of these distinct individuals and keep their personalities/plot orbits from tangling into an incomprehensible mess. While possible, it seems incredibly unlikely.
That’s what has me believing there’s a remarkable kernel of stranger-than-fiction truth at the heart of this whole saga being teased out piece-by-piece. Or again … I’ve finally been gaslit into being a tin foil hatter of beautiful Reddit fantasies. Either way I’m here for it!
⇧ 209 ⇩ | Reply | Give Award | Share | Report | Save | Follow
Reply to u/amateurdetective · 3h
All I have to say is please touch some grass and post to r/creativewriting instead 🙄
⇧ 74 ⇩ | Reply | Give Award | Share | Report | Save | Follow
1K notes · View notes
portgasdwrld · 1 year
Text
📂 Op men + them being jealous
part 1
Featuring: Monster trio (Luffy, Sanji, Zoro)
Warning: fluffy fluff, ended up being the monster trio being subtly jealous lol Ik I was going to make it suggestive but I like it better that way, might change it for the others
Note : After 200 weeks, 1500 minutes and 25 years, I’m finally posting this serie after thousands of drafts 👩🏻‍💻 y’all don’t know how many times I wrote and erased stuff 😭
Tumblr media
Luffy
The crew just landed on a new island, it was a huge forest, not a person in sight. You weren’t particularly a big fan of walking around in an unknown deserted place, especially in the New World where you never knew on what or who you could fall.
On the other side, Luffy was absolutely fearless and enjoyed the thrill of exploring the unknown and seeing unusual creatures; Sailing was all about that for him. An adventure wasn’t an adventure if he didn’t feel that rush of adrenaline faced to a strange situation. He had insisted you come with the exploring team while you pleaded to stay behind with Robin and Usopp.
But here you were walking glued to Sanji as your boyfriend lead the way somewhere in this lost territory filled with trees and the noises of wild animals. He was screaming in excitement when he came across weird insects or odd looking vegetables. You sighed heavily as the anxiety was still heavily present in your system.
The cook adjusted his pace to match yours sensing your uneasiness about the situation. He knew you only came for Luffy, so he made sure to help you feel more comfortable in his own way.
Luffy ran forward as he noticed a beautiful blue flower tinted with yellow strokes that looked like gentle waves. He took it and searched for you with his eyes.
-This would look so pretty on your hair!
He exclaimed as he walked over to you and Sanji while waving the flower in his tan hand. You smiled as you thought it was adorable, but Luffy’s eyes quickly glared at your arms wrapped around Sanjis. He didn’t say anything and simply fixed the flower behind your ear, complimenting you with loving eyes and his cute grin.
-You look perfect!
He announced as he put his arm around your neck, naturally removing you from Sanji. A giggle left your lips as you melt into his familiar warmth. His eyes looked down at you with so much love and care, he wouldn’t want nothing to happen to you. Sanji laughed as he noticed Luffy successful attempt to get you away from him.
Your boyfriend closed the distance between his face and yours. With slightly furrowed eyebrows and serious eyes, he wondered if you were fine.
-Yeah, I just feel uneasy about walking here if I’m being truly honest. I’m not a fearless warrior like you, let’s say~
You explained calmly as you stared back into his big brown eyes. His expression softened up and he moved his arm to be able to grab your hand instead.
-Alright, then stay close to me only. I’m the strongest, so I will protect you no matter what! I promise!
-You’re sweet, thank you Luffy.
He gave a squeeze to your hand as you two followed the group through the millions of trees. Luffy smiled to himself, knowing you were relying on him to protect you now~
Zoro
It was all going well, a great night where Zoro was simply enjoying his time drinking with the others. It was all going great until he noticed a man that kept staring at you. You didn’t notice as you were busy goofing around with Usopp, enjoying a fun conversation.
Zoro felt this feeling of frustration grow in him the more he glared at the person shamelessly eyeing you like he clearly couldn’t see you were taken. That’s when it snapped for him: maybe they couldn’t tell? And that angered him even more. How can this person stare at you like a candy while he was sitting just next to you.
The swordsman pulled you closer to him, making sure his arm around your waist is noticeable. He smirked relieved when he saw the man look away with an annoyed huff. He took a sip from his beer as his smile got bigger. Zoro took that opportunity to slip a quick peck on your jawline.
You stared at him weirdly, wondering what have gotten into him.
-Wassup with you?
-I cant kiss you or what?
-Yeah, but you don’t usually do that.
-You always complain
He whined as he rolled his eye, but still he was glad that no one was hungrily looking your way anymore. You were his and he would make the possible to make it known. Even if it needed him to be outside of his comfort zone, he was going to make sure you were safe from lingering unwanted eyes (maybe to also make himself feel better)
You gave him a funny look, confused about his unusual bright expression. You pecked his lips not giving too much thoughts about it, before going back to your conversation with Usopp. You leant your body on your boyfriends that surprisingly responded to it by holding your waist tighter and rubbing his thumb against your tummy.
-You’re really acting strange, but I ain’t complaining
You said under your breath so only he could hear. He chuckled as he drank some more. You looked over your shoulder with a smile.
-Great, because you’re not leaving my side tonight.
Sanji
Hand in hand, you two walked through the village in the middle of all the varieties of shops surrounding y’all. You wanted to buy a necklace so you were hopeful to find something of your taste and Sanji was more than willing to help you.
He had already made his grocery shopping with you yesterday and organized everything late in the evening, so it was his rest day. He wanted to enjoy the sunny weather with his awesome lover on this pretty day.
It all started when the seller was proposing you multiple options at the table and he invited you to come in the store for something more refined for a beautiful person like you. Sanji didn't care, because of course you are beautiful, so it was only natural that other people would notice. He nodded excited to see what other options the man had that could fit you even better.
Sanji cocked an eyebrow when the seller pushed your hair behind your shoulders and got close to your face as he commented about you smelling good. You laughed as you thanked him, mentioning how your boyfriend bought the scent for you as you pointed at the cook. He put a gorgeous silver piece around your neck and handed you a mirror.
-What do we think?
He asked with a content expression, you stared at the mirror with a floating smile as you nodded, approving the jewelry.
-It's so gorgeous! Oh! What about this one?
You asked as your eyes flew to a more elegant necklace. You walked away from Sanji quickly as you engaged in a great conversation with the seller about the jewelries and some specific information, that your lover was honestly unfamiliar with. Sanji felt like you kind of forgot about him and started to wander around the store on his own as he kept an eye on you, still.
"...should I get into jewelries.."
It was those type of thoughts that occupied his mind as he sulked in his corner. Though, Sanji is a gentleman and he loved more than anything to see you happy and passionate, so he put his jealousy aside to let you enjoy your moment. So, he put his ego aside and started to think about which one would look hotter on you-
-Chérie, have you find something you liked?
He asked you as he wrapped an arm around your waist and pulled you into him. You hummed as you looked at the other man and you both nodded, agreeing on something the cook had no clue about.
-I'm going to take this one, what do you think babe?
Sanji kissed your cheeks and whispered in your ears with a smirk.
-They all look beautiful to me, because you are stunning. I don't think I will be of a great help, my love.
You smiled to yourself, because Sanji likes whatever you wear or not. On his end, he just wanted to leave already and pamper you with kisses & hickeys all over your neck to celebrate your new necklace and maybe to let people know you were his..
5K notes · View notes
hazelfoureyes · 7 months
Note
Have you ever thought about the idea of a Clueless ace reader x ace alastor trying to figure out what all the fuss is about? Couple different ways it could go obviously but I feel like it would be a perfect comedy smut
Tumblr media
Thank you for this meal. Okay I know this is LOOSELY based on your prompt, please forgive me. Can I add in that they be a little tipsy?
After a few drinks, you and Alastor do your usual teasing and mimicking of the others dramatic displays of physical affection. But, unusually, Alastor seems to be really invested in the joke tonight…
Warnings/promises: light smut (fingering), wrong kind of haha, sconces, bad Angel accent, Under 1500 words
maybe the tag list? Works list: @ xx-all-purpose-nerd-xx
Alastor list: @celestial-vomit , @amurtan
.
Fuck Joke Around and Find Out
The evening started with drinks among the group gathered at the bar. Everyone talking, sipping, leaning into each other to be heard better. Vaggie’s fingers playing with Charlie’s, Angel inching closer and closer to Husk until he was quite literally on top of him, to Husk’s obvious embarrassment. At some point, Angel took Husker’s hand, the two slinking down the hallway. Soon after, Vaggie not-so-discreetly followed a bouncing Charlie to their top floor home.
After realizing the couples snuck off, you turned to Alastor and asked, already smiling, “Oh I guess it’s our turn?”
Your giggling slipped into mutual cackles, his brows rose and he asked, “Your room or mine?”
You threw your leg over Alastor’s lap and straddled him, mustering your best Angel Dust accent, “Pssst rooms are for squares, baby.”
Normally, especially when having a little to drink, the physical barrier between each other was thin and easily toppled. An unspoken understanding had formed some time ago, allowing you both to relax a little more than usual when in close proximity. He still attempted his touchy intrusions to fluster and bother people, but he knew that didn’t work quite as effectively on you.
“Squares? Oh, not us.” A smirk, his head somewhat dramatically shaking a reinforced ‘no’, making his bobbed hair sway left and right.
When you start a pitifully-motivated grinding against him, losing balance and tipping backward, Alastor’s large hands come to the dip of your hips and still you. A laughed, accent-less, “Thanks, trying to do it like he did,” fell sloppily from your mouth, your hands going to his shoulders for extra security. Your head bent down, stifling another nervous giggle from spilling out. “I think this is exactly how Angel had Husk pinned. Not a convincin’ portrayal, pookie?” Your accent was shit, but he smiled all the same. His ears were pressed down and to the side, resting a little more against his skull than usual, something that seemed to happen often when he had a couple glasses. It looked more relaxed than his normal way of wearing them, but you never asked him about it.
Alastor’s finger tipped your chin upward, pulling you in for a kiss against his grin. When you huffed, fighting the awkward laugh, he swiped his tongue over your lips and slid into your mouth. A hum, as you relaxed into it. What a long joke this is, you think somewhere a little up and to the left of your liquor softened mind.
When alone together, you’d occasionally play around. Just mimicking what ridiculous things the other sinners had done recently, laughing and moving on to general gossip and conversation. Maybe the alcohol was dragging out the bit.
His hands pulled you forward, your little hip movements actually making contact with his crotch now. You hear yourself moan into his mouth before you even realize you’d made the noise.
Thinking becoming a little fuzzy, you pull back from him, “Oops. Sorry. Got carried away.”
“No need to apologize. What’s a little joking around between pals?”
You nod before a surprised shriek is forced out of you, Alastor pulling your hips down and starting to sincerely grind against you.
“I didn’t expect you to remember all the moves, Alastor.” Your hand came to your mouth trying to still the tremble of your lips as you spoke. Other hand now gripping his shoulder to stay upright. You’d never have played around with any one else but him like this. Too much confusion to deal with after. But, Alastor’s “playing” was so convincing. You weren’t minding it, to your surprise, but you weren’t sure you understood the source material as well he did.
His head fell back with a roar, “Being an infrequent lover doesn’t mean I am a bad one.”
Oh. Was the blush on your face noticeable in the dingy light of the parlor? You had never heard him say that word before. His hips were still moving, but the laughing stopped. It wasn’t unpleasant, in fact you found yourself sinking a little more, letting your weight settle fully. It earned you a sloppy half-smile from him. “That would make them experts, compared to us,” You motioned your head in the general direction of the stairs.
“You think so?”, he leaned up to kiss you, you leaned back a little, causing his lips to miss yours. A quick annoyed glare passed over his face before slipping back into a neutral stare, “Are you in the mood for a good joke tonight, dear? I wouldn’t be opposed to making you”, he grazed his nose against yours, “laugh.”
You let him capture your mouth with his, a surprisingly more intense kiss, before pulling away again when you caught another moan rising up, “I don’t mind a good laugh, now and then.” Did you-you say that or Angel-you?
The sofa cushions were pressing into your back before you could process what had happened. Alastor’s body was resting between your legs, which were spread open around him. His lips didn’t leave yours, one of his hands cradling your neck to trap you between him and his hungry mouth. The other was undoing the button of your pants and sliding under the band of your underwear.
His back was arched, his considerable height forcing him to bend over you if he wanted to continue the kiss, which he apparently did. Now on your back, you wiggled under him, awkward and uncertain what role you played anymore.
When his fingers slipped past your bottom lips and the mound of his hand ground into your clit, you pulled away from him and both hands shot to your mouth. You were aware you were in a public space but you couldn’t see anything past the sofa. Everything beyond him and the tattered chaise lounge was shadowy and lacking contrast. Even then, your heart was pounding.
When did the playing around shift? Was this—- did he think this was funny? His smile was strong against your neck still, but maybe not?
You splayed your fingers out to better hide yourself, embarrassed at how your hips rolled into his palm. Looking past your hands, you could see him staring down at you now, wide shoulders hiding you from the light of the sconces above. He had the same look as always in his eyes, nothing out of place. Cooly, he asked without actually wanting an answer, “Do you think this is what they’re doing now? Or is everyone already…”
A finger slipped down and into you, your legs clenching around his hips. You heard him sigh, before a second finger began to push in. Your hips lifted off the sofa and angled into his hand, welcoming the way he was pressing down and into you.
Oh, yeah, no.
A pent up moan tumbled past your lips when his fingers crooked up and pressed into the soft bundle of nerves just inside your entrance.
“What a curious laugh you have, my dear. Are my jokes that good?” He buried his face into the crook of your neck again when a voice stopped him from leaving the little marks he had been set on.
“I thought jokes were supposed to be funny. When is the funny part going to happen?”
Alastor’s ears were pin-straight into the air, hair stiff and sharp, as his face slowly turned to the side to see Niffty sitting at the bar.
”Oh, was I suppose to leave when everyone else did?” His hand slipped out of you and then in turn, your pants.
“No, Niffty, dear. That’s quite alright.”, Ears faced back and down, eyes half lidded and smile clearly forced, “We were just— playing around.”
“Really? Cuz it kinda looked like you guys were gonna fuck.” She hopped off the bar stool and scurried down the hall, “Please don’t dirty the sofa, sir.” echoing behind her.
You patted his shoulder, lifting yourself up on your elbows, “Can I be Husk next?”
I wrote this while washing dishes— the dishes aren’t very clean but neither am I
༻Masterlist༺
2K notes · View notes
zhearun · 2 years
Text
I love how Tumblr tech wise is falling apart, but damn if their engineers make it really quick and snappy to open when you click a link of someone's profile on Twitter.
I swear it loads faster like that than if you open the app itself.
0 notes