#and it was relatively easy and natural for me to do them

[thesirenisles]

MARS’ WARRIORS

𓃭 aries 𓃭

✨💥planet energy, mythology & astrology obsvs✨💥

Aries Sun, Aries Rising, Venus, Mars

mars dominant, mars in the 1st house

Mars ruled.

Mars- Ascendant aspects, Sun-Mars Aspects

Strong Mars placements, Aries Stellium

✨💥“Her enemies had fallen. Sanguine showers painted the Earth a ghastly ruby hue. Wailing cries of defeat created a victorious symphony of which she savored…. cackling up at the heavens.”𓃭✨💥

Do not steal any of my original work & writing. Photos are either from Pinterest or collaged by me.

✨Majestic Martian,

Ruled by the blood-red planet of Mars, you blaze a path on this Earth with an unwavering air of confidence.

✨💥Regal is the word that comes to mind.

Never needing reassurance, you literally believe you have already won before ever touching the battlefield.

Mars has blessed you with an innate, instinctual battlelust... an energy that inspires some, frightens others, but entrances ALL.

While everyone else contemplates... you act. You win the battle and even after you've won... you're still not satisfied.

✨💥You crave the next battlefield.. another King to slay.. another display of your hard-earned glory and greatness.

Even though January starts our calendar year, March begets Spring, the season symbolizing the beginning of life. Is it no surprise this month is named after your planetary ruler and the beginning of the zodiac?

Mars the planet is named after the Roman God of war and battlelust (Ares to the Greeks, Sekhmet to Ancient Egyptians) The Greeks deemed him the spirit of battle and child of Zeus and Hera.

With this energy, you have a natural, primal and intrinsic ability to tap into pure... red... RAGE. ✨💥 𓃭

While it sounds a bit frightening, this manifests as an incredibly useful gift in so many avenues of life. A Martian or Aries will always be ambitiously setting goals, achieving them, and writing more before they can catch a breath.

✨💥You have the spirit of a winner. You do not even fathom the thought of failure.

You move through life aware of the power of every single person in your immediate space, ready for someone to challenge the crown that you bled for.

This may be due to having literal experiences being attacked, bullied, and just… bothered. Your energy is akin to Plutonian/Scorpio, whose ancient ruler is Mars.

The element Fire clarifies and you are Cardinal Fire! You're literally blazing the trail. 🔥

A natural debater and concise communicator, you often find yourself defending yourself and others. (Always going to clear the room! Esp. to defend the ones you love. I love this for you all).

You have probably been admonished for your bold nature and aggressive style of communicating by adults, teachers, and maybe even... employers.

✨💥But, you are just being real. Your energy thrives in authenticity.

You hate being given orders and have probably fought hard to get into a career with relative freedom... this could manifest as entrepreneurism or content creating.

✨💥 She who mauls... 𓃭

The Mythology of Mars

While attempting to gain understanding of the energy of this sign and pIanet, I discovered the very simliar origin story in the Ancient Egyptian, Sekhmet, ("She who is powerful"). The goddess is depicted with the head of a female lion and ruled the desert sun, war, total chaos, and healing. I do want to clarify. This is not a male lion with the extravagant afro (symbol of Leo.)

Sekhmet manifests as a female lion because they are the fierce protector and huntress within the pack or pride, literally embodying primal female rage.

A female lion mauling is much like aftermath of a Martian or Aries temper explosion. It's not always a defensive energy, but a prowling one where the Martian sets its' sights on an easy mark.. or prey.

This could be a person or a task.

Egyptian mythology states she was created from the literal wrath of the sun God, Ra.

✨💥As the story goes:

Disappointed with the ungrateful treachery of men, Ra conspired with Set, God of Chaos to harness and manifest the wrath in which he felt... creating the embodiment of female rage, Sekhmet.

The stunning maiden possessing the spirit of war, is unleashed upon the people of Ancient Egypt, mauling anyone in her path until the waters of the great river ran...red.

Sekmet was insatiable and her bloodlust lasted days.. She literally maniacally drank and gorged herself on the blood of the people. (Think: Akasha, Queen Mother of Vampires, in "Queen of the Damned")

Ra attempted to stop her, but being a daughter of the Sun... his powers had no effect. This drunken slaughter lasted until Thoth (Mercury to the Romans, Hermes to the Greeks) God of Trickery finally convinced her to drink wine under the guise of blood. The Goddess drank and fell asleep, calming the spirit.

✨💥I believe this is a valuable lesson anyone with dominant Mars energy has already learned quite a few times. You must utilize caution and strategy before rushing in.

✨💥THE ROMAN CIRCUS

On one hand, this is bad betch, rockstar, DIVA energy that can cosmically entrance the senses.

On the other... it can get a bit delusional…

✨💥 When I think of Aries energy, I think of the Roman Circus... (The Circus Maximus: Chariot Races, Gladiators, Live Animals, and Drunken Splendor.)

The event lured in many..under the guise of a celebration and glory. In reality, it was a grotesque sacrificial blood offering.

✨💥 To win the Roman Circus... was to suffer and harm many others. So, was it really a win at all?

This can be applied to the life struggles for some Martians or Aries who pursue a person or thing that is projecting a false but glorious image with everything they’ve got.

✨💥 I once knew an Aries sun (Aries Venus, this is for you too) who would always fall into silent competition with others girls because of just ONE Libra male in our social circle.

The Libra was a shameless flirt and seemingly a ladies man. However, he was very nonchalant towards the Aries sun... unresponsive to her direct energy. (Air sign men🙄)

She attempted numerous times, throwing very unsubtle hints sprinkled with arrogance. She knew that she was beautiful and wondered why he did not respect it.

✨💥 As beautiful as she was, she could not take the rejection. Aries HATES to lose. She needed to win.

Unbeknownst to the Aries sun, the guy was actually in the closet! Hiding his sexuality, he would only show his interest to women he knew weren’t interested... It was all a show and he was only projecting for societal benefits!

I share this story because I see this re-enacted amongst Martian and Aries women too often.

✨💥 In the spirit of battle, you set your sights upon who you deem as the most masculine man/woman or the one with the most options... because you want them to choose you above all.

You need to win. He becomes your Roman Circus. 𓃭✨💥

This happens to Martian men too… often rushing into a woman’s life before reading the fine print… only to have a cataclysmic collision of short-lived passion. 🫣

While I do applaud healthy competition, the female Martian complex often leads towards the Aries woman being trapped in a mothering role supporting a loser she only got because he used to be “the hottest guy in her area and everyone wanted him". (Giving major: Peaked in highschool mental vibes🤮)

✨💥You have a natural need to asess and rank a room according to power... or perceieved power. Badly aspected or unevolved Mars & even Pluto can make you exert force over those you deem weak.

However, those you perceive as powerful or heavily sought after seem to capture all of your romantic attention.

You want to conquer the most manly man and be the fierce queen at his side.

However, this desire comes from a need to feel glory. So people can become trophies… i.e. trophy wife or trophy husband.

HOWEVER, The problem with an "100% manly man… Toughest Hood Niiga… Greek God" archetype is that most men with these aesthetics did nothing to really gain them because their born handsome or are literally aware of the power of their own aesthetic!

Because your assertive energy is so direct and rivals that of a man at times… you can attract those pretty boys who are benefiting from male-pretty privilege & female sexual projection (i.e. the hottest and buffest guys girls assume will be the most sexual etc. NATE JACOBS CORE LOL)

✨💥Always remember… a less capable man is going to overcompensate!

He’ll be a knock-off designer... a fake… a fraud... and I am sorry to say, but I feel the biggest risks are (an unevolved Aries😭, Libra, Sags, GEMINI or Leo men...)

Not all of them, but they do have the tendency to exaggerate or be performative with their manhood. Pisces does this too, but they are not fooling an aries LOL.

✨💥This can become that gross Mommy and Son energy I mentioned. Eventually... if they are lucky.. the Martian can snap out of their bloodlust daze to realize this guy was just acting... Any additional mental manipulations is what can create a toxic bond which is draining over time.

This relationship dynamic will be fun at first but it fizzles out when you realize he has the maturity of a child!

✨💥Run away from the man who puts on the show, ladies! It's what I call.. the Roman Circus.

With this energy, you can definitely be a bit overbearing when you are trying to show that you care. This is never minded too much by those who know your fiercly loving heart.

✨💥 You are a queen! Remember that what’s meant for you does not always have to be won over. It can manifest organically!

You are multi-faceted. Embrace diplomacy and take time to contemplate decisions like your sister sign, Libra.

Your Martian sibling, Scorpio also teaches the lesson of patiently waiting and observing the situation before action.(No one is plotting like a Scorpio Mars 👀)

However, a Martian never stays down for long and always bounces back improved from life’s perils!✨💥

✨💥 Aries vs. Scorpio

Scorpio is a water sign, balancing out the fiery energy creating warm and inviting waves to lure you in.

Aries is a fire sign finding natural comfort in its sizzling Martian ruler and Solar energies... VA VA VOOM HOT..

✨💥The spirit of war lays waste to the lands and the God of the Underworld waits patiently to collect the souls.💥✨

𓃭

I believe Aries are our public leaders, change makers, warriors, and fierce inspiration. Their protective maternal energy is inherent and divine.

Sekhmet was equally feared and adored!

The likeness of the goddess can literally be found today in Egyptian art and architecture guarding the Pharoahs.

Much like Sekhmet and Ares, both Martian signs are an unstoppable force once in motion.

✨💥In the 1st house, Mars defines the personality and appearance. A perfect example is the feline-faced Nicki Minaj (Mars in the 1st house) on the left can be seen in what appears to be a Sekhmet inspired headress with lioness ears.

On the right… her Roman Circus🫣🙊😂

✨💥I can literally hear Nicki’s iconic maniacal laughter… it legit sounds like what I’d imagine of blood-thirsty, Sekhmet after she’s slayed a Kingdom!

This can get a little egotistical… but she IS a queen. 🤷🏾‍♀️

I love my Martians though. You guys are so inspiring and honestly age like fine wine!! The youthful fire within you never really stops burning.

✨💥Be sure you are a productive force and not destroying all that lays in your path!

Thank you for reading! Wishing you blessings! ✨💥

Pluto Obsevation ♏️✨

Neptune Observation♓️✨

Mercury Observation♊️♍️✨

[iloveetoeatbananas]

hiiii idk really what to call you bc yeah anyways i have a request fir u but feel free to take ur time with it idm at all seeing as ur blog is relatively new and u probably have a bunch of asks and stuff because ur first two fics were absolute masterpieces like literally anyways im rambling im so sorry uh

(u can skip that part) So my request is basically where minho and fem!reader are really good friends and shes like a track-hoe and basically has a really flirty personality so she flirts with all her friends and minho always gets flustered uh or something like that and one time he sees her flirting with idk one of the gladers and he gets jealous thinking that shes dating (said glader) and then she confronts him about it and they kiss and live happily ever after :D

sorry this is super long and confusing dont rush to do it take ur time !!

Ok I'm honestly getting so impressed with these requests, they are so thought out and unique and I'm literally living for it. Btw my name is Rosalyn so feel free to call me that or sometimes I go by rose but address me however you'd like <3 Anyways thank you so much for the request and all of the praise, I appreciate it sm!!

Anyways, this was a super cute prompt idea I absolutely love it, so I hope you enjoy!

______________________________________________________________

Jealous (Minho x fem!reader)

______________________________________________________________

Context: pre Thomas, read above for summary ^

Warnings: spice

Word count: 4K (I proofread, but again, don't be surprised if u catch some grammar issues.)

When you arrived in the glade being a girl, it was quite a surprise for everyone.

Most of the boys tried to be pretty accepting, and after a while, you managed to get along really well with everyone. But if you're being honest, it was all due to your rather, flirty, personality.

That, however, you can't really be blamed for. I mean, you couldn't help it, it was just the way that you were!

It did, however, prove to be a slight problem during your first few months in the glade. You can't blame the rest of the boys for taking your subtle flirty gestures the wrong way, if you were them, you'd probably take the things that you said the wrong way too. So by no means was it their fault for thinking you liked them. But unfortunately, you never reciprocated their feelings, which only confused them more.

Anyways, the first person to understand this was Newt. He was always okay with your overly friendly personality and never actually got the wrong idea from you. That's probably why he became your first friend in the glade, and why when he said you should become a track hoe, you accepted his offer immediately. He, along with the rest of the track hoes' were rather chill and you enjoyed spending time with all of them.

You would consider yourself the closest with them out of all the other people in the glade, so you often hung out with them during the bonfires and dinner. However, you were relatively close with just about every boy in the glade, given your personality, but regardless, you naturally gravitated towards everyone.

It took a couple months for everyone to come to terms with your behavior and rather flirtatious personality, so after about five months, everything was going pretty smoothly. Under the given circumstances and all. Being trapped in a maze was by no means easy, but you were making the most of it. You had developed a good daily routine, and you can only imagine without the structure you and the other gladers had built for themselves, you all would've gone mad by now.

Part of your routine was waking up early. Alby had made Gally and the other builders build you a hut for obvious reasons, and Gally was happy to do it if it meant getting on your good side. You enjoyed the privacy from the rest of the boys but since you had a hut, you had a bed. A bed that was impossible for you to force yourself out of in the morning. After a couple weeks though, you got into the right mindset and started waking up right when the sun started peaking over the maze walls.

You woke up early so you could get a head start with some of the work in the garden. This meant you just spent a bit of extra time plucking out weeds and getting extra fertilizer from the deadheads. You did this to lightly the load that you and the rest of the track hoes' had to do, and you also did it because you just enjoyed being productive.

But one of the secret advantages of waking up early to tend to the garden was seeing the runners leave right when the maze doors opened. You took the brief amount of time they had before leaving to talk to them because they were all very busy people, and getting any opportunity to have a quick chat with them mattered to you. Especially because it meant you got to talk to Minho.

You never admitted it to anyone, but Minho was one of the only boys in the glade that you actually felt attracted to. You couldn't quite understand why, but you always felt drawn to him.

Maybe it was because he was held so high by all the gladers, even though none of them were ever able to talk to him because of how busy his schedule was. He was in the maze all day and when he finally returned from a long day of working to find a way out of the maze for himself and everyone else in the glade, he would be in the maze room. He was working, constantly. Which is why you felt special whenever you had the chance to talk to him. Even if it was just for a couple seconds.

Or maybe you liked him because he still got flustered whenever you talked to him. You would always try to be as respectful towards him as possible, but your flirtatiousness always found a way to shine through. And he seemed to be the only boy who hadn't gotten over how flirty you were, even though every other boy knew that that was just the way you were.

Needless to say, you had a pretty big crush on him, one that you tried your hardest to deny. But you really couldn't help it, which is why you chose to become friends with him. You decided to settle with that because you were sure he wasn't interested in being anything more. Even though Newt often tended to think otherwise.

But you still couldn't help but think that it was just so cute how whenever you talked to him he would fumble over his words, or get as red as the tomatoes you were tending to whenever you even touched him.

However, whenever Minho acted all flustered like this, he would curse at himself relentlessly, wondering why he was as awkward as he was whenever he was near you.

The truth is, he had been down horrendously for you the second Alby pulled you out of the box. At first, he chalked it up to you just being the only girl and well, he couldn't exactly remember the last time he had seen one of those. But as the weeks went on, his feelings for you only deepened. He never saw a point in telling you because every boy who confessed his 'love' to you got rejected. Part of that made him feel glad though because he knew that just about none of the boys in the glade were good enough for you, and he felt happy knowing you would never like any of them. But the downside to that was Minho thinking that he would never have a chance with you.

That never stopped him from wanting to talk to you though. He would purposely make sure to stop by the garden to talk to you before he headed into the maze. Whenever you weren't in the garden, he would check the deadheads to see if you were there. Once he found you, he would make some excuse by saying he was just taking a walk in the woods to clear his head before going into the maze.

He really didn't know why talking to you mattered to him so much, but it just did. And today was no different.

You were nealing down next to garden beds that Gally and some of the others had just built. It was a relatively new addition to the garden and you had just finished filling them with soil and fertilizer yesterday. So you were eager to begin planting some of the last remaining seeds that were sent up from the box into the beds.

You could always tell when a month would pass by when you ran out. The box always sent up a certain amount of seedlings and by the time you ran out, a month would pass and the box would come back up, providing you with another month's worth. So as you planted the last seed in the pouch, you knew that in a few hours, a new greenie would appear from the box, symbolizing the start/ end of yet another month in the glade.

You stood up, dusting off your knees as you congratulated yourself on your wonderful planting skills. But your eyes wandered away from the garden and onto Minho, who was now walking your way. Your heartbeat quickened as you saw him. He arrived slightly earlier than normal because you noticed that you hadn't seen any of the other runners with him, but you also knew it would only be a few minutes until they came to join him.

Minho mentally prepared himself while he walked up to you, telling himself that he was going to be normal today, and he wasn't going to start stuttering like an idiot.

At least that's what he tried telling himself as he approached you, clearing his throat, "Hey (Y/N)," Minho said while resting his hands on that runner's vest he always wore on top of his signature blue shirt which complimented each of the defined muscles on his chest.

"Hi, Minho." You said with a smile on your face that couldn't help but make Minho blush. "What brings you out so early? The maze doors don't open for another five minutes don't they?" You questioned. You had gotten pretty good at telling time around the glade, even without a watch like Minho.

"Oh yeah, I just thought that maybe I'd get over here a little earlier," Minho said with an awkward chuckle as he tried to smile back at you.

"Ah, I see," you said before continuing, "Is it cause you wanted to spend a little extra time talking to me?" You said with a giggle, trying to make a little light-hearted joke as you stared up at Minho with puppy dog eyes.

Minho however, did not take this as a joke. He began blushing, hard. "Oh no that's not why- wait no that's not what I meant. Like I love talking to you but that's not why-" Before Minho could continue to embarrass himself further, you cut him off.

"Minho I was just joking." You said with a laugh, trying your best to reassure him because clearly, he was mentally freaking out. You couldn't get over how cute he was when he was like this. You were always so used to seeing him act serious and stoic in every other situation, but whenever it came to you, he was a mess.

"Yeah- right. Of course." Minho said awkwardly, trying his hardest to laugh off the situation. He felt his cheeks heat up as you continued to look at him for a moment while taking off your gardening gloves. He couldn't help but take the time to admire you and the features on your face while you did so.

You had your hair tied into a loose braid that was slung over your shoulder and onto your chest. His eyes glanced up and down your body to see that you were wearing a pair of low-rise jean shorts paired with a V-neck shirt that clung to your curves and exposed your chest slightly.

You noticed his eyes drift to your chest and laughed silently to yourself but didn't say anything else to him. You normally didn't mind having the boys in the glade stare at you because, at this point, it was to be expected. But you couldn't help but feel butterflies in your stomach as Minho looked at you, and you couldn't help but feel happy that you decided to wear this shirt today.

"If it makes you feel any better, I love talking to you too Minho." You joked, even though you definitely meant it. Your voice broke the slightly awkward silence that had filled the air while you put your hand on his bicep. No matter how many times you've made this gesture toward Minho, it never fails to surprise you with how firm his muscles are. It also never failed to make Minho physically stiffen and make his mind go completely blank.

You absentmindedly began softly rubbing Minho's bicep with your thumb. You were genuinely curious about how he had gotten this strong. Was it all the running he did? Did they have weights in the glade that you just didn't know about? You weren't quite too sure what it was but you were loving it.

You snapped out of your thoughts though as you saw the other runners approaching the garden. You looked back up at Minho with a soft smile as you took your hand off of him, "Well I hope you have a good run today Minho." You said while trying to snap him out of whatever trance you'd unknowingly put him in.

"Thanks," Minho said. At least he didn't stutter while getting that out, but then again, he only said one word. But it was a new record nonetheless.

You greeted the other runners with a smile and a wave while Minho's feet stayed planted in front of you, unable to move.

"We'll meet you at the doors Minho." Ben said as he and the others jogged past you and him, snickering at the whole situation.

You stared at him again for another moment, expecting him to move but something in him couldn't. "You should probably catch up with them right?" You ask him, hoping that you didn't just cause the glades best runner to short-circuit just because you touched his bicep.

"Right, yeah- yeah you're right," Minho said while letting out a soft chuckle.

"Be careful alright? I'll talk to you later." You told Minho as you patted him on the back while he began to walk past you.

"Okay yeah. Talk to you later." Minho said, still very flustered about what had just happened. He was still trying to process it all because even though you had been touchy with him before, it was never like this. There was something very different about it this time. He thought about it for the rest of the day while he was running in the maze, and even when he came back and ate dinner.

While Minho was showering before heading to the bonfire, he couldn't help but wonder if you also felt it, if you also felt the same energy in the air that he felt. Or if he was just overthinking an exchange between the both of you that hadn't even lasted more than five minutes.

The truth was that he wasn't the only one whose mind kept racing back to that moment.

You couldn't stop thinking about it either and it was distracting you this entire day. You didn't know what was so different about it this time, but you could feel something shift between you and Minho during that simple exchange. You brushed it off as much as you could and decided to turn your focus on showing the new greenie around.

He seemed to have taken quite a liking to you and was practically following you around 24/7, which you didn't mind too much. He seemed like a sweet kid who was around your age, behaving toward you the same way every other boy had toward you in the glade at one point or another.

As the day continued, the bonfire began and you found a seat with a group of about ten people, the greenie being one of them. He chose the seat right next to you and after a couple drinks, he had his arm around you. In your eyes, it really wasn't that big a deal. You thought it was sweet that he was opening up so soon, and you had to admit he was pretty funny. You couldn't help but laugh at a lot of his jokes.

But Minho wasn't too big a fan of how the new guy clung to you. While everyone gathered at the bonfire he couldn't help but notice how the very obviously drunk boy, had his arm around your shoulder and it was driving him crazy. He had been hearing whispers from the other gladers about how you were going to start dating him and the mere thought of it made Minho's blood boil. Even though all the comments that had been made about you and the greenie were jokes because everyone knew you well enough to know you were just being friendly, Minho didn't know that.

You were in the middle of a conversation with the new guy and the rest of the group when you spotted Minho walking in your direction. At first, you got excited, you had been waiting to talk to Minho this whole day. But then you looked at him and noticed the stern, almost angry expression he had on his face. Your confusion only grew as he stopped right in front of you, his build towering over you as you stared back up at him.

"Hey, can we talk for a second?" Minho said through gritted teeth. The amount of anger in his voice was prominent, and you couldn't lie, it was kind of hot. Minho was not a hot-headed person, so seeing him be anything other than stoic or flustered was new for you.

"Uh sure, is everything alright?" You ask with genuine concern. You didn't know what could've gotten Minho this angry so you were relatively worried.

"Yeah, it's fine. Just- can you come with me?" Minho said quickly, and it was obvious to you that it, whatever 'it' even was, was not fine. You took Minho's hand anyway as he helped you up from your seat.

Everyone in the group was staring at you, just as confused as you were while you told them you'd be back soon. You shot the greenie a wave and you could've sworn you saw Minho roll his eyes and scoff as you did so.

Minho led you to the edge of the deadheads and stopped by a nearby tree. There was silence between the both of you and you were waiting for Minho to say something. When he didn't, you spoke instead, "So what is this all about?"

Minho crossed his arms as he began to reply, you couldn't help but notice fury in his eyes as he spoke, "I should be asking you that."

"What?" You questioned, slightly dumbfounded and slightly confused by Minho's harsh tone. He'd never spoken to you in such a way, so now you were really racking your brain trying to figure out what you could've done to piss him off so much.

"Oh don't pull that oblivious klunk with me (Y/N)." Minho sneered.

"I'm not acting oblivious, I don't know what you're talking about, seriously." You said while putting your hands up in surrender, and it was the truth, you really didn't know what he was talking about.

"I'm talking about you and the greenie. How you guys were all over each other. Are you dating him or something?" Minho spits out, venom and jealousy lacing his words.

You couldn't help but laugh as he said this but you quickly realized he was being serious. "Wait you're kidding, right? Me and the greenie? No Minho he's just a friend." You said in an attempt to reassure him.

"Well, it didn't look like you were just friends. Not by the way he had his arm around you." Minho blurted out.

"Are you getting jealous Minho?" You asked with a grin on your face. Minho stayed silent for a moment after you asked, so you spoke again, "Why would you care anyway? It's not like you like me like that or anything." Annoyance in your voice this time. Who was he to act so pissed off about it if he didn't even like you?

"Who said I didn't?" Minho questioned while staring dead at you.

Now it was your turn to be silent.

"You like me?" You said as you just stared at Minho for a moment longer, wondering if you had really heard him correctly. A sliver of hope surged through you as you thought of the possibility.

Minho quickly realized what he had just said and just stared at you. Did he really just say that? Why did he just say that? His words got stuck in his throat and he stayed quiet.

"Minho answer my question."

"Yes, okay? Yes, I like you. So what if I do? Are you going to reject me the same way you reject every other boy?" Minho asked with genuine curiosity.

Before you or he could say anything else, you kissed him.

You hadn't even realized how long you had been waiting to kiss Minho ever since you laid your eyes on him. But as your lips merged into his perfectly, it all just felt right.

Minho melted into your touch as you wrapped both of your arms around his neck and he pulled you in as he placed both of his arms around your waist. The kiss you both shared was gentle yet passionate as you fell deeper and deeper into his warm embrace.

You pulled away for a moment to look Minho in the eyes, "I like you too Minho." You said with a warm smile that almost made him pass out. Minho's heart melted as he heard those words come out of your mouth. They were what he'd dreamed you you eventually say to him, and he couldn't think of anything else to do at that moment than to kiss you again.

The kiss between the both of you deepened and only became more sloppy and desperate as if the both of you couldn't get enough of each other. You allowed his tongue to enter your mouth and taste every bit of you. You could tell that he must've had some muscle memory from his life before the maze because he definitely knew what he was doing as his tongue wrestled against yours.

Minho pushed you onto a nearby tree and moved one of his hands from your waist and to your ass. You moaned softly into his mouth as he did so and you pushed yourself into him further, which only caused Minho to harden against you.

"Oh, there you guys are. I assumed you guys got everything settled?" Newt asked as he interrupted you and Minho. You both pulled away for the second time, breathlessly, and stared at him for a moment.

"Oh yeah- everythings um, settled. I guess." Minho said while turning around to face Newt. Newt gave you a look and you just gave a thumbs up and an awkward smile back to him.

"Alright well, I just wanted to let you know (Y/N) that the greenie was wondering where you were," Newt said with a smirk while scratching the back of his head.

"Oh, well- just tell him I'm busy or something." You replied hastily. You had waited long enough to let Minho know how you felt and you wanted nothing more than to turn all of your attention back to him now. Minho looked at you and grinned, obviously very pleased with your response.

"Will do," Newt said as he began to walk away and back up to the bonfire to join everyone else. You blushed as you put your hands up to your face and buried your head into Minho's chest.

"God that was so embarrassing." You said, your words muffled in the fabric of Minho's t-shirt.

"Oh come on there's nothing to be embarrassed about. If anything it's good that that shuckin' greenie'll get the message." Minho cooed as he wrapped one arm around your back and used his other hand to stroke your hair. He planted a kiss on your forehead as you took your hands away from your face and wrapped them around Minho's waist. You looked up at him again with a goofy grin on your face, which only made Minho grin at you back, "What, what is it?" He chuckled.

"You never struck me as the jealous type." You stated while tilting your head slightly before continuing, "Not like there's anything wrong with that though."

Minho only smiled back at you and brought his lips to yours once more, holding you in his arms as if he found the one thing that he wanted to hold onto for the rest of his life.

______________________________________________________________

alright yall here is yet another Minho fic

I hope you guys liked it and tysm @minhoshotharness for the request!! It was so fun to write and I hope that you liked what I did with the concept.

plzplzplzplz keep sending me these requests guys, I literally LOVE writing them

[tuliptic]

Messages From The Divine

This Pick a Card/Pile is for you and me to hear the messages from the divine. Who wants to talk to you? What are the messages they bring?

Close your eyes, meditate on this topic and ask yourself the question. Breathe in and out, make sure your mind and heart is calm. Then, open your eyes to see which pile talks to you the most/draws you in the most. Once you’ve found your pile, scroll down to the respective parts to see what are the messages for you.

Piles go from left to right.

Disclaimer: This is solely for my entertainment purposes. Take only whatever you feel like it. If it doesn’t resonate, it means I’m not the reader for you and it’s okay to just drop it. Besides, I do not consent to my work or images being used by third partis on this platform or other websites as well.

Decks used: Luna Cat Tarot Deck (Major Arcana), Linestrider Tarot Deck, Sweet Dreams Oracle Deck, Starcodes Astro Oracle Deck

Pile 1

Message from the goddess Selene

My dear… -sighs- You’re strong, you’ve fought so hard for everything to be in place, you’ve fought for the world to be in your hands. What does that feel like? You realized that achievement isn’t everything, correct? You realized that you needed more strength to face more things that you used to love, right? I’m not saying you're wrong, I’m just… I just want you to be happier, to be more at peace with yourself.

You are starting a lot of new projects and you’re slowly draining yourself out. I’m worried about you. Starting one or two is still alright, but the more you start, the more you have to see through it until the end, and that’s slowly eating you up. What started as fun is starting to become a burden, a responsibility you’ll need to bear. Success will be coming your way, but please do not let it lose your sense of fun, please do not let it lose your sense of self.

-Sighs again- I see that you’ll be very busy from now on, with how many projects you’re having with you, and that things are going to be moving at a very fast pace, probably faster than you can catch up. When this happens, know that I’m here for you along with your higher self, and we’ll be communicating with you in your dreams to help you with whatever life has for you. You are divinely protected, especially by me. And as much as changes come, you just… Embrace them, no matter how fast they are, and you adapt.

As much as I worry for you, you seem pretty excited with all these movements. I believe they come as a pivotal change for you to transition into a new phase, into a new you. I am happy for you but I can’t stop worrying about how much you’re starting to put on you. Please remember to take care of yourself, alright? I’ll be here for you all the time, even when you can’t see me. Just look up in the night sky and tell me your happiness, your fears, your success, your worries. I’m listening. I’m here for you as your greatest supporter.

Pile 2

Message from the goddess Athena

How does it feel like? To finally regain the balance that you’ve always wanted? To finally accept the changes that came your way and make peace with it? You had so much fear, but you still managed to do it. Spectacularly, I’d say. You did a great job and I’m so, so proud of you for getting through those hard times.

Betrayals are such painful things to deal with, especially when it’s people you trust the most being sneaky and backstabbing you. However, fear not, my child. There’s always an end to a tunnel. Trust the process and keep running. Don’t let past disappointments stop you from having hope in this world. Continue giving, and you shall receive. Balance is what keeps the world moving, what keeps the world in a harmonious state. You give, and you shall receive. Even if it’s not now, it will, eventually. Believe that good karma will come back to you when you’re generous with what you have, including time and love.

You should also take some time for yourself, my child. Spend some time with me, meditate and think about where you want to go, what you want to achieve, what you want to let go, who you want to spend your energy on. It is a new phase, a new chance for your own growth, for you to challenge yourself to step outside of your comfort zone as you head towards illumination. You are a warrior, my child. You know that you’re the co-creator of your life and destiny, and you’re ready to take matters into your hands.

Whenever you feel tired or you need help, come to me. If you’re willing to receive help from me and the Universe, help shall fall upon you. Believe. Trust. Love. Live life to the fullest. I am with you.

Pile 3

Message from the goddess Demeter

My dear child, I’d love to give you a huge hug. Whatever time of perils shall be over soon. Fate is now smiling at you, and the Sun is coming out to give you a warm hug. Do not fear the Sun, for it gives out light and heat to the world, for it gives warmth to the soul. The Sun is always there for you, let its rays kiss your forehead and remind you that you are very much loved.

Whatever painful times, whatever heart-stabbing moments are coming to an end. The swords are falling out and you can finally let yourself be healed. Stop treating your pain like it’s something you imagined. If you see the wound is real, then you can heal it. Be kind to your wounds, spend time and tend to them gently. My dear, I know you tend to have an overly rational approach to your day to day problems, and over-rationalize a lot of things. But my lovely child, reason itself isn’t the answer to everything. Let yourself and your emotions run. Accept that it’s alright to be unreasonable, that it’s already a time for you to let yourself loose. 

It may be very difficult right now, but trust that whatever that’s happening to you right now is intending to build you up to face the future stronger. You’ve been creating strong emotional connections with the important people in your life, haven’t you? Those people, they are here for you. They are always with you, physically or emotionally, and they are determined to bring you to wonderful places that are filled with wonder, delight and joy. 

My beloved child, your family may have disappointed you at times, but you have to remember you’re never a disappointment in my eyes, in the eyes of the people who love you unconditionally. I’m here to nurture you, to bring you to a place where warmth and light resides, to let you be able to release that warmth and light to the people you care for as well. I’m here for you, always, and forever.

Thank you for reading until the end! Feedbacks and reblogs are always appreciated! <3

[iridescentblued]

꒰୨୧꒱ — 𝐬𝐨𝐮𝐭𝐡 𝐨𝐟 𝐭𝐡𝐞 𝐛𝐨𝐫𝐝𝐞𝐫 !

꒰୨୧꒱ — 𝐩𝐚𝐢𝐫𝐢𝐧𝐠: geto x afab!reader

꒰୨୧꒱ — 𝐜𝐨𝐧𝐭𝐞𝐧𝐭 && 𝐰𝐚𝐫𝐧𝐢𝐧𝐠𝐬: nsfw / 18+, minors and ageless blogs dni! geto is a college algebra math tutor && reader is failing, written in lapslock, geto is a tinie, TINIE bit of a perv (but we love him), not beta’d in any shape or form so please excuse mistakes, unprotected sex (wrap it before you tap it, folks), piv, oral (f!receiving), use of pet names (kitten, angel, sweetheart), praise, reader calls geto ‘senpai’ until she doesn’t, size kink. wc; 8.5k

꒰୨୧꒱ — 𝒃𝒍𝒖𝒆 𝒔𝒂𝒚𝒔. . .  this is my first fic on this blog and also my first jjk fic in my entire life so please go easy on me aha i tried to keep it relatively tame, but based on my plans for the future, this will not be a trend sjfigjsfgj. reblogs and likes are greatly appreciated! ♡

there wasn’t anything special about your case; at least, that’s what suguru had thought when he picked up your request before he met you. before he met you, you were just another student trying to demystify the painfully enigmatic art of getting through college algebra. before he met you, he had already tagged this case as another charity stint — a good way to get brownie points with the dean’s office and the mathematics and natural sciences department. in fact, thinking of all his tutoring cases as community service made them somewhat palatable, if not a little forgettable. he was quite sure, at the time, that you’d be in and out — both of the tutoring center and his memory. such was the case with most of his other tutees, anyway. 

he hadn’t expected you to be… well, you — a pretty little thing, with your sweet smile and your wide doe eyes. on the first day, you’d stood out; you’d arrived at the tutoring center’s lobby in a short dress, knit cardigan, and coquettish makeup, as if every fiber of your being were bidding the spring a solid farewell. multiple heads had turned, including his, as you came up to the front desk and asked for one geto suguru for college algebra. you were eager for summer, suguru had learned as you broke the ice little by little, in part because you looked forward to visiting okinawa with your family, but also because you were eager to get your first semester out of the way. that much, you had in common with most of his other students — almost all of the ones seeking help in college algebra only took it as a depressing core requirement of whatever degree they were doing. you, specifically, were focusing on fashion design; that very vividly explained your attention to your looks. this mathematics class was a thorn in your side, a mandatory thing that was simply supposed to get you through later business-oriented classes in your degree program. for suguru, however, college algebra had become the perfect excuse from the moment he’d laid eyes on you. 

the more time he spends with you, the more he thinks you’re exactly his taste. it starts off with little things he finds attractive, things he picks up while he’s watching you fill out the practice sheets he’s prepared for you on quadratic equations or while trying to get you to understand logarithms — your neat, tiny handwriting, almost like print; your habit of boxing your final answers in firm strokes, even if they’re hopelessly wrong; your colored tabs, cascading down the page side of your textbook. but as the weeks wear on, he sees all the little things in between — the way your long eyelashes quiver when you stop and close your eyes as you think for the answer, the upturn of your plush lips when you have the same answer on the practice sheet as he does, the deepening of your artificial blush with a natural hue when you realize you don’t know the answers to his gentle questions. he notices that you refuse to wear anything longer than a knee-length skirt despite the still-strong winds, notices that your tiny palms are always smooth and pink, that your hair always smells of coconut milk. these are things he can’t help but jot down in his memory — that was exactly what you were, after all: memorable. 

and the more he remembers about you, the more suguru wants you. yet he’s never made a move, never given so much as a hint of his interest, not only because there are prying eyes all around the building but also because you have never so much as shown a smidge of desire back. in fact, he has to wonder if you’ve ever thought of him in a different capacity — not as a tutor, but as a man. if you have, you’ve never made that obvious; you always talk to him respectfully, the little wall you’ve erected between the both of you remaining steady, and you never let your eyes linger on his face for longer than it takes for him to explain what you don’t know. suguru has had his fair share of female students, and in all of them, he’s seen the same kind of hunger — to few, he’s catered to their whims, if only to pass the time, if only for his own benefit. but you, with your ribbons in your hair and your sweet, sweet mouth, have never once shown that same kind of desire. 

he doesn’t know if it frustrates him, but he does know one thing — it makes him want you all the more. 

he wants you even now, as you sit across from him, dolled up as usual. even now, as your eyes take on a glassy sheen of defeat, your cheeks puffing out in the way that tells him you’re admonishing yourself once again, he craves you — maddeningly so. and he realizes that it doesn’t really matter if you're not the one to fall first, as long as he can still have you. 

“time out,” you beg, your fingers meeting the palm of your hand to signal a break. “my brain feels like it’s going to explode.”

“you just had a break ten minutes ago,” suguru reminds you, though there’s a lighthearted amusement to his voice that makes you smile sheepishly. “at this rate, you’ll be on more breaks than you’ll be taking the time to actually learn.”

“i’m trying,” you groan, your fingers curling against your forehead as you bump your head against your fist. “i just don’t think i’m cut out for this polynomial whatever — trial and error bullshit.” 

“you’ll hate me for saying this — but you’ll never know unless you keep trying.” 

“funny.” your sigh rustles the papers in front of you gently. “how do you do it, senpai?”

“hm?” 

“you’re not only good at this stuff, but you’re so good you’re able to take the time to teach people like me.” 

“strengths and weaknesses — it’s the natural way of the world.” suguru smiles gently at you, and he notes how his chest feels tighter when you return the sentiment shyly. “i could never do what you’re doing in your own degree, try as i might. anyway, you’ll get there. i won’t let you become my first ever failed project, you know.”

“i wouldn’t want to let you down either, senpai, but—” the back end of your pencil taps lightly against the surface of the table. “it just feels hopeless. i can’t focus on anything. it’s so… so abstract, and everyone here is talking all at once, and i don’t even know what i’m ever going to get out of this class in the long run.” 

even when you’re dejected, you look pretty; your bottom lip juts out naturally when you whine like this, and for a moment, suguru can’t say anything in response. he’s too busy wondering what your mouth would feel like on his — on him. when he snaps himself out of his brief reverie, he notices you’re looking around at everyone else — and he has to agree that with the noise level in this whole building, it isn’t the most conducive site for learning, especially when the learner is already so averse to the subject matter.

“i can’t help much in the way of it being too abstract,” he says kindly. “but it’s not a requirement for us to have our sessions here. i know it can be quite distracting, all these voices flying around, so why don’t you look for a place that better suits you, and we can start meeting there instead? the more comfortable you are in your environment, the better you’ll be able to absorb the material, i’m sure.” 

“you think?” your pencil comes to a slow halt as you refocus on him, a thoughtful light glimmering behind your gaze. “yeah — yeah, i actually wouldn’t mind that. then, i’ll look for a different place for us to meet, and we can start there next week. how does that sound?”

“whatever suits you suits me,” he responds easily. 

he lowers his gaze immediately after you flash him a blinding grin; there are far too many people here, as you both very well know, and if he keeps looking at you and your pretty little expressions any longer, he might just give them something to actually look at. 

it had been your idea, not his, so why did suguru feel like he’d dragged you into a compromising situation?

you’d texted him over the weekend that your search for a new venue had been absolutely fruitless; every cafe and study space you’d been to was either too expensive or equally as packed with people, if not both. suguru had seen the preview to your message, but he hadn’t been prepared for what it read out in full when he’d actually opened it.

senpai, would it be too difficult to just meet at my apartment? i attached a map, so let me know!

it wouldn’t be too difficult; logistics-wise, it was walking distance from campus and almost directly across the train station he takes home. it also definitely promised an environment you were comfortable in, and you wouldn’t have to worry about excess noise from any other tutoring groups. no, the difficulty really only lied in himself — you two, all alone, would certainly mean his mind would be up to no good for the two hours every monday, wednesday, and thursday you would be together.

but for your sake, he’d try to rein it in, with the operative word being try.

your place is as neat and as pretty as you are; he doesn’t know if you’ve cleaned up for him, or if you’re naturally this organized, but he likes it all the same. it smells of toasted marshmallow and expensive perfume, and all your furniture matches. suguru supposes he likes that in a woman — someone able to care for herself, someone who cares about herself. and you’re always just as neat and pretty to match, with your hair always styled sweetly, your makeup always enhancing your features.

the problem is that now that he’s in here, where you live, and where you spend most of your time, suguru’s mind seems to wander too much towards thoughts about what you do in private. he rejects studying on the couch, not just because it’s bad for posture and concentration but also because he can’t help but imagine you pressed into the cushions by his hand. he suggests the small dining table you have, but on the second meeting at your place, he starts thinking about what you might look like seated on the table, your ass hanging over the edge and his face buried between your thighs. whenever you look up to ask him something, he drinks in your lovely, made-up face again, and starts wondering what your makeup would look like ruined before he interrupts that trainwreck of a thought with the answer to your question.

by the end of the week, suguru’s defenses are all but shot, and he realizes that this situation might be optimal for you, but it definitely isn’t doing him and his now constantly straining cock any great favors.

he supposes that your performance has somewhat improved; you’re less likely to trail off when you’re thinking and can actually do practice sets for a lot longer without all the noise and hubbub around you. your only real hindrance is yourself and your frustration; you have a habit of giving into your carelessness that sends you spiraling into despair, and it doesn’t help that when you press your cheek against the surface of your dining table and whine, the comfort suguru offers is noticeably delayed because he’s too busy thinking about his cock between your lips.

“my dad’s going to kill me if i fail this midterm,” you grumble, stabbing the practice sheet with your pencil; it skids sideways, and suguru robotically fixes it back into proper alignment for you, careful not to brush against the arm that’s folded inwards, supporting your chin. “he only agreed to let me take this degree because of the business aspect of it. as if i’ll need to know about—” you check the header of the worksheet. “domain and range when i’m doing actual design work.”

“you’ll never know what might be useful later on in life. i definitely thought this was nonsense back in high school — and then i got this job.”

“and now you’re rolling in dough?” you smile slightly. suguru chuckles.

“i’m a long way away from having myself a scrooge mcduck golden pool, but i make enough to get by very comfortably, thanks to this.”

“thanks to me, you mean.”

“you’re not my only student,” he snorts, pinching your elbow; you cry out exaggeratedly. “focus up. the hour’s almost over, and you should have finished with this much earlier.”

“can you leave it as homework?”

“not a chance.”

you blow out a sharp puff of air. “my mom used to do this thing where she’d give me rewards if i did well with my homework. i wish i’d still get something out of this.”

“what kind of rewards did she give you?”

“chocolates — candy, or sometimes we’d go out for milk tea together, if i did a particularly good job.”

“this is math tutoring, not a trip to the dentist,” suguru says, amused.

“a trip to the dentist would be more enjoyable,” you mutter under your breath, picking up your pencil and doodling an angry face next to the number you’re only halfway through solving. “this totally blows.”

“try to finish this before the hour’s up, and i’ll see if i can get you something nice. out of my own paycheck,” he stresses, prodding at your cheek to shift your attention back to the paper. he doesn’t miss the fact that your eyes light up, childish as the promise is.

he doesn’t know if that’s really what motivates you, but you do manage to finish the worksheet with a few minutes to spare before the clock hits seven, and that earns you some light, solo applause. it isn’t much by way of true praise, but you flush with pride all the same. suguru packs his things in silence as you get yourself a glass of water, and you see him to the door. only there does he notice your eager eyes, your expectant smile.

“what’s going through that pretty little head of yours?”

“are you really going to give me a reward? i did great today, you know,” you respond bluntly.

“you were serious about that?” he laughs.

“absolutely. i earned it.” you raise a slim finger, wagging it in his face. he trails it with his gaze, no shortage of amusement in his eyes. “next monday, i want something sweet.”

suguru takes in the sight of you, keeping your door open with your hip; he wonders if you know what you’re doing to him, what you’re asking of him — if you even know there’s nothing that could possibly be sweeter than you at this very moment. he drinks in the sight of your feigned haughty expression on your pretty features, the unnervingly low dip of your tank top, the tempting hemline of your shorts, and feels like you must be aware of what he’s going to do next.

“if it’s something sweet you want, you don’t have to wait until next week.”

he does it before he can think it through — surely, there’s nothing too harmful about a quick kiss? he angles your chin upward with his thumb and forefinger before you can even react to his words, and he tastes you like that for the first time. you’re just as soft and as sweet as he’d imagined, if not more so.

when suguru pulls away, you step back; there’s shock written all over your face, your mouth still hanging open slightly. your voice is gentle, shaky when you start speaking.

“senpai, wha—”

“see you next week. rest up over the weekend, or there’ll be consequences.”

he finds it easy to joke with you now, even after what he’s done — finds it easy to wave goodbye with nonchalance as he walks to the elevator, now that he’s gotten one thing out of his system. the look on your face, the growing blush across the bridge of your nose and your temples is indication enough for suguru to feel confident — if you hadn’t thought about him that way before, you were sure to spend the next few days doing exactly that.

it’s exactly a week before your midterm exam, and suguru notices you’re less than focused.

he’d let you stew over the weekend, not expecting much by way of communication; indeed, his phone hadn’t once been jostled by your texts. he’d taken that silence to assume that you’d been wrapped up in thoughts of the kiss he’d left you with, and you did not disappoint on that front; the next monday saw you fidgety, flushed, and constantly faltering in your words. you asked less questions, which normally indicated a problem, but today, he’d let it slide; you definitely had a little too much on that pretty little brain of yours.

he notices you’re still dolled up — your eyelids are shimmery, and your lips are glossy; you’re wearing a tennis skirt that hits all the right buttons for him, too. it’s true that you’re always pretty well-dressed and put together, but today somehow feels different. if before, suguru had always seen you dressed up simply to look good, today it feels a little more like you’re dressed up to look good for him. he knows it’s a little bit egotistical to assume as much, but he also doesn’t miss the side glances you throw at him when you think he’s not looking at you answering your textbook or the way your cheeks glow when you make the slightest bit of eye contact.

still, you try to focus as much as you can; it’s adorable, in fact, to see all your valiant efforts to appear unperturbed. he figures he’ll play along for as long as you will — what matters to him, after all, is that you’re in the game to begin with. you complain less today, focus on your worksheets, and suguru even manages to witness the sight of your forehead creasing up as you concentrate on a particularly difficult item. you’re adorable, in the kind of way that makes him want to pin you down and have his way with you.

you finish your work without a fuss today; you only actually asked for his help twice, which was a feat in and of itself. and again, when the session is over, you walk him to the door.

this time, when you linger, he waits; you’re clearly not good at hiding your true intentions, as it’s become clear you have something you want to say. as you try to piece your thoughts together, suguru reaches into his backpack’s front pocket and extracts today’s gift — an actual chocolate bar, albeit a rather run of the mill one.

“what’s this?” you ask, your thought process clearly derailed as confusion takes over your features.

“your reward. for a good job last week and today — you said you wanted one, didn’t you?”

“but i thought—” you stop yourself, your mouth opening and closing, suddenly wordless. suguru grins.

“not good enough? i picked that up from a convenience store on my way here, so it definitely isn’t anything special, but i thought it would at least be a good motivator.”

you’re turning red, and there’s turmoil in your eyes — he enjoys this, he realizes, the way he flusters you. if he had known this would be the result, he would have made a move much sooner. you shift your weight from one foot to the other, back and forth, obviously weighing out your options too. finally, you say, “alright.”

“you seem disappointed.”

“i’m not.”

“i’ll get you a better brand next time, if you really don’t like it.”

“it’s not that.”

“so what is it?” he doesn’t expect you to say it, and you don’t defy expectations; your bottom lip just quivers, and suguru chuckles low under his breath, stepping forward just past your doorway, just a little bit closer to you. “don’t tell me you wanted something completely different?”

you don’t say so, but he knows; he can tell by the way you tilt your head back, the way your lips part slightly, the gloss still trailing along the seam. he can tell by the way your torso arches just a little bit closer, almost like an accident. he can tell by the way your eyes bore into his, almost pleading.

“what you did last week…” you start, but your voice trails off into nothing soon after. he chuckles again.

“ah, that. i might have gotten ahead of myself.”

“was that all?” you press.

“and what would you do, if it wasn’t?”

“well — do you always like to play games?”

“i have a penchant for playing with my food before i eat it, if that answers your question.” he smiles down at your still-reddening face. “i was giving you a reward, as you wanted. i came up short on options then and there. you’ll let it slide this once, won’t you?”

“you did that just because i did well last week?”

“of course.”

“well, i did well today, too.”

“you did, and that’s why you have this.” he gestures to the chocolate bar in your hand.

“i don’t want this.” your voice is stubborn now, heated and frustrated, and you stuff the chocolate back into his hand. you must not like having to ask for something so blatantly — it’s too bad suguru wants to hear it in those exact words.

“tell me what you really want, then.”

you’re still unable to find the words, but your hands do the talking for you; they press into his shoulders and give you leverage to tiptoe until you’re just close enough to his lips. but you don’t close that gap, your mouth quivering only inches away from his, and oh, suguru wants to toy with you, but you’re just too irresistible this close to him. his warm palms press against your jaw, keeping your face steady as he closes the gap, and this time, he doesn’t just get a brief taste of you — suguru claims your lips with the thirst of a man who’s stumbled upon an oasis in the desert.

you must have thought about this moment long and hard over the weekend, because the nonchalant side of you that’s turned a blind eye to him is completely gone; he drinks in your soft noises and short, breathless gasps — all signs of your eagerness — until he’s drunk on the taste of you. the deeper the kiss gets, the less you can keep up, but you try, and suguru always likes rewarding your efforts, his wide tongue taut and flush against your tiny one in the sweet, warm cavern of your mouth. he licks every inch of it, leaves the mild nicotine taste of himself there, before he pulls away slowly. your eyes are still closed when he creates distance, fluttering open in a happy haze a few seconds later.

“good enough for you?” he murmurs, tucking a soft lock of hair behind your ear. you hum in assent through your dazed smile, and suguru knows he won’t be the only one looking forward to this coming wednesday.

you’d done really well today.

suguru’s proud of you — prouder than he’s been of most of his students in his career here at the university, actually. you’d finally answered a worksheet almost perfectly, save for a couple of numbers where you’d forgotten to round up, and those things are absolutely negligible at this point (by his books, anyway). you’ve been on your best behavior yet, avoiding all forms of complaint, and he knows fully well why, but he won’t criticize you for your hard work all the same, no matter the motivation behind it.

in fact, you’ve done so good that he doesn’t wait until he’s about to leave to give you your sweet reward — which is why, twenty minutes before he’s meant to go, he’s got you on your couch, your legs spread, each one hooked over his shoulders.

truth be told, you’d been good way before the lesson had started; you’d answered the door in a crop top and the tiniest pair of shorts you’ve dared to wear yet — all clothes that you couldn’t yet wear outside yet, given the weather. selfishly, suguru is thankful for this fact, and if he had to list down other things he’s thankful for, just off the top of his head, it’s that you no longer meet in the tutoring center and that your apartment’s walls seem thick and well-reinforced.

“senpai, don’t tease me.” your silly little whining voice makes its first appearance of the day, but all suguru does is smile — it’s an almost wicked expression, set firmly between your thighs. “you said i did really well today. don’t tell me you’re backing out on rewarding me?”

“not at all, sweetheart,” he hums, pressing a small kiss to your inner thigh. he likes seeing you shiver at the contact, likes the way you’re chewing on your lip in what appears to be slight agitation. “just thinking of how much of a reward you deserve.”

in all honesty, suguru would like to take every bit of you now; you’re already so ready for him, anyway. he can smell the faint perfume of your arousal, can see the way you’re anticipating the most from him, and a part of him doesn’t want to deny you of that. the larger part of him has dreamed of burying his cock into you, anyway, and why wouldn’t he do that? but something also tells him to wait — or, rather, to make you wait, to make you want him just a little more.

and so, he decides.

his mouth finds your skin again, pressing kisses up your thigh; they get wetter, hotter as his mouth moves up, until his nose and lips are buried against your clothed core. you squirm in response, but his grip on your thighs keeps you relatively steady, even as his tongue presses against thin fabric. the wet muscle pushes sharp against your tiny entrance, the tip meeting slight resistance against your shorts and panties, but he finds a way, burying half his tongue in alongside damp cloth.

you’re already wet like this, and so needy that it might be possible for suguru to get you off just like this, still clothed, but the hunger in him spikes once you call out to him.

“senpai, please…”

with a groan, his fingers yank the fabric aside, exposing your pussy to the warmth of his breathing. it’s as pink, as pretty, as tiny as the rest of you, as fuckable as he’d imagined it would be, and he wastes no time in pressing his tongue flat against your folds, dragging it up in a wide, messy stripe; the muscle only tenses when it bumps against your clit, his tongue flicking upwards to tease it.

you’re so reactive, even at the slightest things — you whimper, you squeeze your eyes shut, you squirm. you’re begging to be fucked, and suguru’s cock is strained tight against his jeans, but your taste is so addicting that he can’t help but dive back in. his tongue eases between your folds now, spreading them apart until they’re lewd and sticky with his saliva, and the nub of your clit has grown so pronounced now — so pert and lovely that he can’t help but purse his lips around it and suck with excess force.

“senpai — f—fuck,” you mewl; you almost sound tearful. “f—feels so good…”

suguru wants to tell you how fucking good you taste, how beautiful the sounds you’re making are, but his mouth is too busy; his teeth rake down your cunt lightly, earning him a jerk of your hips, and he has to place pressure down on your thighs again to make sure you’re still enough for him to slip his tongue into your cunt.

he can tell even just by that how tight you’d be around him; your walls are warm around his tongue, and there’s a pressure against the muscle that tells him how good it’d feel for his cock to take its place. as if to simulate his desires, he presses his tongue deeper in, fucks you shallowly with its wetness until your whimpers become little sobs, broken and choked back. his thumb drags across your slit then settles against your clit, and he can feel the thrum of your pulse against the pad of his finger, beckoning him. he complies, easily, thumb tracing circles around the nub that start off slow, only for him to ramp up the pace alongside his tongue.

you’re easily at fault for that; the way you whine for him, call him senpai, tell him how good it feels over and over — why wouldn’t he want more of you?

he’s not sure which of you really earns the sweet reward today; you cum on his tongue, your cunt trembling against his mouth and your fingers threaded into his hair, but he’s the one who comes out licking his lips like he’s had the best treat of his damn life.

come the middle of next week, suguru finds himself face to face with a test paper — one already clearly marked, with a number circled on the top-right corner. ninety. a stellar grade for anyone, and especially for you. 

you know it, and you look absolutely triumphant; you’re practically shining as you perch on your little dining table, your perfectly manicured finger jabbing at the score in emphasis. 

“flying colors, wouldn’t you say?” 

“color me impressed,” suguru replies smoothly, a genuine smile of pride tugging at his lips; he turns the page over, scanning your responses. you still draw your parabolas a little on the small side, making them a bit difficult to discern, and you’ve still got the habit of not rounding your answers up, but this is tremendous work, and he’ll be the first to praise you for it. “your dad must be filled to the brim with joy now, right?”

“i haven’t told him yet. you were the first.”

“well, i’m proud of you, sweetheart.” 

“proud enough to give me a reward?” 

he looks down at you in feigned thoughtfulness. here you sit, back in your little tennis skirt, looking up at him with hopeful eyes under those long, curled lashes. for someone who spent the first half of this semester acting ostensibly nonchalant, you’d very easily shown your true colors soon after — not that he really minds. in fact, he’s taken a decided kind of liking to how eager and willing you’ve come to be. 

“we’ve only just started our session, though,” he hums out, an idle thumb grazing his chin as he watches your expression turn from bright to cloudy, the beginnings of strategy darkening your gaze. it’s not like he wants to say no; he has no real intention to. but seeing you squirm in want makes him feel good about his decision to hold out a little longer — never mind the ache in his cock even then. “don’t we usually leave the rewards for a later time?” 

“i was thinking — since it’s the start of a new lesson —” 

“we wouldn’t want you falling behind from the start, would we?”

“i promise i won’t,” you pout. “i promise i’ll put in my best effort next time.” 

“next time? sweetheart, don’t tell me you’re thinking to get off scot-free today…” suguru trails off, his hand falling to the nearest surface it can reach — which, logic seems to dictate, is your soft, milky thigh. he feels you tense under his palm, and he bites back a smile, keeping his expression level. “i just don’t know.”

your small hands grip at the front of his shirt, and he hears you, for the first time, doing something he’s always wanted to hear you do. 

“please, senpai?”

how could he say no to you? he hadn’t really planned on it, had only wanted to see you do this, but it’s still too much and beyond his expectation — your misty gaze, your quivering lip. it’s almost laughable that you don’t think he’d notice the way you shift yourself so that his hand, still warm against your thigh, slides up your skin, the hem of your skirt bunched up in the junction between his thumb and forefinger.

suguru chuckles — isn’t this exactly where and how he’s always wanted you? “how could you ask me like that and expect me to refuse, angel? in that case, i have no real choice but to dedicate all our time today to your reward.” 

your breathing hitches — in anticipation, in desire, in excitement — as his hand continues its trail upward, deliberately now, fingers hooking into the waistband of your panties. his head dips down, rests into the crook of your neck, and he inhales the thick, sweet scent of your perfume, your shampoo, of you and all that he’ll take from you. 

“just remember, you asked for this,” he murmurs against your skin. “so i’m going to take every bit of you until there’s nothing left for anyone else.” 

you’re so willing, so ready even before he can get his full bearings; your hips are rising slightly off the table, and suguru feels like it’s you that’s telling him to move faster. he tugs down your panties, letting gravity take its course until they’re a tiny puddle of fabric on the floor, and he slots himself between your legs. like this, you have no choice but to spread, and you do so without hesitation, your knees locking against his sides as he pulls you in for a tight, hungry kiss. there’s that taste of you he loves, that clean, sweet buzz that draws him in, and his hands are bruisingly tight on your waist as he reclaims your lips. 

you already look dazed when he pulls away, which is always cute, but a little unfair — suguru wants you to be aware still when he takes you, and damn, if he doesn’t want to take you right fucking now. he kisses you again, harder and more demanding, as if willing your attention back to him, while his hands explore you — run up your thighs, fingers brushing against the plush curve of your ass. it’s not enough, not by a long shot, and he’s pushing the waistline of your skirt up your stomach with his hands, letting his warmth transfer onto your skin; he chuckles as your stomach sucks inward at his touch, just as you let out a gasp against his lips.

and he wants desperately to hear that noise again; in fact, he wants to know what you sound like in every capacity. his mouth works down your neck, pleased to find that suckling wet and languid on a spot just above your collarbone has you writhing and whimpering. are you sensitive or touch-starved? whatever the reason, he wants to draw all of that out of you, his hands drawing back down to hook under your thighs. suguru drags you to the edge of the table, until your bare cunt is flush against the front of his jeans, and he lets you feel him — a brief tease of what’s to come. 

“i’m s—so wet already,” you whisper, as if he doesn’t know — as if you know it’s exactly what he wants to hear anyway. “senpai, please, i need you.”

“not that,” he murmurs, his teeth grazing your collarbone as he speaks. “not senpai. suguru. call me suguru, angel.”

“s—suguru,” you exhale shakily, and it’s music to his ears — as if the last thing holding him back from you had shattered. 

“that’s it — what a good girl,” he purrs, his hips rocking forward against your pussy before they retract, leaving just enough space for his hand to slip between. slender fingers trail down your folds, sticky and slick. “you are all wet for me, aren’t you? ready to take me deep inside?” 

even the way you nod, a tiny movement of assent, drives him wild, yet a part of him still wants to test the limit of your patience, his middle finger stretching to circle your entrance. 

“wouldn’t want to shock your tiny little pussy, though, would i? will you let me stretch you out first, kitten?”

“yes,” you mewl, sounding almost tearful. “anything— anything, please.”

suguru drinks in the long, drawn-out keen you set free when his digit sinks into you; he’s already felt your walls against his tongue, but a small part of him is still surprised at just how tight you are. that same part nags that he might not fit easily into you, but whatever that voice is is easily drowned out by a more assertive promise — he’ll make it fit. 

“can’t tell you how much i’ve wanted to feel your pretty little hole around my cock,” he presses on, his finger pushing deeper in; he feels you tense a delicious kind of tightness, as if it’s almost too much for you. is it? “ever since that first day you came into the tutoring center, dressed up all cute — did you do that on purpose, sweetheart?”

“yes,” you admit, breathless; the syllable is lengthened into a weak moan as suguru pumps his finger into you, slow, deep strokes that tease your tacky walls open. “wanted — wanted to make a good impression…”

“and you did, didn’t you? kept looking so sweet for me, so pretty every single time — got me thinking about all the ways i wanted to have you. got me so fucking hard every time we’d meet — is that what you wanted?”

suguru doesn’t give you much room to respond, but he can make his own answers to appease himself anyway; he reclaims your lips, already eager for another taste of you, and you comply with the same amount of desire, your soft whimpers melting against his teeth. in the space of pseudo silence, wet, messy noises, he manages to tease another digit into you, and you cry out against his lips as it pushes in, joining the first in how deep it reaches. he absorbs that too, takes in every minute sound you make, relishes the way you pulse around his fingers. even without the noises, he can tell your pleasure’s heightening, with the way you clench around him, your hips rocking pitifully as you’re eager to rut against his palm. 

“look at you now.” he’s selfish, but he doesn’t care — he wants to ruin you, and if the telltale squelch of your cunt as he fucks his fingers into it isn’t indication enough, then the way your mouth hangs open as he pulls away, letting his name fall freely from your lips, definitely is. “legs spread, all desperate to feel good for me. what a needy little kitten you are. this good enough for you, angel?”

you shake your head, only to squeal as he pulls you closer, his fingers shoving deeper into you; your hips are re-angled, allowing him to brush the pads of his digits against the rough, sweet spot, and he feels triumph bloom in his chest as you throw your head back, teary eyes squeezed shut.

“no, no, no,” you babble, and he can see the bob of your throat as you swallow hard, clutching at sense to make words. “want — need your cock, want to cum on your cock so badly, suguru — want you to fuck me, stretch me open, please —”

��greedy, aren’t you?” he murmurs, leaning in to nip at the spot he’d left reddened above your collarbone. “go on then — show me how much you want it. show me what a good girl you are, and cum on my fingers.” 

“but—” 

“come on, angel,” he urges above the squelching noises, increasing surely in volume. his fingers meet resistance when they spread apart inside you, but all it does is create a delicious friction that has you squirming in his hold. “don’t hold back. let me see you fall apart.” 

and you do, so prettily, your eyes rolling back and your voice unrestrained. suguru’s fingers ride you through your orgasm, pumping deep and steady despite how slick you’ve gotten, your juices coating his hand and wrist. he watches the flush rise to your neck, stopping at your cheeks, watches the heaving of your chest, the shine of your skin from a thin sheen of sweat, and he doesn’t want to let you come down from this high, but his cock is aching — practically bursting from his jeans — and all he can do is make the silent vow that the next time you look like this, he’ll be balls deep in you. 

“that’s my girl,” he coos gently, watching the tension slip from your shoulders; his free hand is at the small of your back quickly, easing you down as your torso falls back, and you’re laying on the table. “pretty little thing, aren’t you? cumming so sweetly for me.” 

“suguru,” you groan out weakly, your tiny hand clasping around his wrist. “cock — i want your cock, please—” 

“can’t wait?” he’s indecent for sounding amused, but even that does nothing to stay his arousal; how eager you are simply makes him want you all the more. “okay, angel — since you asked so nicely.” 

a slight twinge of disappointment runs through him as he pulls his fingers out, but it’s quickly buried by the feeling he gets once he gives you a clear sweep of a once-over; how slutty you look, still half-dressed but already half-ruined, your thighs shaking in an effort to keep them open for him, the remnants of your last climax still leaking out of your hole. the sight of you has him so distracted that unbuttoning and unzipping his pants feels like a fever dream of an act; he barely notices what he’s doing until he’s already bare in front of you, and alertness has crawled halfway back into your consciousness as you push yourself up on your elbows to look at him.

“it’s so—” you have the decency to blush, though there’s a pleased look on your face that tells him you’re not really embarrassed. “i didn’t think you’d be this big.” 

“does that worry you?”

“i’ve never had anyone… this big.” pride blooms in his chest — good, he thinks, because if he can’t be as memorable as your first, then he’ll take being the most in something as a prize. “i don’t think — will it fit?”

“does it matter?” he chuckles, and your blush deepens. “no matter what — you’ll take all of me in, won’t you?”

you chew on your bottom lip, as if considering your options, but to suguru, there’s really only one choice — the correct one, and you make it when you nod your head. 

“it’ll feel good, though, you know,” he muses. his hand wrapped around his base, he lines himself up with you, the tip grazing against your folds. “even better than just now.”

with just a little more pressure, he has his shaft flush against you; his girth sits against your slit, the tip pressed against your clit, and he starts to rock his hips — into his fist, against your cunt. your hips quiver, and a shiver runs through you as your pleasure spikes again, but he can tell it isn’t enough. your bottom lip is back between your teeth, and your eyes are flitting between his face and his cock. suguru reaches out, eases your lip out from between your teeth, strokes it gently, almost tenderly. 

“say it,” he commands in a soft, silky voice. 

“fuck me, suguru,” you breathe out, barely missing a beat. “fuck me, fuck my pussy, please.”

and if you ask that desperately, he’ll waste no time; he draws his hips back, dragging his cock down until he’s aligned with your entrance. his eyes are trained on your face, even when he pushes in, so that he can take in your expression — the widening of your eyes as his tip breaches the first wave of resistance, the way your mouth falls agape as his fingers dig hard into your flesh. he’s never seen a prettier sight in his life.

“stretched you out already, but you’re still so fucking tight,” his voice is a soft, melodious croon, a stark contrast to the way he’s forcing past your tightness. “tight and wet, like a good girl.” 

“so big,” you whimper, your fingers stretched far enough to tickle the front of his shirt. “can’t — can’t take it.” 

“of course you can, angel.” suguru doesn’t give you the time to brace yourself fully before he’s rocking his hips in a little more sharply, his cock now halfway into you. your fingers curl into a little fist, immediately flying back to block the noise from your mouth. “ah ah. don’t get shy on me now; you’ve been so noisy for me all this time.”

but he doesn’t really mind the way you clap your palm over your mouth to muffle your high-pitched squeal as he thrusts in fully, the adjustment period after the last movement close to nothing; he’s too busy focusing on how good you feel around him, how warm and wet your insides are. this is heaven, easily, and suguru wants to stay here for as long as he can. 

“god, you’re fucking tight,” he repeats, an appreciatory gaze running over where you’re joined. his thumb stretches over your folds, rubbing them — something of an apology, perhaps, although all it does is stimulate you more, and you shiver at the extra contact. “how deep is it, baby?”

“can feel you here,” you mumble out, your small hand pressing just above your pelvis. he feels the tightness multiply as you place pressure, even just for a moment. “your cock’s so much deeper than anyone else.” 

your hand falls away, limp, as he draws his hips back; you inhale, long and deep, before letting it out as a broken moan when he pushes back in. it drives him crazy, to start off this slow, when all he wants is to find a pace that has you sobbing, but the resistance of your pussy against his length isn’t easy to ignore. suguru works you open, his jaw set and his grip tight against your frame, and it isn’t long before he’s picking up speed, the slap of his flesh against yours fueling him exponentially, mingling with your cries, steadily increasing in volume. 

“that’s it. let everyone hear you,” he eggs on, his thumb now circling tight around your clit; your legs are quivering, threatening to close, but he keeps you steady, one arm wrapped around your thigh. his thrusts grow rougher, more deliberate, and when he looks up from where you’re joined back to your face, he sees your expression as a mixture of incredulity and ecstasy. a thin line of drool hangs from the corner of your mouth, your pretty pink lip gloss smeared, and fuck if he doesn’t want to make sure you look like this every single time he comes over. “let them know who’s fucking you good, angel.”

“su— suguru!” your voice hitches, lilts up as he presses in at a different, deeper angle, and he almost cums right then and there from the way your walls pulse around him. “your cock feels so good, fucking me just right— more, god, more—” 

he complies without hesitation, gathering both your thighs and pushing them closer to your chest; you look even lewder like this, folded in half with your sopping cunt presented to him like it’s all his to take, and it is, isn’t it? there’s an increase in the intensity, the vigor in which he pumps his cock into you, and he knows he’s brushing repeatedly against your spot by the way you’re blubbering his name out in a way that suggests you sincerely think no one else in this building can hear you. 

“that’s my girl,” he hums approvingly, though there’s a thickness in his voice that has him sounding a little more strained. “such a good girl, with your cunt all nice and sloppy for me. do you like it when i go this deep? does it feel good when i fuck you where no one else can?” 

“yes!” you sob out, your hands crumpling the end of your skirt up into tight fists. “suguru, i— cum, i need to cum again, please—”

“i’ve got you, kitten,” his tone is reassuring, a stark contrast to the rigor of his hips. “don’t have to hang on for me, you know; always love seeing you fall apart.” 

“m’close, so close, closecloseclose—” 

“let go, then,” he urges, his blunt nails digging into your flesh. “let me feel that sweet cunt cum on my cock.” 

you comply without hesitation, though if you’d done it willingly, he can’t really tell; he has to pin your hips down to stop you from bucking up and causing him to slip out, and you writhe against him as you sob in ecstasy, your walls fluttering before they clench. stray tears leak from your eyes, squeezed shut, and suguru wants nothing more than to eat you up like this — broken, fucked out. 

you’re not even fully down from your high when he feels it — that sudden wrenching in his gut that tells him he’s about to follow suit. with a low groan, he peels your thighs apart again, lets you watch him as he bullies straight into your leaking hole. your voice is a staccato, punctuating every deep, sharp thrust into you, and it’s exactly to that melody that he wants to get off. 

“tell me where you want it, angel.” he doesn’t trust his voice, sharp and short as it is now. “should i mark your pretty face? your stomach?”

“want it against my pussy,” you whisper out, and suguru almost loses his mind as he watches you spread your folds apart with your forefinger and middle finger, inviting him. “make a mess of it, senpai.”

he’s barely able to pull out before he’s spilling against you; he ruts against your slit, coating your folds and the insides of your thighs in thick, creamy white. you hold your legs apart for as long as you can until they start to tremble, and he catches them and gently eases them down. 

when you sit up to kiss him, you’re still demanding; he feels your hips rock closer, your sticky cunt pressing against the underside of his cock.

“not enough,” you murmur against his lips, and suguru chuckles as you bind your hands around his neck. 

“don’t worry, kitten,” he hums back. “we’ve got all afternoon.”

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

[thydungeongal]

So what would speedrun strategies for tabletop RPGs look like?

In the realm of videogame speedruns a lot of strategies rely on the code producing results that were unintended. Now, anyone who's been on the various character optimization corners of the internet knows that RPGs do have this in spades: RPGs are one of those weird mediums where rules texts are often extremely technical manuals, a lot of authors like to write in a very "natural" sounding register that often results in ambiguity. Reading the resulting ambiguity in such a way that the author very much did not intend but that is technically a possible reading of the text is one way in which I could see speedrun tactics being applied in tabletop RPGs.

Sometimes speedruns don't rely on knowing how to exploit the mechanics in unintended ways but simply on developing a mastery of the mechanics and understanding how to best utilize them. This is also a skill that can be developed via engaging in character optimization and close reading of various systems.

Let me give a few examples:

Picking pockets to reset aggro: Works in B/X D&D (Moldvay & Cook), might be possible in other older editions of D&D. If a Thief rolls more than twice their percent chance of picking a creature's pocket they are caught in the act and the DM is instructed to determine its attitude, for an example by making a reaction check. Should this method actually be used there is always a chance that a character getting caught picking a creature's pocket could result in that creature suddenly having a positive reaction.

Due to this unintended but valid consequence of the rules text, a group of Thieves could simply attempt to reset the attitude of anyone that becomes hostile to them, making it easy to do a Pacifist run.

Use your words: This is from D&D 3.5. You may have heard that the Diplomacy skill in D&D 3.5 is quite busted. It is extremely easy to get a bunch of +2 bonuses from here and there to the point where at a relatively low level it becomes effortless for a character to hit the DCs required to turn a Hostile creature Indifferent (25) or Friendly (35).

Utilizing one of the builds that allow for very large Diplomacy bonuses, it becomes nearly effortless for characters to resolve modules meant to be handled through violence diplomatically. Red Hand of Doom starts the characters off at level 6, which is already enough to gather so many of those tiny bonuses that the skill starts to break. Meaning that simply walking into the camp of the campaign's big bad and going "Why can't we be friends" is within the characters' grasp.

[superhero--imagines]

Being Sanji’s GF would include:

A/N: this is the ugliest banner I ever made I swear.

Tags: Female reader

* A man that is 6 ft +, can cook, and treats you with respect? I can’t believe we as a society weren’t simping for him before

* We already know that he loves pretty girls, so if you reciprocate his advances—he’s down hook, line, and sinker

* I feel like he’d fall hard and fast for someone a bit shy, with a soft form of kindness

* Sanji himself is so kind, even if it’s in these extremes depending on the gender of the recipient

* So seeing someone who kindness comes to so naturally, where it isn’t a flickering flame or a bright fire, but just a soft warmth that linger in all of their actions leaves him in awe

* “You’re amazing.”

* He’s still got a wandering eye though, so catch him randomly slapping himself or sitting with his face in his hands as he tries to restrain himself from ‘being unfaithful’

* “Hey Sanji?”

* “Hmmm.”

* “Have you ever thought about cheating on me?”

* The dishes he was washing clatters in the sink and he grabs your hand in both of his, kneeling in front of you

* “Never!” And he means it, he might look but he would never dream of being with someone other than you. “You’re the only person I want to be with.”

* I think as time goes on he gets a lot better at understanding why he feels the way he does, and eventually the flirtatious behavior cools down even though he’s still as kind as always because he realizes it comes from a place of craving validation instead of genuine love

* And honestly, now that he has you he doesn’t need it from anyone else anymore

* “(Y/N)-chan, can you get me the oregano?”

* You smile as you get it from the fridge, it’s not easy for him to ask you to do things

* He has the biggest goofiest grin on his face when you wrap your arms around his waist and rest your head on his shoulder

* Sanji would literally give you a romance as big as the world — or he’d try to at least

* “Sanji this is really lovely.” And you mean it, the candle lit dinner and all your favorite foods at the center of the deck

* “But um, I feel a little bad for Luffy.” It’s more than a little, there’s an entire waterfall of drool falling past his lips from his spot behind a pillar.

* His fingers curl under your chin, urging you to meet his gaze

* “There’s nothing to feel bad about, of course I would spoil the most important person in my life.”

* Your cheeks heat up from the words.

* “But Sanji—“ you look to the pillar seeing seven faces quickly duck, and a hand grab luffys still salivating head. “—they’re all staring!”

* If you could die from embarrassment you’d be six feet under

* “Let them stare, it’s because they’re dazzled by your beauty.”

* “Actually it’s because we’re hungry!” Luffy shouts, only to have his mouth covered by Nami.

* Sanji ends up making them a snack.

* His favorite hobby is pretending Chopper is your child when you guys go out

* “When are you guys going to stop pretending he’s your baby?” Zoro growls

* You look over at Chopper who’s happily sitting on Sanji’s shoulders, munching away on cotton candy

* “When he stops pretending to enjoy it,” You respond

* “That’s never going to happen!” Chopper shouts with a giggle

* He’s so greedy with you I swear

* You give him a kiss, he gives you back at least five

* You hold his hand, he keeps you glued to his side for the rest of the night

* “I know it’s ugly of me to get an inch and take a mile, but…around you I just can’t keep myself from trying.”

* He learns how to make all your favorite childhood foods, either from a relative or by studying old recipe books from your homeland

* And if you ever seem homesick or you’re feeling down he’ll suspense you with the dish

* “How did you learn to make this?” Your region is a far ways away from his usual French cuisine

* “I have my secrets.”

* Please cook for this man, just once, make a fancy dinner and have the whole crew pitch in as wait staff

* “You’re always taking care of us so this time we wanted to serve you!”

* He’ll eat half-burned pasta with tears of joy streaming down his face

* “This is the best meal I’ve ever had.”

* He’ll fall even harder for you if you have his wanted poster near your bunk bed

* “There’s a little red stain near my lips though—“

* “Ah, sometimes when I can’t see you at night I give it a little kiss for luck haha.”

* He’s dead. Sanjis dead.

* Cause of death: love sickness

* He died happy though

* He’s just such a simp for you man

* Like, take the shirt off his back and lay it over a puddle so you don’t get your feet wet, hear you’re craving a certain type of food and make it the next meal, buys you feminine hygiene products from the store with pride (along with some snacks he knows you like, kiss your hands and worship the ground you walk on type of love.

* Honestly what a dream

A/N: kinda wanna make a nsfw version too.

[bad-and-drawn-that-way]

vox more than anything fic ending with fluffy makeup sex is all i need :,))) LET ME HOLD THAT TV MAN!!!

I didn't end up adding the spice because it didn't flow naturally with how this came out. I do headcanon that Vox would 100% try to initiate spicy times during a makeup because he wouldn't know how to handle the emotional vulnerability in any other way. Homeboy hasn't exactly had any healthy fight aftermaths. Hope yall are ready for the fluffy pain <3

Tag List: @luzzbuzz

More Than Anything Part 3 [Vox x Reader]

Part 1

Part 2

Part 2.5 (Vox POV)

Things at the Vee's Tower seemed relatively normal when you stepped into the lobby. It felt a little weird if anything. When Vox was upset, it could shut down the entire tower for days on end if it was something more serious. You didn't hear the hum of the overbearing generators that would keep things running during his fits and your worry only grew as you stepped into the elevator. You swallowed down your anxiety as you scanned your badge that would let you onto the elite floor where the penthouses of the Vee's were at the top.

Did something happen to Vox? Was he not here for some reason? Where would he go? Did he... just not care?

Anxiety swirled in your mind as the elevator doors slid open. You saw Velvette on the couch scrolling through her phone and the young overlord perked up when she saw you.

"Bout fucking time," she groaned as she pocketed her phone and got off the couch. "Do you have any idea what a pain in the ass it's been to babysit the man-child?" Velvette poked at your chest and you couldn't help but notice the dark circles under her eyes as she frowned at you. "You owe me for this."

Ninety percent of hell didn't see past Velvette's tough-as-nails exterior and if it hadn't been for the time you'd spent with the Vee's due to your relationship with Vox, you doubt you would have ever seen through the cracks in her demeanor either. For all her bark and bite, you could tell she cared for Vox and Valentino deeply. She wouldn't look so damn exhausted right now if she didn't.

"I'll make it up to you," you sigh in relief as you drop your bag to the side. "Where is he?"

To say you were less than pleased when you saw the door held shut by the smokey chains of Valentino's magic was an understatement. You were pissed. While you still felt a semblance of gratitude for the other Vee's keeping Vox from doing anything rash, you were going to tear them both a new one for keeping him caged like a fucking animal.

Velvette lifted her hands and got the cue to leave as you triggered your demon form and slashed Valentino's magic to wispy shreds. You yanked open the door and your eyes searched the room for Vox maniacally. There we no cameras and the windows had been covered with some sort of blockers. It looked like the Vee's had the sense to leave him with some comfort items and non-tech-involved things to pass the time, but the only technology you saw was some ancient Nokia-looking phone lying by his foot that he wouldn't be able to use to teleport out of the room.

"Vox?" You breathed as you saw him curled up in a corner with his screen buried against his knees.

His head whipped up and he breathed your name, only to curse as his body glitched hard from the prolonged stress.

"Y̶o̸u̴ ̸c̶a̷m̴e̸ ̸b̶a̸c̸k̴?̷," he asks, and your heart aches as you watch him flinch at the static in his voice.

"Oh hun, come here," you sigh as you get down on your knees and pull his screen towards you. You didn't know much about tech, but his personal repair sinner had shown you some of the basics to take care of Vox if anything ever got out of hand.

You reached around the back of his head and did a hard reset for him, holding him close to you as he went limp against your chest. When Vox powered back up, he flinched hard and pushed himself away from you, backing up with wide eyes and frantic breathing before he processed it was you who had been holding him and not Valentino.

"Woah! Easy," you gasp, not expecting the sudden movement. You look over him and instantly regret leaving him for as long as you had. "What... What happened?"

Vox's heart was pounding rapidly in his chest as flashes of Valentino's manipulative words flitted through his mind. The promises of affection if he crawled back. The venom in his voice as he told Vox you'd never love him again. The back and forth between gentle lies and cold hard truths. The one time he almost, almost caved into Valentino's whims.

With a shaky breath, Vox stomped down on as much of his weakness as he could and turned away from you. "It's not important."

"Like hell, it's not," you frowned as you reached toward him, only to pause as he flinched at the tone in your voice.

It was obvious there was a whole new can of worms to handle and most likely a moth to strangle. But you steady yourself and take a deep breath, deciding to take things one step at a time.

"I'm sorry for leaving," you start slowly as you sit properly on the floor with Vox. "I was scared and angry and processing everything. I needed space. But I should have at least texted you back or checked in. I didn't..." your voice wavers. "I didn't think that..."

"It's fine," Vox sighed. "I get it. What I don't get is why you're here. Why did you come back?"

"I was always going to come back," you say as you reach towards him slowly. Your heart ached to know he had genuinely started to believe you'd just abandon him, but given the pieces of the unsettling image of what happened while you were gone, you understood where it was coming from.

Vox looks at you and hesitates before he leans into your touch and lets you cup the side of his face. "I was angry and hurt and scared," you admit. "I needed time to process my feelings. I didn't want to say something I'd regret."

You shake your head and chuckle, "I'd say I should have known better, but this is our first big fight now that I think about it. It's uncharted territory for us both."

Vox was silent as he slowly reached up and took your hand. He let out a shaky breath as he looked down. "I've... any connection I've had with someone. It's never... survived this sort of thing. Once shit hits the fan, that tends to be the end of it. I thought... I thought you were gone for good."

"I won't let you think that ever again," you say as you cup the other side of his face with your free hand. You make him look at you, but you're gentle. "We'll talk about this. I'm in this for the long run, you dorky TV man."

"But I tricked you," Vox shook. His face flickered between heartbreak and frustration. "I stole your soul. You have no reason to fucking t̵͍͌r̸̰̈u̵͉̍s̸̯͛ẗ̶̫ me."

"I love you," you say without hesitation. Vox's eyebrows furrow and he opens his mouth to retort, but you shake your head and stop him. "You did a bad thing. You did break my trust. But I know why you did it. Loving you doesn't mean I'll forgive you every time you cross a major boundary, but it does mean that I will do whatever it takes to worth through the bullshit together," you say softly.

Your thumb swipes over Vox's screen as you feel him tremble in your hold. "You're worth that effort to me, Vox."

"Why?" Vox asked as his eyes darted over your face as if the answer to his confusion would be found there. He didn't understand. How could you come back? How could you want to forgive him? How could you be here in front of him, looking like he was the one who hung the stars in the sky rather than the one who drew souls to their doom like a siren song on a screen?

You kiss his forehead and pull him close as he shakes harder in your arms. "W̸̻͝h̴͖̒y̵̞̍?̵̝̕"

His claws dig into the back of your shirt as he hangs onto you like a lifeline. "I̵ ̷d̴o̶n̵'̶t̶.̴.̶.̵," Vox growls in frustration at the emotion that sticks in his throat. "I can't... I don't d̷e̴s̶e̷r̷v̴e̷ this."

"Because loving you has never been about what either of us deserves," you sigh as you kiss his head. "It's because despite everything, I know I could never replace you. So I'm willing to put in the work if you are."

A broken sob ripped itself from Vox's chest unwillingly as he held you tighter. Your heart broke, knowing this very well could be the first time anyone had actually tried to stick around after any of his fuck-ups. You held him close, rubbing his back as he worked through his emotions. You were there for him as he glitched and let out an anguished scream as everything he'd been holding in for so long finally poured out.

You don't know how long it is before he finally calms down. He looks up at you and you know his eyes would be bloodshot from the breakdown if that was how his screen functioned. He let out a deep breath and you smiled softly as he cupped your cheek.

"This isn't the first time I've thought you didn't belong down here," Vox admitted. His voice was hoarse from exhaustion and the pure angst session some cruel fucker decided would be entertaining to put him through. If he ever found that bitch, he'd wrangle her neck.

You laugh as you feel tears prick the corner of your eyes as you finally see the familiar spark in his eyes for the first time since you'd come back. "Nah, you know heaven wouldn't know the first thing about how to put up with my shit."

Vox barked out a tired laugh. "Damn right, they wouldn't. You're a menace."

"Yeah," you giggle as you press a kiss to his cheek. "But I'm your menace."

Vox reached up, his fingers tangling softly in your hair as he brought you in for a proper kiss. "Yeah. You're my menace. And I love you, more than anything."

[terastalungrad]

Sometimes, you’re a comedian with a touring show to promote, so you do an interview with a regional newspaper.

I think that’d be the funniest possible time to reveal a big scoop, wouldn’t it?

Stewart Lee is currently touring, and to promote his Yeovil performance, gave an interview to Blackmore Vale Magazine.  According to Wikipedia, the Blackmore Vale is an area of north Dorset, south Somerset and southwest Wiltshire.  According to the comedian Jake Baker, the magazine would cover his school sports day as he grew up in Dorset.  That’s the level of news you’d expect.

The questions are friendly and easy, from a journalist clearly familiar with Lee’s work and history.

The first question is about the show’s angle.  Lee describes the nature of the show, and here’s an excerpt:

So it looks like stand-up, and sounds like stand-up, but it’s actually a kind of character piece about a desperate person who’s frightened and trying to organise the world in a way that puts them in control. And I guess you could argue that’s what a lot of stand-ups are doing anyway. Ricky Gervais to me looks like a very frightened man. He’s frightened of transgender people coming after him, the act is a defensive wall.

Fun!  This is a Ricky Gervais hate blog, so it’s nice to see a sudden, unexpected attack in an unrelated promotional interview.

Lee mentions Gervais again in response to question four.

Sometimes I become bitter and think ‘I get all this good press, why can’t I get 10 million quid for a TV special like Ricky Gervais?’ But on the other hand, I wouldn’t want that audience, it wouldn’t allow me to be better.

And then again to question eight, where Lee explains why he spends six months running new shows in the relatively small Leicester Square Theatre (as opposed to arena comics who might do 10 warmup shows followed by 60 tour dates).

You can still run it like a club gig, you can interact with people in real time. Also, you wouldn’t get better at the show because you wouldn’t have done it as many times. You can see this with an act like Gervais. Those shows have not been run in, they’re not fluid, they’re a succession of inflexible statements that would snap like twigs if the pressure of an unforeseen event was applied to them.

The journalist finally addresses this head on.  It really is worth reading the entire article - there’s a lot more than I’m quoting, including an interesting story about Sean Lock:

But here are my favourite bits:

[Gervais] still kind of copies me though, which is the weird thing. There’s still a lot of cadences of what I do but they’re used in the service of evil. In Star Wars, he’s Darth Vader and he’s taken the force, which is me, and used it for evil purposes. He was a fanboy, he was actually the booker at University of London and used to book me and Sean Lock all the time. And when he became famous for the Office, he wrote an hour-long act that was so indebted to us it was awkward. [...] If he’d come up through the circuit that would have been rubbed off him because you find your own voice doing club gigs. It took me two years of gigging five nights a week to come through the mesh of things I liked. But he didn’t have that experience in the same way. [...] Funnily enough, in his first show there were bits I’d never recorded that he’d do almost verbatim. He’d clearly remembered them. I went to see him at the Bloomsbury – on his invitation actually – with my then girlfriend and she was very concerned for me. I’d given up at that point due to lack of interest, and she was concerned for what it felt like to see my act being done to hundreds of people, it was quite weird. On the other hand, that sort of did make me think I don’t want it to be consumed into someone else’s vocabulary. And also, I think because he had a residual sense of guilt, he would always credit me in interviews as being an influence – that helped me in 2004 to get the audience back.

This is, to my knowledge, the first time Lee’s ever claimed that Gervais stole his material.  He’s certainly talked about Gervais clearly taking influence from him (though in the past, he downplayed this compared to the account given in this interview).

It’s a pretty big thing to accuse a comic of stealing material.  That’s a big taboo.  I reckon this is partly because Lee wants to discourage fans of Gervais from coming to the show.

Anyway, let’s finish by quoting the end of the interview:

It must be strange to have that level of financial remuneration and those audience figures but not really a single good review. And I expect what that does for you is create a cognitive dissonance where you have to manufacture a worldview by which the whole world is wrong and you’re right. Which can’t necessarily be very good for your mental health, although I expect the money’s nice.

[clockwayswrites]

A Broken Sort or Normal, Epilogue

WC:1383, Masterpost

Danny glances up from his fight to fit the cufflink into the sleeve of his rich blue suit and smiles at what he sees in the mirror.

“You know, it’s supposed to be bad luck to see the bride before the wedding.”

Wally grins, easily, from where he leans against the door frame. “I’m the one in white so I think I’m the bride, in this case.”

“Oh, so putting the bad luck all on me?” Danny asks as he turns to appreciate how his fiancée looks. Wally really is stunning in his white on white tux. Danny hadn’t been able to stomach the idea of traditional black and white tuxes, not with Phantom still being such a raw wound. Wally hadn’t minded in the least going with a brighter color palette.

“Never,” Wally promises. “We’ll face whatever comes together.”

It’s a vow that Danny unquestionably trusts. Since the curse broke, Wally has been there for every step of it— and Danny has needed a lot of help with steps. Danny’s weakened core not only handicapped him as a ghost but as a living. Many days Danny is able to pass through it all relatively unaffected, other than the cold ache that has settled into his bones, but other days are harder. Other days Danny walks with canes braced against his arms. Other days Danny needs his wheelchair. Other days he can hardly get out of bed unless he goes ghost. And through it all Wally has done everything that he can to make things easy for Danny.

They have a house now, one story and carefully renovated so that on the days Danny needs the wheelchair he can still move around easily. There are electric blankets and soft pillows and this ridiculous massive bean bag that’s big enough for them to both sink into on the bad days.

And there are good days too. There are days where the aches are just a background note, days it all doesn't hurt so much, days where he can fly. Oh how Danny had missed flying. Of all the things that came with being a halfa, flying is what Danny had missed most– not because he could help or be a hero, he missed flying just for himself.

The first time he had felt stable enough to fly, Wally had whisked them out to that same field their first date was in and let Danny loose. Danny had flown for hours, darting around, doing tricks, and floating among the clouds. When he had come back down to earth, Wally had been there, picnic waiting and the biggest smile on his face.

So like everything in Danny’s life, it’s all a balance: the good, the bad, the effort… Danny loves it all.

He loves it not just because it reminds him of how much living means, but because of how deeply it shows that Wally cares. Wally’s love is one thing he can never question. It’s a certainty that Danny has needed through all of the aftermath.

Once Danny had been released from the Watchtower’s medical, he had started small dealing with it all. Coworkers were easy to reply to and he could trust that informing a few would spread the news to the rest. They didn’t push for more than he was willing to give, though he had known he would come back to questions and rumors.

Everyone else was harder.

He had set a video call with Sam and Tucker at the same time. It was maybe a little unfair to not give them each their own call, but he just didn’t have the energy for that. They weren’t kids anymore and hadn’t been for a long time.

“God, Danny,” Tucker started at the same time as Sam said his name.

He held up his hand and their mouths shut with a clack. His smile was tinged with sadness, but it was a smile. “Don’t. You two didn’t do anything horrible.”

“Dude,” Tucker said and for a moment Danny was back in high school. Tucker looked good, still in bright colors and with his hair expertly shaved on the sides with a little pattern. “We forgot about you.”

“We left you alone to deal with all that,” Sam said. Her hair was a more natural shade of black now and her smoky eye an expertly done wing. It was odd to see her lips red instead of purple.

“Because of a curse. You forgot because of a curse,” Danny said, “and then you just did what anyone does, you went on to have a future. It’s not like we had some big fight or anything, you both just moved on with your lives.”

“That still had to hurt,” Sam said.

“It did,” Danny said honestly. He didn’t see the point of pretending the past hadn’t happened. “But that doesn’t mean it was either of your faults. The last thing I want is anyone doing anything for me out of guilt, especially since in this case it’s misplaced. It’s okay that you both grew up. I did too.”

It hurt and it would always hurt, at least a little, but Danny didn’t want any false care now.

Sam chewed on her lip and Danny smiled a little at the sight of the old habit. “I’m still sorry.”

“Me too,” Tucker said.

“Thanks, that does mean a lot, but it’s okay, really.”

There was a level of peace from that talk. Sam and Tucker both asked if they could reach out sometimes, and Danny said yes but with zero expectations. They were different people than they were as children and Danny knew, because he had lived it, that without Phantom there wasn’t much for them to talk about. And Danny had no plans to talk about Phantom. That part of him had ended with a wish seven years ago. He didn’t want to rehash or relive it now, even with them.

Jazz… Jasmine was harder. Sam and Tucker losing touch was just part of growing up. His own sister ignoring him though, that wasn’t the same at all. If it wasn’t for his nieces, Danny didn’t know if he would even be trying with Jasmine, even as apologetic as she was. There were some things that were too hard to come back from.

“Are they here?” Danny asks and looks back down at his stubborn sleeve.

Wally steps forward and takes the cufflink from Danny. He’s gentle as he fits it into the slot and secures it. “They are. And all our friends are here too. Just remember that you don’t have to talk to them any more than you want to. It’s okay to be taking things slow. It’s okay to decide that you can’t do this with her. You know I’m with you whatever you decide.”

Danny raises Wally’s hands to brush a kiss across each set of knuckles. “I know. I’m so lucky to have you. Is it bad that part of me making an effort with them is so that my nieces have family other than their moms and our parents?”

“Nope. I think that makes you a really good uncle. I mean, where would I be without Aunt Iris? Family like that can mean a lot and if that’s the only reason you have for dealing with your sister, then that’s enough,” Wally assures him.

It helps Danny relax some.

“Okay, good. We’ll just… see how it goes. I’m not going to focus too much on them today, not when today is about me and you.”

“I think that’s all good. You’re just wrong about one thing though,” Wally says, his grin just a little mischievous. Danny loves that grin.

“And what’s that, Mister West?”

“Well, soon to be Mister West,” Wally says, “it’s that I’m the lucky one. I could have lost you so many times and so many ways and despite everything, today I get to marry you. I don’t think there’s anyone luckier than me today.”

“Well, not to have our first fight,” Danny teases, “but agree to disagree.”

“I think I can live with that.”

Danny laughs. There’s nothing funny about that, but the laughter bubbles up in him all the same, not from humor but from joy. “Living, that sounds like a very, very good plan.”

---

AN: Aaaaaah we are done!! Not everything is perfect, but Danny is alive and living and Wally is going to be with him for all of it <3. Thank you all for coming along for the ride on this! It's been unexpectedly delightful to write these two together and I'm glad to finally wrap it up with (hopefully) a nice bow.

And yes, this will be going up on ao3 but I need the brain functions to go back to the start and give it a good polish! I'll likely do it chapter by chapter weekly to give myself and my darling beta @mokulule time.

Until then or the next thing here, stay delightful, darlings!

[jupiters-galaxy]

I've seen some people criticize how quickly Peter and Steph fell for each other (to the point of being the thing they treasure most), and while I do understand some of the criticism, I think there are a few key things that some people aren't picking up on.

-Treasuring each other IS NOT strictly romantic. While it's true that Peter is in love with Steph, and Steph with Peter, it goes deeper than their repressed love story. They ARE friends. They do genuinely like spending time together, although their connection is relatively new. They care about each other as people first; neither of them seem like they NEED to be in a relationship with the other. They seek each other out even when they're just friends.

-It's also important to remember that the lords in black only want treasured things in the metaphorical sense: they can't give up OBJECTS. It presumably has to be a person or a concept.

-It's important to remember that both of them have been through an unbelieveable ordeal. Peter's closest friends were murdered. Stephanie lost her DAD, and although they weren't close, that can't have been easy to stomach. I cannot stress this enough; Peter and Steph quite literally have no one else left. Peter has no other friends. It logically tracks for him to be attached to Stephanie, as she is someone who experienced the same traumas as him. From Stephanie's angle, she doesn't really like her friends, and since objects are out of the question, Peter is the only person who she feels truly knows her. He's really the only option for her, even if her feelings are confusing.

-I also want to point out that you can really kind of feel them falling for each other, although it is admittedly subtext. Peter is weak to Steph as early as the opening number. He does out of character things to make her happy; a compliment from her makes his day amazing; he faces his biggest fear in hopes of seeing her at Pasqualli's. Stephanie cares for him from the first day they meet, although her care is a lot more ambiguous. She teases him about how he's into her, but at the same time, she's protective of him, feeling horrible that he got beat up and wanting to stop it. Even beyond that, she's inclusive towards him, inviting him to hang out with her simply because she likes his company. Her attraction to him makes sense: we know that Steph has a thing for funny and smart guys, and Peter's geeky snarkiness ABSOLUTELY fits. Their relationship is one that just makes a lot of sense!

-Their relationship is actually portrayed really realistically near the end. They're not intense about their love, nor are they overtly sexual. In NPMD, they don't even kiss! The furthest they go is dancing close together and having conversations, cautiously stepping into a new relationship that they mutually want. Despite the heavy nature of their confessions in As Cool As I Think I Am (Reprise), the payoff is not drastic. The confessions were likely only so heavy because they both thought Peter was about to die. Of course he would go out detailing how he loves her, and of course she would say it back; their last memories together should be good ones. When faced with normalcy, they progress as most teens would.

-At the end of the day, they're two traumatized teenagers who already liked each other before the trauma. It makes sense that they feel like the other is the most important to them; after all, Grace is the only other survivor from their group, and they're thinking about her in a less than favorable way past Richie's death, if not sooner than that.

This is not to say they're perfect, but I think their portrayal was really sweet and a joy to watch. I think the implications are extremely interesting idk!! I love Peter and Steph, I think they're more nuanced than they're getting credit for. I love to see cringefail nerds getting badass and amazing girlfriends, let me have this!!!!!

Anyways yeah that's my hot take. One of many. NPMD is consuming me someone help

[verysium]

『01』 呪術廻戦: jujutsu kaisen recs

五条悟: gojo satoru

i know you still think about the times we had by @saetoru

satoru will always comes when you call him, he just never thought you’d stop calling. notes: satoru is so desperate and pathetic here it is just delicious; has the right amount of angst to cause tension but a good ending to soothe my poor heart; traditional rich boy and disapproving mother/father scenario but implemented relatively well; miscommunication and feelings of inadequacy; reader realizing the extent to which satoru loves them

pretty eyes by @quirklessidiot

in which the right eye is mine and the left eye is yours and when we meet for the first time, you see your own eyes staring back at you. notes: takes tragic star-crossed lovers to a whole new level; riddled with parallels and symbolism; idea of illness and loving someone at their worst; right person, wrong time at its finest; fate being unnecessarily cruel; surprising moments of humor

minazuki by @quirklessidiot

In which Y/N L/N is placed under a union she has no choice but to partake for the sake of her survival. notes: this series needs to be scientifically studied; it is just that good; halfway in and i fell in love with the reader instead of gojo; strong and somewhat morally grey characters; dark themes around femininity in a patriarchal society but concept was executed flawlessly

21: only by @tenjiiku

“What do you want, Satoru?” You do not use his last name or any honorific to address him despite his age. He was older than you by a few years — but certainly did not act the part — so you do not think he deserves your respect. Your host father told you he does — something about his being from a prominent private school as an educator, which you cannot possibly fathom being the truth — but only in front of you is Satoru Gojo an inane, odd man with a need for clean, dry-cleaned clothes that, for some strange reason he has conjectured in his equally baffling mind, that only you can provide. He smiles at you, placing his cheek in his hand. “You.” notes: this fic embodies the duality between gojo and satoru; he is easy-going until he isn’t and you realize he actually has a considerable amount of depth; the plot twist did it for me; satoru being a loud-mouthed tease but secretly harboring feelings

soulswap by @orphxus (impxria)

this is where the evening splits in half, love or death. grab an end, pull hard, & make a wish. notes: short but realistically describes everything wrong with jujutsu society; poetic voice; gojo being serious for once; disillusionment and tragic hero archetype; being the strongest yet being unable to save anybody; geto would read this fic and feel seen

両面宿儺: ryomen sukuna

nocuous by @quirklessidiot

“It’s ironic, isn’t it? I knew how this was going to end but I’m still terribly hurt by it.” notes: the heian era setting is so complex and established even through dialogue and subtle description; reader strikes me as older and able to deal with sukuna’s chaotic nature; sukuna being an absolute menace is sending me; tragic angst but almost didn’t notice it due to how beautifully the images are presented

avīci by @rotpeach

Several years ago, Satoru Gojo was involved in the exorcism of a uniquely stubborn curse. The official report states that one of Ryomen Sukuna's fingers was recovered from the scene, and nothing else. Only the two of you know the truth. notes: gore, gore, and even more gore; boy was this fic a wild ride; imagine a work that condenses the ugliest and most revolting parts of human nature yet presents them so elegantly you start questioning the blurred lines of morality; cannibalism, violence, and love triangles; japanese mythology & folklore; heian period references; cursed spirit reader tries to grapple with the idea of self after being created for the sole purpose of serving others; themes of existentialism, identity crisis, obsession

[kinnbig]

✨ Simple Gif Colouring for Beginners ✨

I wrote up my basic gif colouring process for a friend recently, but a couple of people here mentioned they'd also find it helpful! so, as requested, this is a beginner-friendly walkthrough of the way I colour my gifs :) it's aimed at brand new gif makers with no prior experience with photoshop or photo editing.

when I first started gif making I found colouring and photoshop in general suuuper daunting, so I've tried to simplify everything here as much as possible. hopefully this will be relatively easy to follow and not too intimidating!

a couple of things to begin with:

I'm only talking about colouring here - this is not a full gif making tutorial. I've linked to some of my favourites of those here!

I personally like to make bright, 'clean' looking gifs with vibrant but natural colours, so that is the style of colouring this tutorial is geared towards. most of gif colouring is subjective and about personal taste - the only thing that I'd say is possible to get wrong is skin tones, which I talk about a lot in this guide.

as I mostly gif Thai dramas, most of the advice is geared towards colouring for East Asian/South East Asian skin tones - but the techniques should be fairly universally applicable (and here are some tutorials that talk about gif colouring for other skin tones).

I'm not an expert! I'm not claiming this is the best or the only way to colour gifs - it's just how I do it.

this post is very image-heavy. if the images aren't loading (or the gifs are running slowly or cutting/looping weirdly), then try viewing the post in its own tab (rather than on the your dash or someone's blog) and refreshing the page.

okay, full walkthrough beneath the cut!

contents:

1. intro a. natural gif colouring goals b. very very basic colour theory 2. super simple colouring (the essentials) a. curves b. selective colour (and skin tone correction) c. hue/saturation d. saving and reusing colouring e. another simple colouring example 3. other adjustment layers a. brightness/contrast b. levels c. vibrance d. colour balance e. channel mixer 4. troubleshooting a. curves b. saturation 5. fin!

1. intro

the colouring part of gif making can be super overwhelming, especially if (like me when I first started!) you're completely new to photoshop and/or have no experience with colour theory or photo/video editing.

if you're opening photoshop and making gifs for the first time, I highly recommend getting used to making a few basic, uncoloured gifs to begin with. just to practice, rather than post anywhere (though you can always come back and colour them later if you want) - but it'll make the rest of the process much easier if you're already beginning to get used to working in timeline mode of photoshop. give yourself a bit of time to practice and get a feel for things like how many frames you tend to like in a gif, where you like to crop them for the best loop, what kind of aspect ratio you like etc* - so that you're not trying to navigate all of that for the first time on top of everything else!

* frames: for me between 60-90 frames is ideal, but 40-120 frames is the absolute min-max I'd personally use in a normal gifset loops: for the smoothest loops, try to avoid cutting someone off mid-movement or mid-word if possible. aspect ratio: for full-size (540px) gifs, I tend to go for either 8:5 (slightly 'skinnier' gifs), 7:5, or 5:4 (particularly big, thick gifs lmao)

✨ natural gif colouring goals

part of what can be so daunting about starting gif making is not knowing where to start or what you want to achieve. this is definitely something that gets easier with practice - the more gifs you make, the more you'll get a feel for what kind of look you like and the more instinctively you'll know how to get there. it also helps to see if any gif makers you like have made "before and after colouring" posts - these can help with getting a sense of the kinds of changes made through gif colouring. here's one I made!

in general, I like to make my gifs bright and 'clean' looking, with vibrant but natural colours. these are the things I'm usually hoping to achieve with colouring:

brighten dark scenes

remove muddy, yellowish lighting or filters

saturate colours

correct any skin lightening filters or overexposure

make lighting and colours as consistent as possible between gifs within a single gifset, especially gifsets featuring gifs from multiple scenes/episodes/videos

this guide is focusing on natural colouring, but of course there are many cool ways to make stylised/unnaturally coloured gifs. imo you'll need to master these basics first, but if you want to learn how to do things like change the background colour of gifs or use gradients or other cool effects, then @usergif's resource directory has loads of super helpful tutorials!

✨ very very basic colour theory

[disclaimer! I don't know shit about fuck. I do not study light or art. this is just an explanation that makes sense to me exclusively for the purposes of gif making.]

the primary colours for light/digital screens are red, blue, and green. having all three colours in equal measures neutralises them (represented by the white section in the middle of the diagram).

so to neutralise a colour within a gif, you need to add more of the colour(s) that are lacking.

in practice this usually means: the scene you want to gif is very yellow! yellow is made of red and green light, so to neutralise it you need to add more blue into your gif.

it can also mean the reverse: if you desaturate the yellow tones in a gif, it will look much more blue.

looking at the colour balance sliders on photoshop can make it easier to visualise:

so making a gif more red also means making it less cyan.

removing green from a gif means adding magenta.

taking yellow out of a gif will make it more blue.

tl;dr:

neutralise yellows by adding blue (and vice versa)

neutralise reds by adding cyan (and vice versa)

neutralise green by adding magenta (and vice versa)

2. super simple colouring (the essentials)

starting with a nice sharpened gif in photoshop in timeline mode. (these are the sharpening settings I use!)

some scenes are much harder to colour than others - it helps to start out practising with scenes that are bright/well-lit and that don't have harsh unnaturally coloured lights/filters on. scenes with a lot of brown/orange also tend to be harder.

I usually save a base copy of my gif before I start colouring just in case I end up hating it, or find out later that it doesn't quite fit right into a set and need to redo it etc.

so here is my base gif!

it's an okay gif, but it has a bit of a yellow tint to it that I want to reduce.

colouring is easiest to do in adjustment layers, which can be found under layer -> new adjustment layer - or for me they are here:

there are lots of different types of adjustment layers that do lots of different things - but for me the absolute essentials for colouring are curves, selective colour, and hue/saturation.

I also use brightness/contrast, levels, exposure, vibrance, colour balance, and channel mixer sometimes, depending on the gif - but I use curves, selective colour, and hue/saturation on every single gif.

✨ curves layer

the first thing I always do is a curves layer. when you first open one it will look like this:

first I usually click the ‘auto’ button, just to see what happens. sometimes it makes a big difference (it usually brightens the gif a lot) - but on this gif it didn’t do much.

if it had made the gif look nicer then I would have kept it and added a second curves layer on top to do the rest of these steps.

the next step is selecting the white and black points with the little eyedropper tools.

the bottom eyedropper lets you pick a white point for the gif. click somewhere super light on the gif to see what happens - for this gif, I clicked on the lampshade on the left. if it looks weird, I just undo it and try somewhere else - it usually takes a few goes to find something that looks good.

here's what that did to the gif:

then I pick the top eyedropper and use it to pick a black point by clicking somewhere really dark, again playing around until I find a black point that looks good.

here's what the gif looks like after picking the white and black points:

this can take some experimenting, but you can make super easy drastic changes to your gif just with this. in this case, the curves layer took out a lot of that yellowy tint.

and this is what the curves graph looks like now:

you can click and drag those lines to make further changes if you want - I usually leave them alone though. the colours of the lines indicate which colours have been changed in the gif - for example, you can see from that steep blue line on the graph that blue has been added to neutralise those yellows.

next I usually do another curves layer and just press the ‘auto’ button again to see what happens. usually it brightens the gif a bit more, which I like.

‼️if nothing is working: usually with a bit of fucking about a curves layer works well - but sometimes you can’t find a good white and black point anywhere, and instead your gif turns wacky colours and nothing looks good. this happens more often with very heavily colour tinted scenes :( the troubleshooting section at the end goes over some options, including starting with a levels layer instead.

✨ selective colour (and skin tone correction)

skin tones are made up of a mixture of yellow and red.

removing yellow (or adding blue or red) to a gif will make the skin-tones too red - and removing red (or adding cyan or yellow) to a gif will make the skin-tones too yellow.

adding blue to this gif with the curves layer took out the yellowy tint, which I wanted - but it also took the yellows out of Kim's skin tone, which I don’t want. so I need to put yellow back into the skin tones specifically - without putting it back into the rest of the gif.

selective colour layers let you select an individual colour and adjust the levels of other colours within that colour. you can change how yellow the green shades are, or how much cyan is in the blues, for example.

I need to add yellow back into the red tones to correct the skin tones on this gif. this is the case for most gifs in my experience - the vast majority of the time, unless a scene is very heavily tinted in another colour, a curves layer will add blue/remove yellow.

in the 'colors' dropdown, select the 'reds' section and drag the 'yellow' slider higher - this will add more yellow into just the red shades within the gif.

the amount of yellow you need to add back into the reds depends on how much yellow was taken out of the gif initially - I just play around with the slider until it looks right. if you're not sure, it helps to have some neutrally-coloured (not white-washed!) reference photos of the people in your gif to compare to.

here's the result. Kim's skin is a lot less pink toned and much more natural looking:

✨ hue/saturation

this adjustment layer lets you adjust the hue and saturation of the gif as a whole, and also of each colour individually.

I don't use the hue or lightness sliders unless I'm trying to do something more complicated with the colouring.

clicking the dropdown menu that says 'master' lets you edit the saturation of each colour individually. this is useful if your gif is still super tinted in one colour.

I thought the yellows on this gif were still slightly too bright, so I switched to the yellow channel and desaturated them slightly. (remember if you do this then you need to go back to selective colour and add more yellow into the red skin tones to balance out the desaturation!)

then I increased the 'master' saturation of all the colours to +5:

I usually find the right amount of saturation is somewhere between +5 and +12, but it depends on the gif.

‼️if the gif feels undersaturated, but the saturation slider isn't helping/is making the colours worse, try a vibrance layer instead.

done!

✨ saving and reusing colouring

you can copy and paste adjustment layers between gifs to make your colouring even across each of your gifs for one scene - so if you're making a set of multiple gifs of the same scene, or you think you might want to gif the same scene again in the future, you can save it as a psd so you can reuse the colouring again later.

each gif's colouring will then still need tweaking - different cameras/angles/shots of the same scene can still start out with slightly different colouring.

I recommend uploading the gifs as a draft post on tumblr so you can see what they all look like next to each other and catch any inconsistencies.

✨ another one! (speedrun!)

HI KEN!

the white point for the curves layer was in the window behind them.

the curves layer removes the muddy yellow tint, but again it makes their skin tones (especially Ken's) very red toned, which is adjusted by the selective colour layer.

3. other adjustment layers

imo many many gifs can be coloured really nicely with just those three adjustment layers, but some need different adjustments.

✨ brightness/contrast

pretty self explanatory!

I personally usually avoid using the 'brightness' slider because I rarely like the effect - I only tend to use the 'contrast' one. 

the 'auto' button is sometimes useful though, especially if you’re struggling with the curves layer.

✨ levels

levels alters the white and black points of the gif, like curves - but unlike curves it doesn't also alter other colours.

use the sliders beneath the graph to alter how dark/light the gif is. you can slide the black slider further to the right to make the blacks darker, and the white slider to the left to make the whites lighter.

levels is a good place to start if your curves layer isn't working.

(I'm going to hit the image limit for this post lol so here are some screenshots of a table I made to demonstrate this rather than actual gifs. sorry!)

on both sides, I dragged the sliders up to where the big jumps are on the graph - this is usually a good place to start!

✨ vibrance

vibrance... makes the colours more vibrant. it's more subtle than saturation.

it's really helpful for gifs that feel grey. sometimes adjusting saturation just makes the greys kind of weirdly tinted, but a vibrance layer can fix that.

vibrance is much more subtle!

✨ colour balance

colour balance affects the overall balance of colours within a gif.

it's good for scenes with heavy tints.

I tend to stick to the 'midtones' dropdown, but you can also alter the colour balance within the shadows and highlights if you want.

✨ channel mixer

I avoided channel mixer for such a long time because it scared me. but it's great for scenes that are very heavily tinted in one colour.

basically, it works with the levels of red, green, and blue within a gif. you select an output colour and then play around with the levels of the colour you selected within each other colour.

kind of the reverse of selective colour?

so in the 'blue' channel, the levels of blue are at 100%, and the levels of red and green are at 0% - but you can impact how much blue is in the reds and greens and blues.

this tutorial explains it well - but imo the best way to get to grips with channel mixer is just to play around with it a bit (sorry)

(when I made this guide for my friend, I also made a slightly more complicated gif colouring walk-through that included using channel mixer. there isn't space to include it within this post, but if anyone is interested I could always upload it as an 'intermediate' gif colouring tutorial - lmk!)

4. troubleshooting

‼️curves

usually with a bit of fucking about a curves layer works well - but sometimes you can’t find a good white and black point anywhere, and instead your gif turns wacky colours and nothing looks good. this happens more often with very heavily colour tinted scenes :(

for example, with this base gif:

using many of the brightest points as a white point turn it wacky colours, like this:

yikes :(

some options for these cases:

try brightening the gif first with the 'auto' button on the curves layer or with a levels layer. having a brighter gif to start with can give you better options for picking a white point.

try finding an alternate, whiter/brighter white point. look for places the light reflects - on this gif, using the light on Porsche's cheekbone works well as the white point. it also helps to find places that would be white if the scene wasn't tinted - the lightest part of a white shirt is often a good place to start, for example.

skip the curves layer, and instead use a levels layer to alter your white/black points, and colour balance or channel mixer to balance the colours.

‼️over/undersaturation

if your gif (especially the skintones) is looking a little washed out or lifeless, it might be undersaturated. boost that saturation - or if that's not working, try a vibrance layer.

oversaturation is often easiest to spot in the mouths and ears of any people in a gif. if the mouths are looking unnaturally, vibrantly red, then you've gone too far with the saturation.

5. fin!

and done! I hope this was coherent helpful to somebody.

if there's anything that I've missed or that doesn't make sense pls feel free to shoot me an ask or a message and I'll do my best to help! I've also collated a bunch of additional reading/resources below.

happy gifmaking 🥰

✨ some links!

photoshop basics by @selenapastel

gifmaking for beginners by @hayaosmiyazaki

gifmaking guide for beginners by @saw-x

dreamy's gif tutorial by @scoupsy-remade (includes instructions on how to blur out burned-on subtitles or annoying video graphics)

beginner's guide to channel mixer by @aubrey-plaza

how to fix orange-washed characters by aubrey-plaza

colour correcting and fixing dark scenes by @kylos

does resampling matter? by usergif

how to put multiple gifs on one canvas by @fictionalheroine

watermarking using actions by @wonwooridul

resource directory by @usergif

[lakesbian]

i have had like 10 friends rec worm to me but nobody’s given me a good like, gist of its vibe and what its abt because ‘its best blind’, could u please give a like brief summary and vibe check of it 😭 it’s so long i dont wanna try and invest that much time without knowing much abt it

so, worm is a 1.7 million word long webserial written in 2010. 1.7 million words seems like a lot, but it was also written over a relatively short period of time, which means the writing style is very easy to parse--the ideas aren't without complexity, but the language itself isn't intimidatingly dense. you can get through it at a very decent pace. i agree with your friends that there are vast portions of worm that hit best when you're unspoiled, but the thing is that worm is long enough that giving you the basic plot pitch is in no way spoilers for any of the things that i wouldn't want to see spoiled for someone. i'm actually kind of baffled they're not telling you Any Thing, because it is in my estimation one of the best books i've ever read, but it also Needs a briefing before you get into it for like five different reasons. which i will now provide. i swear to god this is brief by my standards it's just that i am very thorough

worm is a story about superheroes and supervillains, set in a world where superpowers are traumagenic--rather than appearing randomly or innately, some people gain powers after a traumatizing event happens to them. the protagonist is taylor hebert, a 15yo girl who has the power to control insects and desperately wants to be a superhero. and then accidentally finds herself scouted by a team of teenage villains instead. who's to say how she's going to react to all that!

one of the most compelling things about worm is that the superpowers in it serve as visceral, hyper-literal metaphors for the trauma and traumatized coping mechanisms of the characters with those powers. each power is incredibly specific and thematically relevant to the person who has it, and it's incredibly interesting and evocative. it feels so natural and well-done that it comes off like how superpowers are just meant to be written.

the fact that superpowers stem from trauma also means that worm is fundamentally a narrative about trauma. specifically, about traumatized teenagers and the relationships they form as they cling together while struggling through growing up traumatized & mutually coping with an increasingly intriguing, intense, and far-reaching escalating plot. worm's depictions of trauma + mental illness--including unpalatable trauma responses, including traumatized characters who are allowed to be complicated and nuanced and messy while still receiving narrative respect--are deeply real-feeling and impactful, and they're placed in the context of a well-spun + engaging story.

i really do have to stress how excellent the character writing is. worm is fully deserving of being as long as it is. over the course of 1.7 million words of character development, the average reader's reaction to the main characters goes from "sorta interesting" to "okay, i want to see where this goes" to "augh...really likable" to "i am now on hands and knees crying and these characters are going to stick around in my brain forever." wildbow has incredible talent for efficiently conveying complicated, real-feeling, and viscerally evocative characterization. many of the interlude chapters (chapters written from the perspective of different characters other than taylor) are so interesting, fleshed-out, and emotionally affecting that they make you wish you could read an entire novel about just the side character being featured. with that level of characterization for just the side cast, it's not surprising that taylor (& co) are genuinely just downright iconic. and i do not say that lightly--taylor is truly one of the best-written protagonists i've seen in anything. ever.

the other main pitch-point for worm is that it's a fascinating deconstruction/reconstruction/examination of the conceits of the superhero genre. it answers the question of--what would the world have to be like, for people with superpowers to act the way they do in classic cape media? and it does this well enough that it's interesting even if you have only a passing familiarity with cape media. i am not a big superhero media fan, but worm addresses virtually every aspect of cape media that was under the sun around 2010 in a way that's so interesting i still find it incredibly engaging. the approach it takes makes the narrative very accessible even to people who aren't usually cape media fans.

and speaking of the narrative: the end of the story is coherent and satisfying and deeply thematically resonant*. the way worm follows through on all of its main mysteries & plot threads is excellent. you don't have to worry about getting thru 1.7 million words and being dissatisfied by the author shitting the bed at the end, or anything like that. he does an amazing job of weaving together plot events in a way that makes each successive one feel rationally, thematically, and emotionally connected to what came before. there's really only one part where i feel the story stumbles a bit, but i think it was the best option he had for the narrative, and it's by no means a dealbreaker. it's in fact really impressive how cohesive and satisfying worm is for such a long webserial released over such a brief period of time.

*this is subjective ive seen some people who didnt love it but ive never seen anyone who downright Hated it who didnt also demonstrate egregious misunderstanding of literally everything worm is about. so thats a good sign

as for the downsides of worm/things that might put you off:

there is a very long list of trigger warnings for it. if you have any trigger warnings you want you should ask your friends to let you know about the relevant parts, because the fact that it's About Trauma (& about typical cape media circumstances presented very seriously) means that traumatic and violent things & their realistic aftermath are constantly happening and/or being discussed. i would not classify worm as needlessly dark or spiteful to the audience by any means, but it is intense and covers a lot of heavy topics. i do assume if your friends are all recommending it to you, they think none of the material would be too much for you, though!

worm was written in 2010 by a white cishet guy from canada. it's typical levels of 2010-era bigoted, it has a deeply lesbophobic stereotype character, it has some atrociously racist stereotype characters, the author really hates addicts, It's Got Blind Spots. i think worm is generally fully worth reading despite these, but very fair warning that it can get bad. i think what exacerbates this is that worm is generally extremely nuanced & sympathetic regarding ideas such as "crime is a result of systematic circumstance vs people just being inherently evil" and "mentally ill people who are traumatized in unpalatable ways are still deserving of fundamental respect as human beings" and so on and so forth, so it's extra noticeable and insufferable when you get to a topic the author has unexamined biases on and all that nuance drops out. the worst part is that a lot of this is most concentrated in the early arcs, so you have to get through them without being super attached to any of the characters yet. it is worth it though.

worm like. Does have a central straight relationship in it. and it's a very well written straight relationship for the most part and i like it quite a lot. but worm also passes the bechdel test with such flying colors that it enters 'unintentionally homoerotic' territory. which means a lot of people were shipping the main character ms taylor hebert with her female friends while the story was being released. which caused the author to get so mad he 1. posted a word of god to a forum loudly insisting that all of the girls are straight and 2. inserted a few deeply awkward and obvious and out of character scenes where he finds an excuse for the girls to more or less turn to the camera and go "i'm not gay, btw. this is platonic." This is fucking insufferable, and will piss you off immensely, but then you will get to any of the number of deeply emotionally affecting scenes between them, and at that point you will be too busy sniffling piteously and perhaps crytyping an analysis post on tumblr to be mad about all that other shit. also they're only a couple tiny portions out of an entire overall fantastic novel

overall: if those points don't sound like dealbreakers (i hope they aren't they're really massively outstripped by the amount of devastatingly good moments in worm, worm still has a thriving fandom over a decade later for a reason), you should absolutely give it a shot and see what you think. my final note is that you have to read up until the end of arc 8 to really see where what makes worm Worm kicks in, so aim for at least there to see how you feel about it if you're just thinking about dipping your toes in vs fully committing. i hope that was helpful and not too long :)

oh and don't go in the comments section on wordpress if you don't want spoilers. or anywhere else in the fandom at all. you will be spoiled. quite possibly for things you could not even have imagined were topics to be spoiled on.

[unprettyg1rl]

I’m reading a book on the history of invention and how our cultural views of masculinity vs femininity affect our progress and holy shit if women’s needs and preferences were taken seriously we would’ve been using electric cars since the late 1800s instead of just starting to use them now.

In “Att uppfinna världen” (Mother of Invention in the English translation) by Katrine Marçal there is a chapter dedicated to the process of inventing the modern automobile, where I read that there were multiple ways of constructing a car when the invention was relatively recent, as the field was still open to experimentation. Petrol wasn’t an obvious choice for fuelling the engine – in fact, around the year 1900 a third of all cars in Europe were electric cars, and the percentage was even bigger in America. Electrically powered cars were superior to petrol-fuelled ones in many ways: they were quieter, didn’t expel smelly gas, much safer and more reliable, and easy to start and control from the driver’s seat. Cars fuelled by petrol, on the other hand, were loud, more unreliable and required a lot more maintenance, and to start the engine one had to do some serious manual labour involving a crank – which would often leave you sweaty and with oil stains on your clothes, plus a constant risk of causing an explosion if you weren’t careful enough. Naturally, women preferred the former, being more convenient and comfortable and thus more suited to their travel needs, whereas the petrol-fuelled car was marketed as the more adventurous, macho choice for men.

The one downside to electric cars was that the battery didn’t last for longer journeys, which in the case for women wasn’t that much of a problem since the majority mainly just made trips within the city or town. This was also an issue that could’ve been fixed, and there were many plans to do so, mainly infrastructure-related ones like battery-switching stations and developing better battery solutions. There were even plans for a net of rentable electric cars for anyone to use, and electric trains, trams, and taxis for public transport (seems very ahead of its time, doesn’t it? A much more environmentally conscious system than our good ol’ “everyone has one or multiple cars that individually expel copious amounts of greenhouse gasses” method). However, investments were too few since the male-dominated society deemed these “women’s cars”. After all, a real man isn’t soft, safe and comfortable – he cranks his own car to life and makes a lot of noise as he travels. A report from 1916 by the magazine Electric Vehicle stated that “The thing that is effeminate, or that has that reputation, does not find favor with the American man. Whether or not he is ‘red-blooded’ or ‘virile’ in the ordinary physical sense, at least his ideals are. The fact that anything from a car to a color is the delight of the ladies is enough to change his interest to mere amused tolerance.”

Like, it’s insane that values such as comfort, safety and convenience were seen as “feminine” and thus dismissed, leading to petrol-fuelled cars completely taking over the market in the end. Imagine what the world would’ve looked like if women were the standard instead of men. It really pains me to think how much damage we’ve done to the planet just because of men’s stubborn macho ideals.

(a lot of this research is quoted from The Electric Vehicle: Technology and Expectations in the Automobile Age by Gijs Mom, a book I’m now very interested in reading in full)

[projectionistwrites]

FOR SCIENCE | the project proposal

In which the Moon Knight alter system presents a unique opportunity to settle the nature versus nurture debate, once and for all...

Steven Grant/Marc Spector/Jake Lockley x afab!psychologist!reader (3.2k+)

RATING: EXPLICIT (18+, mdni) WARNINGS: descriptions of mental illness, depictions of DID, fetishization of mental disorders (DID), potentially unethical scientific practices, no smut in this part NOTES: again, please don’t read this if you’re concerned at all with research ethics, as this is NOT a good demonstration of scientific procedures and studies. DISCLAIMER: although i’m incredibly knowledgeable about psychology, i am NOT a professional. all psychoanalyses made throughout the course of this storyline are entirely my own, based on my own interpretations of the characters. in a similar vein, i am also not an expert on DID specifically (although i am well-read on mental disorders and diagnoses), so i apologize for any incorrect terminology or misrepresentation. don’t hesitate to call me out if i say something wrong!

next part →

Marc Spector’s psyche was a psychologist’s wet dream.

Three distinct personalities, completely separated from each other, all occupying the same host body. At one point, all mutually unaware of the others, but now living together in solidarity and (relative) cooperation.

Meeting Marc Spector was a happy accident—but meeting a man with a clearcut case of Dissociative Identity Disorder as a Professor of Psychology? Now that was just pure, dumb luck.

You had met Steven Grant first. You’d run into him at the British Museum during a university-sponsored visit. Your interaction had been brief, but it was memorable for you nonetheless—there was just something about those soft brown eyes and dopey, shy smile that melted your heart.

Imagine your surprise when you accidentally ran into that same man on the bus, only for him to introduce himself as Marc with a midwestern American accent and a cold, calculated gleam in his stare. He was forward and confident—very much unlike your previous encounter with him. When you called his bluff and swore you’d interacted with him under the guise of Steven, he pulled you aside and gently tried to justify the confusion.

“It’s—I have this...condition. It’s—have you ever heard of Dissociative Identity Disorder?”

You had tried hard to fight your smile.

“Yeah, I’m familiar with it.”

It was only revealed to him—after his winded and lengthy explanation—that you had a doctorate degree in clinical psychology and specialized in mental disorders.

Steven’s curiosity was piqued, and Marc silently hoped you’d be able to shed some insight into the functioning of his fragmented mind. You quickly established an easy friendship, somewhat reminiscent of a relationship between a client and therapist—although you knew and cared for each other on a much deeper and more intimate level.

Several months later, you were finally introduced to the most elusive alter within the system—Jake Lockley.

You began to spend the majority of your free time with the men—all three of them seemed to be relatively taken with you. Steven was sweet, Marc was shrewd, and Jake was steadfast. It was sometimes difficult to conceptualize that they all shared the same physical body with how differently they behaved.

It hadn’t started as a project—genuinely, truly, it hadn’t. It wasn’t your intention to be so captivated by those big brown puppy-dog eyes or the softness within his smile. And the feelings you had for him—for all of them—were real, and raw, and indisputable. You would never, ever, ever do anything to make them feel uncomfortable or jeopardize your relationships in any way.

Which is why this was such a bad fucking idea.

Your nails drummed against the side of your porcelain coffee mug as your nervously chewed on the cap of your red pen, making a futile attempt to focus on grading the research report in front of you, but your attention was clearly elsewhere. Your eyes kept darting to the clock on the wall across from you, watching the second hand tick away slowly. The coffee shop was playing gentle soothing acoustic songs, the smell of cinnamon lingering in the air, but even the coziness wasn’t enough to shake your nerves.

“Hey, there, Doc.”

Your head perked at the sound of a familiar voice, a warming hand clapping your shoulder as Marc Spector walked to the other side of the small table and sat down across from you. You groaned at his greeting, pulling your reading glasses from your nose and setting them on the table in front of you.

“Marc, I swear, if you call me that one more time, I’ll—”

He threw his hands up in mock surrender, although he was smirking slyly at you.

“Alright, alright, jeez—what’s got you wound up so tight, huh?”

He reached for the paper on top of the stack in front of you, reading off the title aloud.

“An In-depth Investigation Into the Underlying Psychological Causes of Erectile Dysfunction in Men Under 50.”

His face contorted in a look of disgust.

“Jesus—that’s gotta be the most boring fuckin’ thing I’ve ever heard.”

You watched as his eyes fluttered briefly, his posture sinking and his features softening. When his eyes regained focus, he shook his head, huffing.

“Bugger off, Marc—I think it sounds plenty interestin’.”

Steven smiled graciously, offering the packet back to you. You accepted it tiredly, throwing it atop the pile of what seemed like an endless supply of mediocre student submissions that had yet to be graded.

“Thanks, Steven, but Marc’s right—my brain’s fried. I swear, if I have to read another shitty case study about men whose dicks don’t work, I’ll gouge my eyes out.”

The man chuckled at your confession as you shoved the stack of papers into your briefcase clumsily, snapping it shut without a second thought and letting it fall back to the floor beside your table. You carefully picked up your mug and took a long, slow sip—your coffee was barely lukewarm, at this point, as you’d be sitting at the cafe for hours, working quietly as you patiently waited on your friend’s arrival.

Although Steven was blissfully oblivious, Marc was observant. His consciousness pushed to the front, studying you carefully—your white-knuckled grip against your cup, your shifty eyes that were looking everywhere but at him, the tension in your shoulders and nervous bouncing of your leg.

“Alright—what’s wrong?”

Your gaze snapped over to him where he was sat with arms crossed over his chest, eyes narrowed in suspicion. You tried to force a smile in an effort to cover up your uncertainty.

“Nothing’s wrong, Marc. Promise.”

You held his gaze intently, trying to convince him with your half-hearted response. His stare didn't waver, and after a few brief moments, you had to look down, overwhelmed with the intensity of his scrutiny.

“Alright, let’s try that again. Y/N—what’s wrong?”

You let a long, exasperated sigh, running a tired hand down your face. This had been weighing on you for a few days, at this point, and you still weren’t sure if you could handle the emotional labor this conversation would require.

“It’s true, nothing’s—nothing’s wrong, per se, I just—I just need to talk to you. I’ve—I have this idea—”

“Like—a work-related, science-y idea? You want Steven? Or—I can try my best to help, but sometimes you get excited and start talking really fast and I can’t keep up, but—”

“No, Marc, it’s not—I mean, it’s not really science-y, but like, also—it kinda is? I don’t know how to explain it, but I really need to—”

“I mean, whatever it is, you seem pretty worried about it, so obviously it’s important, and—and I just wanna make sure we’re giving you whatever response you need, or, at least—”

“Jesus, Marc, if you’d let me finish.”

You clipped, and his jaw snapped shut instantaneously, somewhat taken aback by your outburst. You were normally so controlled, practiced with your expressions, so seeing any sign of emotional imbalance was startling.

Guilt immediately flooded your stomach after you lashed out—you buried your head in your hands, taking a few slow, deliberate breaths in an attempt to quell your rapid heartbeat.

“Shit—sorry, I didn’t mean—this is just... I’m not sure how to go about this.”

You felt the featherlight brush of calloused fingertips against your forearm, coaxing your face away from your palms. When you finally lifted your head, Steven had returned, his eyes soft and reassuring. He pulled your hand into his, squeezing briefly before rubbing his thumb comfortingly across your knuckles.

“S’alright, love, truly. Take as much time as you need, and—and if there’s anythin’ you need from us, it’s yours. Just—whenever you’re ready.”

You tried to ignore the butterflies flitting in your stomach at Steven’s gentle promise. You inhaled once more, before finding his eyes.

“This—I need to talk to all three of you. Can you—are you in a place where you can all be co-conscious?”

Steven’s lips turned up at the corners at your thoughtfulness. He received verbal responses from both Marc and Jake—a confirmation that they were both actively listening.

“’Course. We’re all here. Is—do you have a preference, as to who you’d like to speak with?”

You returned his smile, offering a slight squeeze to his hand.

“I mean—since you’re already fronting, might as well stay, huh?”

Steven blushed, trying to fight the giddiness that came from your validation. He quickly steeled himself, reminding himself that you were struggling to open up to him.

“Alright. Whenever you’re ready, then, yeah?”

You cautiously pulled your hand away from his, mostly to keep yourself grounded and get out what you needed before you second-guessed yourself.

“So.”

You cautiously began.

“I had this—this idea. And it’s—it sounds crazy, and I get that, but I haven’t been able to stop thinking about it, especially because—well, I just feel like this is something that could have damning effects on the entire field of psychology, with both practical and theoretical applications, but—that doesn’t mean—I don’t want you to feel obligated by any means to agree, or—or to feel pressured into anything, and I definitely don’t want you to think that—that I’m using you, because that couldn’t be farther from the truth, I swear, and—”

“Y/N.”

His tone was soft, a quiet interruption from your rambling, and your eyes widened in concern. However, he offered you a reassuring nod.

“Just tell us what it is, yeah? We’ll go from there.”

You nodded slowly, squeezing your eyes shut, before beginning again.

“There’s this huge debate in psychology. It’s pretty much the basis of a lot of our research—the whole nature versus nurture debate. Basically, it’s all about how much of our personalities can be attributed to genetics versus how much can be attributed to our life experiences.”

Steven was listening intently, leaning forward into your words.

“Well, it’s—it’s a concept that’s really difficult to research, because, well, we don’t really have a basis of comparison. The best thing we have to go off of is when identical twins get separated at birth and grow up in different places. Or, at least—that was the best we’ve had up until this point. Does—does that make sense?”

“Yes.”

He assured, nodding in acknowledgement. You only hoped the other two alters were keeping up.

“So, basically what I’m getting at here, is, well—you, and—and all three of you, really—Marc and Jake, you guys provide a really, really unique opportunity, because, well—you share a body. So, physiologically, you’re completely identical. The only thing that’s different about you is who you are, so—your life experiences and memories and things like that. You’re—you’re like the perfect example of how our experiences shape our beings.”

“Right. Right.”

Steven followed your train of thought carefully, brows furrowed. You took a deep breath. This is the part you were dreading.

“So, I had this thought... you three boys are so vastly different from each other. Like, really, really different, and—and you each have your own preferences, things like that, but—but you still have the same body. In my Abnormal Psych course, we’re studying intimacy and desire right now. So—so what I was wondering was about your—your sexuality. Like, to what extent are your sexual preferences due to your biology rather than your cognition.”

Steven blew out a shaky exhale, though he tried not to appear perturbed by your words. His mind was silent—he could feel the intense focus from his alters, now hanging on your every word.

“What if there was a way, to, you know, test, how different your sexual preferences are? And to test and see how your arousal is different, or the same, based on locations of stimulation and things like that?”

Bloody fucking hell.

In a split second, Marc was fronting, Steven slipping back into the headspace, completely overwhelmed and unsure of what to say or how to react. You noticed the abrupt switch, and after recovering from the brief whiplash, you felt panic spur within you. You’d scared him away.

Marc’s brows were furrowed, like he wasn’t completely picking up what you were putting down.

“So, what exactly are you suggesting?”

You closed your eyes.

“I guess—what I’m suggesting is that you—you help me research. You—you let me study you, each of you, independently, to see—to see how different your sexual behaviors and preferences are.”

“Like—like a questionnaire, or something?”

Marc questioned, but when you shook your head, eyes casting downwards, it suddenly dawned on him. Steven’s departure made sense. Everything made sense.

“So... so lemme get this straight.”

Marc made a stopping motion with his hand, gesturing for you to pause.

“You—want to have sex, with me—with us... for science?”

“Well, I mean, it—it doesn’t necessarily have to be with me, I could—we could find someone else, if you’re more comfortable, and—and I could just observe, or—”

“So you’re a voyeur, now?”

You jolted and Marc’s vulgarity, eyes quickly scanning your surroundings to make sure no one was listening in on your conversation. Luckily, the cafe was relatively deserted at that point.

“No! No, that’s not—I’m just saying, with what I’m suggesting, it—it would make the most sense for the researcher to—to be more hands-on, but that’s...”

Your voice trailed off, staring at a speck of grime on the table, trying to calm the rapid racing of your heart.

Yeah, seems she's interested in being real hands-on, huh?

Marc struggled to hold in his snickering at Jake’s internal dialogue, but after seeing the worry that was clinging to your features, his sympathy prevailed.

“Y/N.”

He spoke calmly, cool and collected. Your eyes flitted to his, where he was watching you intently. However, you could see the ghost of a smirk on his face.

“So what you’re saying is... you want to have sex, with me, for science.”

He reiterated, and you opened your mouth to protest, to defend your credibility, to rationalize your bizarre proposition, but instead, a long sigh escaped you as you admitted defeat.

“Yes. Yeah. That’s…exactly what I’m saying.”

A brief silence stagnated between you, and there was a tightness forming in your chest as every worst-case-scenario began coming to fruition in the forefront of your mind.

“I’m—I’m so sorry, Marc, I didn’t mean to overstep, or—or—”

“What, exactly, would this entail?”

Marc inquired, unable to deny his curiosity. You blinked once, then twice, processing his words.

“So—so you’ll do it?”

He held up his hands as if to tell you to slow down.

“Just—hang on. Hypothetically speaking, what—what would this even look like?”

Excitement zipped up your skin as you reached down into your briefcase, pulling out a manila folder full of several sheets of scribbled ideas and disorganized thoughts.

“Well, see, I’ve been brainstorming—”

Christ, she has the whole thing planned.

Steven’s voice sounded faint, breathless, winded. Marc ignored him, instead focusing in on your sudden enthusiasm.

“—and I came up with a research plan. So, the way it would go—we’d meet for the weekend, three weekends in a row, with a week break in between. Each alter will have their own weekend to be the subject of study. Day one, we—well, you would lead the sexual encounter. Do what you want, showcase what sex usually looks like for you, what you like, what you don’t like—”

Marc's mind was reeling. He shamelessly attempted to ignore the effect your words were having on him. Do what you want. What you like. To you.

You were still talking.

“—and then the second day, you’d let me take the reins. I’ll psychoanalyze your behavior from the first day, and synthesize that with all the information I already have about you, and I’ll try to—well, I don’t wanna say push your buttons, but—basically, as shitty as it sounds, I’d be trying to bring to light any vulnerabilities, prod at the soft spots, stuff like that. Try to see if I can find what it is each of you seeks out through sexual intimacy. Does that make sense?”

Marc shook his head, lost in thought, but he blinked away the fog in his mind and quickly corrected himself with a nod.

“Yeah, I mean—I think so? Would this—what would you do, once it’s over? Like, what’s the point?”

“It would never be published, or shared with anyone else, I can promise you that. It’s—it would mostly be for me. Kind of like a passion project, I guess. I’ve been thinking about it for awhile, and, well...”

Passion project?

What’s she mean, ‘she’s been thinkin’ about it for awhile?’

Marc almost shushed the voices in his head aloud, trying to clear his head of static so he could properly take all of this in.

He looked up at you, and you were staring up at him with eye round and hopeful, almost reverent as they passed over him. He blew out a slow breath.

“Do... can we have time to think about it? To talk about it?”

The fuck do you mean, jefe? I’m ready to start right now.

You nodded encouragingly, although Marc caught the brief glimmer of disappointment in your eyes.

“Of course, Marc. Take as long as you need. And—please don’t feel obligated to say yes. I mean it. I know—I know this kind of came out of left field, and—and I don’t want to violate any boundaries, or—or jeopardize our friendship in any way, I would never want to do anything to make you uncomfortable, just—”

You stalled your tangent with a slow breath.

“Just let me know, okay?”

Marc nodded at you, smiling softly and contemplatively as he rose from the table and exited the coffeeshop, leaving you to stew in anticipation and something adjacent to remorse.

The call came in the next day, at 11am on the dot. It was Steven on the other line when you answered, walking out of the lecture hall doors as your class adjourned.

“Hello?”

You answered.

“Mornin’, Y/N. It’s, uh—It’s Steven.”

You giggled.

“I know, Steven. I have caller ID, and believe it or not, your accent is kind of distinct.”

You could practically hear him blush on the other end.

“Right. Yeah. Well, I just—I was callin’ to, uh—Christ, of course they made me do this, I can’t even—”

“Steven.”

You interrupted gently, your calmness soothing his nerves to some degree. He took a breath.

“Sorry. I—We talked it over. The whole—your experiment. And—and I think we’re all up for it.”

You froze in your tracks, students continuing to rush around on either side of you in the hallway. Your hand was shaking.

“I—really? Are you sure?”

“Well, no—I mean, yeah, I just—of course, I’ve got some reservations, but, I mean—it’s for science, yeah?"

A smile was creeping up your face.

“Yeah. Yes. For—for research purposes.”

Yeah, solely research purposes, my ass.

Marc quipped internally, and Steven gulped.

“Right, then. Could we—shall we meet again today, or—whenever, to talk it over a bit more?”

You nodded before realizing he couldn’t see you.

“That’d be perfect. We can meet same time, same place as yesterday?”

He gave a hum of agreement, and you felt suddenly breathless as the reality of the situation began to set in.

“Right. I’ll—I’ll see you then, okay, Steven?”

“Yeah, ‘lright, cheers.”

“And, Steven?”

You called quickly, hoping to catch him before he ended the call.

He hummed in response. You smiled.

“Thank you. Really, thank you.”