#but all that ever is is like. getting them to ask a specific question because my brain cant Say What I Want unless prompted by a question

[nalyra-dreaming]

Do you think that, at the beginning of the episode, Armand kept Louis asleep so he could spin his little yarn about Lestat without the latter there with the express hope of selling Daniel on the telenovela? As well as maybe making peace/having some quiet time with the Daniel (read: his boy from SF) he kind of tried to protect from Louis' cruel Alice-rant last episode? Daniel has been continuously mocking Louis with the notion of Loumand being "a story that is being sold to him" so maybe this way, Lestat appears to be the bad guy yet again and further Lestat discussions are tabled except explaining how Louis got his groove back (and learned to forget about the 'ever-thinking-about-himself' Lestat)?

I'm a Loustater who was ready to live with Loumand because we have to, and thought I was willing to give Armand some trust that he's trying to protect Louis from doing something terrible in Dubai, but it seems that, with that fiction about Lestat, he's been withholding more than Louis ever did. And whether that's to save Louis or himself and likely both, I can't tell. I can't even imagine how we're going to have a walk-down-memory-lane discussion about the trial if Armand can't be remotely honest, even now, about Lestat.

Lastly, all that talk in theatre about the coven wanting Louis dead if he's not joining etc. Is all that telepathic murder plotting being freely discussed in Dubai?

Need help! Want to understand!!!!!!!!

Oh, I think Louis being asleep when the interview continues is a massive red flag, indeed. He was up during the day before, so why will he rise at sundown now? And why does Armand launch into a little fanfic version of Lestat while Daniel asks him a very different question?

And why did the Mac not record that one sentence?

The thing is... I think Armand is doing precisely what he was doing with Louis at the end of the IWTV book, namely a) lie to him about a few specific things, b) keep a kind of veil over Louis and c) protect him (from others and himself).

It's Armand! He's the coven master. He does what he thinks is best.

And of course he loves Louis, too, but... you know. At this point it should be very clear that Louis did not love him back as much as he seemed to do (before). Louis invited Armand in (and into a relationship with him) to not get killed. And to keep Claudia safe, too. THAT is their actual relationship start and fuck how bitter is that?????

The Louis in Dubai... has lived decades with whatever happened after that event in San Francisco. And whatever happened with the Devil's Minion arc there. And Armand... is still lying to him.

I said it in another ask, but by now I'm leaning towards Louis going to NOLA at the end of the season - and either finding Lestat there ... or NOT. And if he does not find him I can see him go and do the Merrick ending in the Merrick ending place.

I think episode 7 and 8 will shift a LOT of things, and no matter how the trial is narrated we already know it likely won't be how it went. It will be interesting to see if they break the narrative once more - or let Daniel read them to filth.

Because I can see Daniel do that. Because allll the little things, all the Talamasca files, all that background information he has now will click into place for him. Because he is very good at his job.

[luckylittlelesbian]

i have so many thoughts on this. specifically about all their different dynamics

lottie - they have a sort of forced proximity thing going on (forced by lottie). no one else knows about lottie’s pills and mental health issues and she’d love to keep it that way. but our cheerleader girlie was just sort of in the wrong place at the wrong time and saw them fall out of lottie’s bag in the locker room. and lottie has just been pestering her ever since. at first it was begging her not to tell anyone. and the girl is just like idc. why would i tell anyone? but then the fact that this girl now knows makes lottie eventually just be like ykw i might as well tell her all that's on my mind -all the time- cause i have no one else to talk to about this. and so whenever the two of them are together they just constantly end up talking about some crazy mental health shit. they have those “hits the joint” talks without the smoking. but a lot of the times they’re so secretive about their little chats that the other yellowjackets are just so suspicious of them.

shauna - they’re study buddies. and they’re together outside of school like all the time. mostly cause shauna’s constantly like please come over and help me with this homework or this project or this math equation or this test. she always comes up with something. most of the time they end up not studying much at all for hours and then they end up having to stay up all night together working on the stuff they were initially supposed to be doing. and those past midnight/3am vibes just hit so hard for them. when it comes to her feelings - shauna doesn't like that jackie has a boyfriend, she hates how that makes her feel and this new girl has just been such a good distraction from jackie and all the feelings that come with being around her. it makes her feel less guilty; catching feelings for someone who isn't her straight best friend, so she's not opposed to it. also a part of her wants to make jackie feel that jealousy and pain that she feels whenever she sees her with jeff.

jackie - she LOVES the whole cheerleading thing. does she even like soccer anymore? would she rather be a cheerleader? probably. she loves to ask so many questions and watch them practice and try out all the different moves the cheerleaders do. she’s not romantically into our main girl (because she’s into shauna) and she is growing so so so jealous because of this bond that shauna and the cheerleader are developing. but obvi in her mind she's only feeling this way (starting to grow resentful) because she feels like she’s losing her best friend. duh. right. that's it? right?! (....she's a gay)

taissa - exercise! sports! early morning runs! i can see them meal prepping together lmao. these two are !health freaks! and they bond over that fast. taissa teaches her soccer the way our girl teaches cheer to jackie (she's bad at it and taissa makes fun of her for it but then our girl is just like- try doing a backflip. and that gets tai to shut up). a lot of the time the yellowjackets make fun off them for working out like they're preparing for war or something. but also saying it's great that tai finally found someone to be insane with (someone willing to get up at like 5am with her so they can go for a run). it gets kinda shady though, cause even though taissa is with van, she's been spending more and more time with their main cheerleader and enjoying it maybe a bit more than someone in a relationship should.

nat - unfortunately for nat she’s so different from the cheerleader that she’s been finding it hard to connect with her on a deeper level. she is so into her wants to get with her so bad but whenever she tries to get her to go hang out with her, or with her and kevin, it doesn’t usually work out. sometimes she comes along but she doesn’t smoke or drink (!health freak!). so most of the time she’s just like i need to study and ends up going with shauna. or says that tai and her are going for a run or that lottie and her are having a picnic or something. it's very frustrating and makes nat try to join in on her things instead of trying to get her to join in on hers. she tags along for a study session with her and shauna (she's painfully the third wheel). tries to hang out with lottie and her but that quickly ends as the two of them just clearly aren't talking the way they usually would if they were alone. (annoys nat to no end - whatever im going) the worst is when she tries to join taissa and her for one of those runs she's been hearing about. (they have to drag her out of bed.) like it was kind of fun, and it got the girl into her bed (kind of) but she never wants to do it again.

misty - i cant decide if she would be okay with this new girl coming in or not. if she would see her as competition or if she would see her as an authority figure that she would gladly do anything for. maybe a bit of both. the two have a bonding moment when during practice our girl scrapes her knee and misty is quick with her first aid skills. also they end up spending a lot of time on the bleachers watching the yellowjackets play so they bond during those times too. just as friends tho. but there is a certain aspect of jealousy because misty has always wanted to be "a part" of the girls' friend group but she has never been able to integrate with them. and she sees this new girl come in and do it so effortlessly it makes her jealous and sad. i wouldn't put it past her that she might even try to harm the cheerleader somehow and then (some of) the yellowjackets stand up for her and alienate misty even more.

van - she simply dislikes her. partly because of her and tai's growing connection but also just the fact that she isn’t into this whole vain mean girl vibe. (even tho she isn’t that at all) unfortunately van just has this preconceived judgement of how she assumes she must be considering she's this pretty girl cheerleader character. she treats her similarly to the way she treated jackie after jackie left her to die in the plane crash. she believes they’re just too different. she also doesn't like how tai's attention seems to be shifting away from her. this does kinda lead to her bettering her performance tho cause she wants tai’s attention back. to make it even worse, van and tai are already (secretly) dating and this thing that's happening is starting to feel to van a lot like emotional cheating.

laura lee - lowkey just wants someone to go to church and bible study with her. she already knows none of the yellowjackets are interested so she sees this new girl as someone who might be. eventually our girl mentions that her and lottie have been having some talks about spirituality and the vastness of the universe and how there has to be more to all of this (and that lottie has been hearing the voice of god lately jkjk... she doesnt mention that) etc etc and that maybe the two of them could join her to church one day and laura lee is just so ecstatic.

[mudstoneabyss]

neurodivergent but in the opposite way from what I see a lot. "neurotypicals are always using unspoken social rules and cues instead of just stating things clearly and actually saying what they mean like neurodivergent-" brother I am playing 5 dimensional chess with multiverse time travel

[stuckinakillingjar]

my mom telling me that my parent's divorce didn't affect my brother and me much, as if those two didn't completely annihilate my view on love and relationships between people in general

[hershelwidget]

working on so many projects

tag yourself i'm "swap auuu"

[aftermathing]

The worst thing about suffering is that it still hurts when the danger is over but no one cares about it anymore because it shouldn't hurt. No one will ever say "I'm sorry that happened to you" especially when they barely say "I'm sorry that's happening."

[hotchscvm]

three cents

pairings: aaron hotchner x reader

summary: you butt dial your boss during a girls night … the girls night where you told them you’d fuck aaron hotchner for three cents.

word count: 1.2k

warnings: talks of big dick energy, prostitution if you squint, red wine, gray sweatpants (mentioned)

Girls' night out was wild, no one knew where you would end up. One night, you ended up on a boat and the next you were on a train to NYC. After getting thrown in jail with Emily, JJ, and Penelope during another night out, you all vowed to keep whatever happened during the night a secret from everyone, specifically Derek Morgan. Derek Morgan who had bailed all four of you out of jail, Derek Morgan who teased you relentlessly for weeks after.

After a long case, Emily suggested another girl’s night which all of you agreed on, desperately needing a celebratory drink after saving a little girl. It was around one in the morning when you got back to Quantico and though Aaron gave you the day off for tomorrow–or well, later today–all four of you decided to crash at Emily’s and drink to your heart’s content.

Popcorn and Hersey kisses lay on Emily’s coffee table, bottles of half-empty wine and jello shots litter the floor and you’re all giggling about whether to prank Derek by getting phone cases with a picture of him shirtless. You’re all on board and Penelope is getting them custom-made through a website she’s found.

“Speaking of Derek’s abs.” JJ drags the ‘s’ creating a hissing noise. She turns to you, grinning. “I’ve wanted to ask ever since you went to that Doctor Who convention with him. Do you like like Spence?”

You giggled, taking a small sip of wine, thinking about the genius. “Noooo. Spence is my friend. And he runs with his gun like it’s weighing him down. Besides, I only went to that Doctor Who convention because he went to see Barbie with me. He’s, like, too young for me, too.”

“He’s older than you.” Emily points out, smirking, knowing full well you liked older men. “He’s adorable and sweet.”

“Spencer is definitely cute and I’d be lying if I said I hadn’t had a sex dream about him,” you confessed, smiling as the girls burst out laughing. “But he’s too … inexperienced. I like my men like I like my wine. Old.”

Your phone had been on mute since you entered the plane, not wanting to abruptly wake anyone up if they were resting, so not a single person in the room had heard your phone ringing or Aaron’s multiple “hello’s” trying to get your attention. All of you were oblivious to your boss listening in to the conversation.

“Is Rossi too old for you?” Penelope asked, inciting another round of giggles.

You nodded, finishing off your glass of wine. “Just a bit. I’ve seen pictures of him when he was in the Marines though, and I definitely would’ve been the fourth Mrs. Rossi back then.”

Emily cackled, a bit of red wine spilling from her full glass. “Okay, I have a question. Would you guys fuck Hotch for ten million dollars? Be honest here.”

“No!” both JJ and Penelope spit out. They all turned to you, grinning like madmen.

You shrugged, filling another glass. “I’d do it for three.”

“Damn, three million? That’s–“

“Nope,” you smirked, taking a sip.

Emily paused, head tilting in confusion. “Three … hundred thousand?”

“No.”

“Three thousand?”

You shake your head, grinning at the confused woman. “Nope.”

“Three hundred?”

“No.”

Emily’s eyes widened, jaw-dropping a little further as you denied her guesses. “Three dollars?”

“No.”

“THREE CENTS?” JJ was the one to shout, mouth dropping open when you giggled and nodded.

Penelope threw a pillow at you, and you giggled, dodging it, nearly spilling your drink in the process. “Hey! This is supposed to be a judge-free zone. I’d suck and fuck Unit Chief Aaron Hotchner for three measly cents.”

“Okay, I’d understand if you said Derek but Hotch?” Emily exclaimed, shaking her head at the thought. “He’s like twenty years older than you!”

“Exactly! That’s part of the appeal,” you replied. You were sure by tomorrow no one would remember your confession–though you were positive you wouldn’t either–and that they wouldn’t tease you too much over it. “He’s the literal definition of a DILF.”

The girls laughed at your words, JJ having to clutch onto a pillow to control herself.

“And!” you continue. “I was working out with Derek once and Hotch came in the gym with gray sweats and his dick looks humongous. It was a huge fucking bulge. I think I saw it twitching.”

Penelope slaps her hands over her ears, playfully grimacing at your words while Emily chugs the remains of her glass, absolutely baffled. You didn’t mind, sex and boys were common conversation topics during girl’s night (and sometimes when Emily would catch you making eyes at someone.

The rest of the night continued the same, though less talk about Hotch’s big dick and more on whether you all should make more jello shots. By the time you’re coming up with an answer, it’s five in the morning and all four of you are knocked out from the alcohol in your system. Even in your drunk state, you knew you’d wake up to a pounding headache.

When Derek calls in the morning, telling everyone about a new case, you’re all moody and grumpy. Hotch wanted everyone in even though he had given the day off, so no one was jumping for joy especially not in your hangover state.

Despite drinking the most, Emily drives the four of you back to the BAU, mumbling obscenities under her breath on the way. When you enter the elevator, Derek is there, causing all of you to groan at his presence. One look at you and he laughs loudly, knowing what had transpired the night before.

You wish you could shoot his foot.

In the briefing room, Hotch apologizes for having you all come in on your day off, pausing to glance at you before presenting the case. Truth be told, you hadn’t paid that much attention to it, your headache taking up your attention. Fire, serial arsonist, fifteen dead, Seattle.

“Wheels up in thirty,” Hotch announces, walking across the table. As the team filters out of the room, he calls your name. “In my office, please. I want to discuss something with you.”

Confused, you follow him to his office, pushing through your headache to think about what he could possibly want to speak to you about. You come up blank, even more confused when you see him lock the door to his office as you enter. “Did I do something wrong?”

Hotch shook his head, moving past you to his desk. He picks up something and turns around. In his hands are three pennies, and he’s holding them out to you. “Three cents.”

You’re getting deja vu on the words, and it’s not until several seconds of standing in silence and confusion that it clicks. Three cents. You blush, looking at the pennies. “I don’t understand.”

“You said you’d suck and fuck me for three cents,” he smirks at your shock, placing the coins in your hands.

“What–”

Hotch unbuckles his belt, causing you to stop mid-sentence. “You’ve got twenty-eight minutes to suck my cock. Get to work.”

[forcemeanakin]

Anakin Skywalker: A headboard gripper

WARNING: Nsfw content !!! Content: p in v sex, cream pie, dirty talk. A headboard was, in fact, hurt during the production of this drabble. Not proofread and written in the middle of the night after uni classes lol.

shoutout to my friend Emma for asking me this incredible question and fueling my drained mind to write something <3

Ofc he is a headboard gripper!

Using it as leverage to fuck deeper into you, yes sir

But I think he would use it specifically to get you full of him

He's strong af and he has the Force... this? yeah, this is to assert dominance

You're already stuffed by his thick cock, but he needs more: he wants to drown every single one of your senses, until the only thing you could do is feel him, taste him, see him.

Hazy vision, your sweaty body sticky and pressed to his. Hair out of line and all over your face. You're the most wonderful mess he has ever seen.

You borderline sound like a porn star, whimpering so high and loud, moaning his name because that's the only thing you could remember.

Legs wrapped around his waist, your ankles pushing his fit butt so he thrusts harder. Your boobs are bouncing to the rhythm of his hips and he takes the opportunity to rest his face in between them.

You crave more, your spongy walls convulsing around him in the hope to milk him for all of his worth.

Who is he to deny you your orgasm... any longer than he already has?

"You close, baby?" He pants, flexing his arms while he lowers his head to lick the drool off the corner of your mouth.

"Mmph-" You roll your eyes, so into the sub space of your mind to answer a real word. "Ani..." You indulge his desire to hear your voice, just for a bit.

"Yeah, my baby's close. Clenching around me like a vice." He hums half a groan, half a moan. "Tell me what you want, baby. Tell me what you want and I'll give it to you."

"I-I-" You whine when he reangles to hit your G-spot better. "I want more!" You cry out loud, clasping his shoulders to survive the hellish pace he had set.

"More what, pretty girl?" He cocks a narcissistic eyebrow, looking down at your pathetic face.

And that's when he does it. Stretching his arm over his head, he grips the headboard of the shaking bed and hammers faster into you. And now he is everything you can see. Just like he wanted.

He knows the view of his abs curling as his hips buck forward drove you crazy every time. If it wasn't because you indeed love to see his chiseled torso, you would have already shut him up.

"More cock!" You quiver underneath him, completely in trance with the sight of a drip of sweat falling from his pecs and his toned bicep tensing at the effort. Veins popping to show off his strength. "More you." You moan in the low.

Side note: I also think Anakin has broken a shit ton of headboards, specially when he is gripping them with his mechanical hand.

He just can't measure his strength !!!!

Also he would totally be like: "want me to fix that?", MID FUCK AND PANTING LIKE THE SLUT HE IS

and yeah ofc he repairs what he broke

except for your pussy

[vidavalor]

Crowley actually says a barely-coded "I love you" to Aziraphale back in 2.03

In his proposal in the S2 finale, Crowley told us that he and Aziraphale know they're in love and have known it for damn ever but they pretend they're not a couple. This, by default, means that they've not specifically said the words "I love you" before, by Crowley's own admission. They've said I love you in their own little language and we've watched it before. It's little demonic miracle of my own. It's don't go unscrewing the cap. It's just a little bit of a good person and just enough of a bastard to be worth knowing... But what Crowley says in the S2 finale is that they've never-- ever-- said in 6,000 years is just I love you in those normal people, human words. It has always been too dangerous for too many reasons to count so they have euphemisms for it and whole conversations around it and have made that be enough. Why do I bring this up? Because Crowley found a middle ground between the words and their coded language with one another in S2 and it's flying under the radar.

So you know that scene when Muriel has shown up and interrupts Crowley and Aziraphale talking in the back room? The one where while Crowley is speaking, Aziraphale suddenly looks like he's about to pass out with sheer want? Yes, our angel always looks at Crowley like he hung the damn moon (which he did but lol...) but this scene is different. This scene is like... someone get Aziraphale a chair and a glass a water because he is pupils-dilated, audibly breathing, and eyeing up Crowley with naked want. More than the lust? He looks happy. He looks delighted. You can basically hear his heart race from that look on his face. Why here? Yes, Crowley looks hot. Yes, he's in profile in a way that is a visual parallel to Before the Beginning (which was an inspired choice for this scene.) Yes, he's here with a Plan and taking charge of the Muriel situation and swaying his hips a bit while he speaks. It's not any of that. Those are nice bonuses. Aziraphale likes them. He gets them all the time. It's what Crowley said in this moment. To Aziraphale. Through what he said to Muriel.

Crowley cracks a dry, kinda dark joke that is meant for an audience of one: just Aziraphale. He knows Muriel won't get it. Since Muriel is cosplaying as what they think is a human Inspector Constable and they are here to verify the miracle Aziraphale has told Heaven and so are monitoring them, Crowley quips that Muriel is here to spy on them (since they, well, are, actually) and that he knows that many human police officers like to make a bit of a hobby out of spying on "people in love."

People. In. Love.

In a one-two punch in the same sentence, Crowley called him and Aziraphale queer humans and he called what they have love, using the actual word *aloud* for the first time in 6,000 years. He said he loved Aziraphale in front of an angel of Heaven in a little coded joke but this time, using the coded bit to say the real thing for the first time.

Then, just to hammer it all home and make sure that Aziraphale really knows it was very much intentional, Crowley says 'love' again in the next sentence. He starts going on about how Muriel can come to him anytime with any questions about love and he's happy to assist with their understanding of human love with all of his implied vast, vast years of experience with the subject and how he'll be here to answer their questions, in the bookshop, while Aziraphale drives his car to Edinburgh.

Go back and tell Heaven I'm here, Inspector Constable, I don't give a fuck anymore. *We* don't give a fuck anymore. You go tell The Archangel Michael that I'm who they're going to get managing Angelic Embassy X aka The Bookshop until Aziraphale gets back-- yep, me, former Demon of Hell. The Boyfriend in the Dark Sunglasses. He's asked me to, which is his way of saying he wants to stop hiding and asking me not to sneak out to my car in the middle of the night which hallefuckinglujah, Inspector Constable... Go tell Their Beatitudes that we ravish each other all over the bookshop. You won't even be lying. As Maggie'll put it later in the season: I'm done being afraid all the time. I love him. We're in love. There's your hot intel.

Aziraphale:

Aziraphale: Inspector Constable, be a dear and spray me down with all 700 of our fire extinguishers, will you?

[lonelyquail]

oh goodness! hi vee! i know its a little bit late, but can I ask for 6 on your oc ask game?

wowie zowie hi person who Definitely isnt just me on anon!!! i absolutely can thank you for asking!!!

so thats my guy chucklefuck and ive been looping this song for a WHILE so its their song now!!

i know for a fact i have Not gotten the chance to talk about chucklefuck here so im gonna be using this as an excuse to talk about them a bunch! basically theyre. best adapted to be a ttrpg campaign character, for one. but theyre a spy bot created by The Main Oppressive Regime to mislead their peers, as well as spy on them and report back. so basically if i played them id be rolling bluff checks every 5 seconds because of their other main gimmick: they think theyre the funniest bitch in the world. see to avoid suspicion they elect to play under the "beep boop, i am a robot" facade. this is Incredibly fucking funny to them bc. yknow the gags where a robot character will do some faux pas or embarrass another character in the party but its not like they Meant to they didnt know any better. well. yeah this guy definitely knew better and they are Living It Up.

im not gonna explain their whole Deal but i will say that i think they Will eventually get found out bc they cant bullshit forever and thats where i think the song fits bc they kindaaa. only exist to be in service of CapitalismCorp Incorporated and havent had enough freedom ever to really think of this as a Bad thing really. theyve got this Delight at watching the world burn and they know that includes them but they sure don't care! why would they?

[erzva]

his favorite ways to make you cum

a/n: ok i’ve realized that you can actually just insert any character of your liking while reading this bc it’s not specific to the character i had in mind..

eating you out

his favorite sexual activity for sure. not only does he love giving you head and seeing you feel good because of him but it’s relaxing to him. when he’s tired or sad he’ll always crawl in between your legs and start kissing and licking and nibbling on your stomach around your bellybutton and your thighs, coating them in love bites.

it’s also extremely arousing to him. he loves hearing all the noises you make, and them getting louder and messier and more embarrassing (as you claim) the closer you get to your orgasm. he can’t help but grind his hips into the mattress, moaning into your pussy, the added vibrations making you groan.

he is always so focused on the task and gets lost in your big pussy lips lapping and sucking at them and your puffy clit as if it’s his favorite hobby (it is). his arms are usually always both snaked around your lower half to keep you in place and so he has easier access and can shove his tongue as deep into your cunt as possible. except for if he’s fingering you additionally to licking your clit ofc. then his right hand will be buried deep in your pussy, desperately grazing your g-spot while sucking on your clit until you start rutting your hips against his face and your grip on his hair becomes tighter. oh how he loves it when you tug on his hair while you’re chanting his name when you’re cumming..

handjobs

he likes them almost as much as you do. he especially loves how you go about asking for one though. he loves it when you sit in his lap, crossing your legs behind his back and hugging him tight for a few minutes, with your head buried in his neck, kissing it and sucking light bruises into his skin before your kisses and sucks move up to his ear and earlobe. and then his jawline. until your kisses finally reach his lips and he’s too impatient to wait for you any longer so he just immediately licks into your mouth making both of you moan at the feeling of each others soft tongues. you keep moaning and trying to keep up with his aggressive licks but your mind wasn’t ready for it yet so you had to pull back. he chuckled. he knew what question was about to escape your lips. you stayed close to him and started kissing your way back to his neck and ear, nuzzling into him. “can you give me a handjob?” you’d ask sucking on the skin below his ear. you couldn’t see but he was smirking. he chuckled lightly. as if he could ever deny you that.

he picked you up in one swift motion and walked to the bedroom with you throwing you on the bed as soon as you reached it. oh how he loved the look on your face every time he does this. you looked about ready to jump him.

“pants off, pretty.” he would demand before positioning himself behind you and starting to kiss your neck and jawline. he would start slow and grope you aggressively while sucking bruises into your skin. the foreplay was part of why you loved handjobs so much. you just couldn’t get enough of his hands on your body.

by the time he would finally bring his hand down to your clit, after whining and silently begging him to touch you already, you were already wet from the foddling and kissing.

and all the praise and dirty talk that was possible in this position was heavenly. his lips were practically sealed to your ear constantly praising you and grunting and moaning in your ear because he knows how much you love it and how much it gets you off.

he loved holding you down with his other arm whenever you’d start chanting his name and wiggling, indicating that you were close.

mating press

missionary is the basic sex position for a reason. it was just so easy to handle someone this way. the look on your face and the sounds you made every time he’d put your legs up on his shoulder and start drilling into you was so arousing to him.

he didn’t care about how “messy and chaotic and embarrassing” you thought you sounded. that’s part of what was so arousing. the fact that he’s making you feel so good you don’t know what to say or what sound to make and don’t even try to tame yourself and instead just let the sounds escape your lips was so hot to him, he wants to cum right then and there.

dickriding

oh how he loved making you cum when you were the one on top. he loved bottoming or subbing and seeing you take control of him and the situation. but he also likes messing with you and he would do anything to hear all the messy embarrassing sounds you make when he drills up into you from below.

the way your eyes would roll back and your moans would become more animalistic at the sudden fast pace was one of his favorite sights to see.

and when it became too much for you and you couldn’t hold yourself up anymore so you’d collapse on top of him and put your arms around him, he would smirk to himself. being able to hold you tight while ramming up into you as fast as possible to make both of you cum while hearing you moan and breathe into his ear was too arousing.

this was originally supposed to be about jason todd (no one’s surprised) but i can also see: hal jordan, dick grayson, roy harper, wally west, toji, nanami, gojo, sae, aiku, karasu, otoya, katakuri, sanji, zoro, shanks, semi eita, atsumu, iwaizumi, tartaglia/childe, itto, laxus dreyar, sting eucliffe, gray, jellal, gajeel, natsu

…

[miniwheat77]

Army Green. (Ghost x Virgin!Reader.)

!CW! NSFW, Smut, Age gap (Reader is 20, Simon is 32), unprotected sex, p in v sex, virginity loss, animal getting hurt, Simon in distress, PLEASE READ THE WARNINGS BEFORE YOU READ. (Sorry if I missed any.)

It’s a sunny day, you’ve spent most of the day outside.

Mostly working on your yard, but you didn’t always mind. It did get rough sometimes of course, living alone and doing all of the work constantly. You lived in a pretty small house. It had a smaller yard, gravel driveway. It was fenced in. It was nice.

Sometimes the work piled up, getting busy, trying to pull yourself out of a funk. Especially because doing 100% of the work was new to you. Since you’d just gotten out of a serious relationship. It was a tough situation. You’d moved out with your boyfriend at 18. You were together for the better part of your teenage years, your first real boyfriend, the only serious boyfriend you’d ever had.

The break up was miserable and rough. The fights were bad, the messages were vulgar and laced with venom. It was a really rough breakup that left you damaged.

You went from a two person household, to one. Having to work more to pay the bills, having to pick up the rest of the household chores and somehow still stay sane. It was tough, but you managed. You had a few friends that helped you stay busy, and you were thankful for that.

You were sitting on your couch, it was the weekend and you didn’t want to spend all of it doing yard work. Your friends were supposed to be coming over and you were excited to spend the night with them. Just as you finished cleaning up your house, you heard a knock on your door. Knowing that it was your friends, you yelled for them to come inside. They walked in with all kinds of drinks and snacks in their hands, ready to have a good night.

“Dude, your neighbor is super weird.” One of them mumbles. “He wears a mask with like.. a skull face on it.” She mumbles. “Yeah?” You laugh. “Why does that make him weird?” You question her. “That’s all he ever wears. I’ve never seen him in anything else.”

“So what. Maybe he doesn’t want people seeing his face.” You shrug. “Whatever. I think it’s weird.” She shrugs. “Maybe he’s like.. super hot and doesn’t want people to know.” Your other friend smiles. “Maybe. Walk over there and find out for me.” You nudge her. Earning a laugh from them. “You’ve never met him?” She asks. You shake your head. “No. I’ve actually never even seen him, I didn’t know he wore a skull mask.” You shrug. They laugh. Eventually the subject changes.

Later that night as you’re sitting on the couch, you’re all about to go to bed. “What if your neighbor is super hot?” She asks again. “There’s tons of hot people, be specific.” You toss a piece of popcorn at her. “I mean.. what if he’s like super hot. You should talk to him.” She shrugs. “Um. I’m pretty sure he’s like 30.” The other one laughs. “Oh.. well damn.” She sighs. “What’s wrong with him being 30? Why would that stop me?” You ask. They both look at you like you’ve just called them the worst names known to mankind. “Jesus! You whore!” They laugh. “I’m serious! What’s wrong with that.” You giggle. “Just.. not your own age?”

“Maybe that’s why guys suck so bad. Maybe we need to branch out a bit. Go for the weird old guys that wear skull masks.” She wiggles her eyebrows at you. “Maybe.” You smirk. “Nah, I’m not trying anything with anyone. Maybe not ever after Wesley.” You roll your eyes. “Oh please, Wesley wouldn’t see a good girl if he got hit by one.”

“Clearly.” The other rolls her eyes. “It’s just because I wasn’t ready.” You mumble. Earning glances for them. “Ready for what?”

“Sex.” They perk up. “What? You were together for that long and never had sex?”

“No?”

“Why not?”

“Because.. I’ve never had sex before? And wasn’t ready?” You laugh awkwardly. They’re both staring at you in confusion. “Well shit. We didn’t know that.” They laugh. “Damn. Whole new perspective.” They laugh softly.

“Yeah, my poor ‘old’ neighbor probably heard those nasty fights, no way he’d fuck around with a girl like me.” You laugh. “Never know until you try.”

You roll your eyes. “Goodnight you two.” You laugh, walking back into your bedroom. You settle into your bed, eyes heavy as you fade into a deep sleep.

You hear whining outside, it startles you awake.

You look at your phone, it’s early. The sun has just barely risen, it’s still mostly dark. Cascades of blue painting the sky. You sit up, rubbing your eyes as you hear it again. It sounds like a dog in pain.

You climb out of bed, walking out to your living room. You can still hear it faintly. Your friends are still asleep on the couch and you open your front door quietly, peeking outside. It’s cold, chills creep up your legs and arms immediately, maybe a bad time to sleep in a tank top and shorts. You step outside, covering yourself with your arms as you look around for the sound you’re hearing. You notice the noise is louder now, along with rattling. You spot a dog, it’s got it’s paw stuck in your fence. Fairly close to your bedroom, that’s why you heard it.

“Shit-“ you mumble. You jog lightly to get to her. It’s your neighbors dog, you assume the one with the skull mask. “Hey, stop moving.” You mumble as she tugs to free her paw. You hear a door open and close behind you, noticing it’s your neighbor.

And he doesn’t have on a skull mask.

“Shite, I’m sorry. I didn’t realize she’d gotten out.” He says as he jogs to you. You can hear the gravel giving away under his feet. “It’s alright. No worries.” You mumble. You unwrap her paw. “It’s alright, I’ve got you.” You mumble. As she whines more. Once you free her paw, she frantically licks at it. “Let me see it darling.” You breathe, reaching your hand out. To your surprise she lies down, rolling onto her back so that you could get a good look at her. Your neighbor crouches down to check the rest of her as you look at her paw. “Just a scratch.” You smile. “Yeah, she’s a bit over dramatic.” The man laughs. “I heard her whining.” You laugh. “Yeah. If I accidentally bump her she’ll yelp like I’ve cut her leg off.” He smiles. His accent is thick and his voice is incredibly deep.

And your friends were absolutely right, he’s hot as hell.

“I don’t think we’ve ever met.” You stand up. He stands up with you, reaching his hand out. “I’m Simon.” You send him a smile. “Y/N.” He smiles. “Ah, and this is my dramatic princess Paisley.” He looks down at her. “Nothing wrong with a little bit of embellishment, gets the attention you need.” You smile down at her. He laughs at this. “Anyways, sorry for waking you, love.” You feel your cheeks warm at his pet name. “No worries, I’m just glad she’s alright.”

“Cmon, back to bed with you.” He nods his head at the dog and she walks with him back to their house. You make your way back to your door, stepping inside. You forget that your friends are there and they stir awake with the sound of your door closing. “Y/N? What are you doing?”

“My neighbors dog got stuck in the fence.”

“Is it okay?”

“Yeah she’s fine. But you were right. He’s hot as fuck.” You laugh. Walking passed them, going back into your room.

—

It’s been a while since you’ve had a day off, picking up extra shifts and doing more and more work so that you could afford your house. It was getting rough. You didn’t see much of your neighbor, aside from passing. He did always wear a skull mask which you found weird. Until you were up early and seen him leaving one day.

He was wearing full military attire, Paisley had on a vest and he was telling her to get into the back of his truck, that’s when it clicked.

His accent, why he was always gone, his large build, the mask. It all made sense now.

Your next day off, you’re sitting in a coffee shop with your friends and they’re making fun of you. It’s a gathering, an every once in a while coincidence that all of you had the same day off. “So what’s going on with everyone else? I feel like I’ve been talking about myself this entire time.”

“Not much.” Everyone mumbles.

“Oh, Y/N’s neighbor is smoking hot, I’m waiting for her to announce that she has a controversially older boyfriend.”

The girl next to you is loud when she says it, earning an elbow to the side from you. “Ohhhh. Tell us more?”

You roll your eyes. “I’ve talked to him once, his dog got her paw stuck in my fence, there’s nothing weird about that. Although he is very, very attractive.”

“It’s weird, he always wears a skull mask.”

“Oh!” You sit up. “I know why. I saw him leaving the other morning wearing full military gear. That explains the accent and everything.” You laugh.

“Accent?”

“Oh.. I forgot to say that? He’s British.”

Their mouths drop, and you can’t help but blush at your spaced information.

“No way, Y/N. If you don’t have sex with that man right now..” she laughs. “Oh god, I am not ready for that. I just got out of a shitty relationship.” You laugh. “Well.. just out of curiosity.” She sips her from her cup. “Just how much thinking have you done about Wesley since you talked to your neighbor?” She teases. You roll your eyes which makes them all laugh. “See!”

“Christ. You guys are ridiculous. I have to go do yard work.” You roll your eyes.

“Look sexy!” She calls out as you exit the building, your cheeks are on fire.

When you arrive home, you look up at the sky, noticing the brewing storm. Maybe today was a bad day for yard work after all. Just as you make your way inside, the rain starts to come down. You sit down on your couch, deciding to watch a show instead.

You lose track of time. You could hear the rain pouring down outside. Thunder making you jump slightly.

A knock at your door has you whipping around. You stand up, slowly making your way up to your door. You open it slightly, noticing your neighbor. He’s soaking wet. “Uh.. hi. Sorry to bother you so late. I just.. have you seen Paisley?” He asks. “Uh.. no I haven’t. Is something wrong?” You ask, opening the door up wider. “I let her out earlier and she never came back in. I think she ran off.” He sighs. “I’ve been looking everywhere and I can’t find her.”

“Let me put some shoes on, I can help.”

“Oh, you don’t have to do that.” He sighs. “No, she’s a good girl, I wouldn’t want something bad happening to her.” You smile. Once you’ve slid on shoes and a jacket, you’re stepping out into the rain.

Ghost notices your tattered old skate shoes immediately. If you’ve got a boyfriend, why isn’t he taking care of you? Ghost knows he’s seen a guy around.

Behind your houses was a huge patch of trees, that’s where the both of you decide to look first. You’re calling out for her, walking along. You part ways when you get into the trees. Calling out for her. You don’t see anything and it’s getting darker as you walk along.

Ghost is somewhere further away by now, he’s calling for her, but she isn’t coming. He stops with a sigh. “Christ, where the fuck are you, fucking dog.” He growls.

“Simon!” He hears you yell. “Y/N?”

“I found her!” You call to him. He quickly makes his way over to you, seeing you’ve got a hand on her collar. “Ugh, damn dog.” He breathes. “Home now!” He says sternly, Paisley bolts for his house immediately. “Sorry. You didn’t have to come out here.” He laughs. “I don’t mind the rain.” You laugh, walking towards your houses with him. “Not real good shoes for bad weather.” He laughs. “Oh psh these? They’re fine.” You wave your hand. “What, your boyfriend doesn’t spoil you?” He laughs. “Oh god, I don’t have a boyfriend.” You laugh. “What? Who was that guy than?”

“Uh.. well. He WAS my boyfriend. But.. it’s a long story.”

“Oh. I’m sorry, I didn’t realize.” He laughs awkwardly. “Oh it’s fine.”

“I’ve got a fire going in my house, if you wanted to dry your clothes out. You could talk about it if you want.” He shrugs. “Uhh. Sure.” You shrug. You follow him up to his back door, he opens the door up for you. You step inside and he shows you to his living room, where he had a pretty wood stove going. Lined with bricks. “Give me a moment.” His house was really nice. You wait before sitting down, not wanting to get his couch wet. “Here.” He passes you a towel and a shirt. “It’s an old shirt of mine.” He nods. “Thank you.” You smile. It’s Army Green.

He shows you to his bathroom and you change quickly, making your way back to his living room. You notice that he’s put your shoes on the tile in front of the fire to dry them out. You can’t help but smile.

He brings out tea and sets it down on his coffee table, sitting in the chair across from you. You pull his shirt down over your knees, making sure you’re covering yourself. Your panties had gotten wet and you had to take them off too. “Why did you guys break up if you don’t mind me asking?” He asks. “Uhh.” You laugh. “I found out that he was talking to a couple other girls. Meeting up with them and.. yeah.” You look down. “I’m sorry to hear that.” He breathes. You smile, looking up at him. He’s no longer wearing his mask.

“Honestly? I thought it would hurt more.” You shrug. “We.. I mean we’d been together for a long time but our relationship wasn’t serious. I didn’t really have any feelings towards the end, not after all of the things he said to me.” Ghost tilts his head. He’s curious.

“Uh..” you shift awkwardly. “I.. this is probably too much information but.. we never.. slept together. I just wasn’t into it, and he hated that I wasn’t. He said a lot of gross things to me.” You shrug. He nods his head. “How old are you?” He asks. “I’m 20.”

“How old was he?” He asks. “21.”

He smiles. “There’s your problem darling.” He laughs. “He’s just.. stupid and immature. I was at that age too. You’re too young to be worried about all of that anyways.”

You smile. “How old are you?” You ask. “32.” Your eyes widen. “Seriously?”

“Yeah, m’ an old man.” He laughs. “You do not look 32.” You smile. “I’ll take that as a compliment.” He winks.

“You need new shoes.” He nods to them. “Uhhh. Yeah. That has to wait.” You laugh. “Hm?”

“I can barely afford my house, those shoes will just have to do. They’ve done me good.” You smile. You move to stand in front of the fire, crouching to pet Paisley who’s laying in front of it. Ghost stands up too. “How about we check you out, make sure you didn’t get into something.” He breathes, rolling paisley over onto her back. He runs his hands along her fur. Feeling that she’s fine as he stands back up. He towers over you, and now you really feel how close you are to him. “I can help you get new ones.” He nods. “No.. that’s not your job.” You shake your head.

“Course not, you could work for it.” He smiles.

Your eyes widen. “Not- Jesus. Not like that.” He laughs. “Oh good.” You breathe out. “Had me worried for a second.” You laugh. “Got a dirty mind.” he rolls his eyes. “I mean.. if you babysit for me when I’m gone.” He nods. “I usually have her boarded at the base but.. they keep her cooped up a lot there.” He looks down at her. “Simon, I don’t mind watching Paisley. You don’t have to get me anything. She’s a good girl, I don’t mind.” You smile. He nods his head. “Thank you Y/N.” He smiles. “Of course.”

You’re warm from the fire, spinning around to warm your front. He does the same. Looking at the dancing flames through the glass. “Do you have a wife or anything?” You ask. “No.” He laughs. “My job isn’t good for relationships.” You nod your head. “Fair.” He laughs. “Why?” He asks. “I was just curious.” You say nervously. His smile is flirty, and you’re worried.

Not because he intimidates you.

You’re worried by how much you like it.

“You sure?” He looks at you, making you turn your head to look at him. “Mhm.” You smile. He takes a step toward you, making you step back.

Back hitting the wall with a gasp. “Might be overstepping here..” he laughs. “But he was stupid to fumble a girl like you.” He breathes. He’s toying with the shirt you’re wearing. You take in a shaky breath, looking up at him. “Simon.” You start. He tilts your chin to make you look him in the eyes, leaning into you. “Can I kiss you?” He asks. You part your lips, not saying a word. After a second, you nod your head.

He closes the gap right away, kissing you hard.

Your friends were going to freak when you told them.

You feel his fingertips gliding up your thigh and you gasp into his lips as he glides them over your bare opening. “Ah- Simon wait!” You breathe. Pushing him back slightly. “I.. I-“ you’re stuttering, not sure what to say. “I’m sorry, maybe I misunderstood..” he breathes. “No- no it’s not that. I.. I liked it. I just.. I’ve never done this before.” You breath, looking up at him. Your cheeks are burning, because his fingertips touching you is the first time a man has ever touched you like that. And this is only the second time you’ve ever interacted with him. “It’s alright.. I know you haven’t known me long.” He laughs. “No.. I don’t mean..” you clench your eyes closed. “I’ve never had sex before.” You sigh. He raises his eyebrows in surprise. “Oh.. well. I’m sorry I pushed you so hard, I had no idea.” He steps back.

“You didn’t. I.. I liked it.” You swallow hard.

He crosses his arms. “Have you ever been touched.. at all?” He asks. You shake your head. “Have you.. done anything at all? Like.. touched yourself?” You chew on your lip nervously. Shaking your head again. “I’ve tried but.. it’s.. weird.” You bring your hands behind your back. “It’s not weird, not if you’re doing it right.” He looks at you. The room is dark, the lights are dim and the fire illuminates it slightly.

“D-do you think you could show me? W-what it feels like I mean…” You look up at him.

“Yeah, of course. Cmere.” He tilts his head, reaching his hand out for you to take. He walks around his couch, pulling you with him. “Go ahead.” You sit down. “Lay back sweetheart.” He nods. You’re nervous as you lay back. “If you don’t like what I’m doing, if you want me to stop at all, you tell me okay?” He says. “Of course.” You nod.

He pushes the Army Green shirt up over your hips, you’re bare. Wearing nothing underneath.

He glides his hand up your thighs, feeling you shiver as he does. His fingertips gliding over your exposed flesh, rubbing over your opening. When he touches your clit, you flinch away from him. He forgets that you’re untouched.

Sensitive, easily stimulated. He chuckles. “Relax. You’re tense.” He breathes. He moves himself over you, pressing his thigh right up against your opening, hearing a gasp from your lips. He lowers himself on top of you, pressing his lips to yours again. You kiss him sloppily, cheeks flushed, your tummy feels warm as he rocks his thigh into you. You whine into his lips, raising your hips to meet him.

He pulls away from you, kissing your chin and down your neck, pushing the shirt up and over your chest. Exposing every part of you to him. The first man to ever see such sensitive parts of you. He attaches his lips to your nipple, hearing you gasp. You lift your hips into him, wanting more. But he takes his time with you. You’ve never felt this way, never been so turned on before. He finishes showing your nipples attention and moves lower, leaving a trail of kisses down your stomach. You’re nervous as he moves himself between your legs. He looks up at you, leaving a kiss to your thigh. One kiss to your swollen clit and you were done.

You let your head fall back, he pushes his hands up his couch, entwining his fingers with yours as he spreads your folds with his tongue. It takes just a few minutes and you’re crying his name out in the perfect symphony. Your stomach is moving with the way you’re panting and you can barely hold still. He moves his hands away from yours, holding your hips down. Sucking and lapping at your clit, pushing his tongue into you slightly. It’s an unfamiliar feeling. You can feel something building. “S-Simon. Feels funny.” You whimper, lifting yourself up to rest on your elbows. Watching him eat your pussy like it’s the sweetest ice cream he’s ever had.

You feel his fingertips gliding over your entrance, and you gasp when he pushes one inside of you. Curling it right into your spongy spot. You can’t hold yourself together, especially not when he adds another finger, scissoring them. A cry leaves your lips, it’s a desperate moan. Something that tells him that you’re just about to cum. You can’t say anything which is what he wants, he’s cornering you right into pure bliss, leaving you nowhere to go. It feels like your body bursts into flames when he works your pussy to an orgasm. The first of many that he’s going to give you. Your eyes are full of tears and clench shut as he works you through your orgasm. Until you’re sensitive and squirming. He finally pulls away from you, moving himself above you again, kissing you, letting you taste yourself on him. You’re breathing hard when you pull away, looking up at him. Like he’s just killed an army in your honor.

“How do you feel?” He asks. Your lips are parted, you want to say something but you can’t. He chuckles at your trance-like state. “It’s alright. I know it’s a lot.” He smiles, pulling the shirt down to cover you. Pulling you up until you’re sitting up to look at him. “I feel good.” You finally say, cheeks burning. “Good, I hope so.”

Your eyes are lost in him and he says something but you don’t even hear it.

He waves in front of your eyes, chuckling when you flinch away. Shaking yourself out of your thoughts. “You alright, space cadet? I wasn’t too much was I?” He laughs. “No.. no.” You giggle, “sorry.” You blush. “First time is always intense. I get it.” He smiles. Leaning into you. “Can’t wait to see how spacey you’ll be when I fuck that pussy for the first time.”

You swallow hard, eyes clenching shut. You’re quiet.

A laugh is what makes you open your eyes. “I’m only kidding. Relax.” He stands up. “Unless you want me to of course.” He winks at you.

“I know you have work tomorrow, I’m keeping you up.” He laughs. “Let’s get these shoes on you and I’ll walk you home.” He smiles. He kneels down onto one knee, reaching out for one of your shoes. It’s dry and warm.

You’re surprised at first.

He’s actually putting shoes on you, like you’re some kind of princess.

He helps you up, throwing one of his jackets over you and holding your clothes. The storm has passed now, it’s only dark. When you reach your front porch, he passes you your clothes. “I can go change and give you your shirt back.” You stutter when you say. He’s making you nervous. “Don’t worry about it. Keep it. It looks better on you anyways.” He smiles. You blush, looking down. “Thank you, for helping me find Paisley.”

“Of course. I don’t mind at all.” You smile. “Um.. t-thank you for um..”

“You don’t have to thank me for that.” He laughs. “Sorry..” you blush. “It’s alright. Get some sleep.” He smiles.

You smile. “Goodnight Simon.”

“Goodnight Y/N.” He nods. “Oh.. wait. Can I have your phone number? Since you’re willing to watch Paisley for me.” He playing his eagerness off. “Yeah of course.” You smile, walking toward your couch where you had left your phone. You pick it up and walk back to the door where he was waiting, passing it to him. He types his phone number into your phone and sends himself a text with it. “Awesome. Thank you Y/N. Goodnight now.” He smiles.

“Goodnight Simon.”

—

“You seem to be in a good mood LT.” Soap smiles.

“Something going on at home?” He smirks.

Ghost rolls his eyes. “Not now Soap.” He rolls his eyes.

“Who’s the girl, you’ve been checking your phone every 10 minutes.” He crosses his arms. Ghost sighs. “It’s my neighbor. I asked if she’d watch my dog. Stop being weird.” He shoves passed Soap. “Aw Cmon. I’m your friend.” Soap scoffs. “I tell you everything. I’ve never seen you act this way before.”

Ghost sighs. “Alright fine. Yeah, something happened between us and I don’t know what to think of it. But she’s kind’ve way out of my league.” He mumbles. “What do you mean by that?”

“She’s 20.”

Soaps eyes widen. “Jesus. A tad bit young don’t you think.” Ghost looks at him unimpressed. “She’s been my neighbor for a while, I thought she was older.” He shrugs. Soap laughs. “Nah, women just mature way before men do.” Ghost snorts. “Yeah. Well.. what I did with her last night I can’t really come back from.” He laughs. “Did you sleep with her?” Simon shakes his head. “No.. but. I don’t want to talk about it. Paisley got her paw stuck in her fence a few weeks back and I went out to check on her and she was helping her. Last night, Paisley didn’t come back when I let her out, so I stopped by and asked her if she’d seen her and she said no, but offered to help me look for her.” He shrugs. “So.. if you did stuff with her, why didn’t you have sex with her?” Ghost flinches. “She.. uh.” He laughs nervously. “She’s a Virgin.”

Soap’s eyes are wide. “Christ. You’ve got yourself into quite the situation Ghost.” He laughs. “Yeah. You’ll have to see her.” He mumbles. “Take me with you when you drop Paisley off for a mission sometime.” Soap crosses his arms. Simon laughs. “Alright. If you insist Johnny.”

“I’m good at reading people, I’ll tell you if she’s good for you.”

“She’s not good for me, I haven’t felt like this in forever.” Soap raises his eyebrows, a smug look on his face. “That means she’s good for you. You’re supposed to feel happiness.” He rolls his eyes. Ghost laughs. “It’s bad for a man like me. I’ve lost everyone, makes me vulnerable.” He mumbles. “So don’t lose this one.” Soap pats his shoulder.

Ghost shakes his head. “It’s never been in my control. But.. me being vulnerable, means that I can be very dangerous. So let’s hope this goes alright.”

—

“You WHAT?” She yells from the other end of the phone, you can hear her coughing violently on her coffee. “Uh.. yeah.”

“Did you have sex?” She asks. “What? No. He just.. he. We didn’t have sex.” You blush. “What’s gotten into you?” She squeals, making you laugh. “I don’t know. I guess I just really like him.” You bite your lip. “Damn. Who would’ve guessed. A 32 year old in the military is your type.” She laughs. “I know right. I don’t know. He’s.. ugh.” You sigh. “I’ve talked to him twice ever, and he’s already been so much fucking nicer to me than Wesley. I just.. don’t even know what to say.” You laugh. “That’s how you’re supposed to be treated Y/N.” She laughs. “Maybe he’ll be really good for you. Maybe you’ll get married and have a bunch of kids.” She snorts. You roll your eyes. “Whatever. I have to get back to work.” You mumble. “We’re not done talking about this. You’re telling me every detail later.” She mumbles through the phone, making you laugh. “We’ll see.” You say before hanging up.

You bite your lip.

You can’t stop thinking about the night before. What he said to you.

“Can’t wait to see how spacey you’ll be when I fuck that pussy for the first time.”

Your stomach turns and you feel yourself getting wet just from the thought of it. You needed to get your mind off of this. You stand up, heading outside to find something to do.

You’re sure you could find some yard work of some kind to do.

You look around your house, noticing the patch of grass by your driveway was mixing with gravel. You head back inside, changing into more comfortable clothes to do this task. Not paying any mind to whos eyes may be on you. Simon was meant to be at work anyways. You get a rake, raking the gravel back into it’s dedicated location. You needed to plant more grass seed, maybe line it with some spare bricks to keep the gravel away from it. It’d keep Paisley away from the fence to avoid getting her paw stuck. Simon really needed to fence his yard in to keep her inside. Although she was a pretty large dog, she’d probably just jump over it. You’re carrying bricks when Simon pulls up, Soap is in his passenger seat. “Is that her?” Soap asks. “Oh.. yeah. I guess so. I thought she was supposed to work today.” He mumbles. “Guess I’ll get to meet her sooner than later.” He smiles. You’ve got your ear buds in, not paying any attention. “We’re just checking on Paisley, get your head out of the gutter.” Ghost mumbles. As soon as Simon opens the door, Paisley bolts to your house. “Oh Jesus Christ, seriously!” He mumbles. Paisley attacking you with kisses, jumping on you catches you off guard.

“Oh my gosh!” You laugh. Turning your face to avoid her sloppy kisses. Simon and Soap approach, and you’re petting Paisley. “Hi darling, I’m glad to see you’re okay after your great escape.” You smile. When you glance up and see Simon walking toward you, another man behind him. “Thought you were supposed to be at work?” Simon asks.

“Ah, a bunch of offices flooded last night in the storm, mine included. So I’ve got a couple weeks off while they renovate.” You smile. “Ah, paid I hope?” He laughs. “Oh yeah. I would be out looking for another job otherwise.” You laugh. “That’s good though, a nice break.”

Ghost looks at Soap. “We just stopped by to check on Paisley. This is Soap by the way.” He nods. You look confused. “Did you say Soap?” You ask, looking at him. Soap laughs. “My name is Johnny, but you can call me Soap.” He nods, reaching his hand out. You take it, shaking his hand. Ghost feels jealousy boiling through him when he touches you. He doesn’t like that. “Civilians don’t get the nickname, Ghost.” Soap judges him. You tilt your head. “Ghost?” You smile, crossing your arms. “Nice. A weird duo but I like it.” You laugh. “I like the Mohawk too, don’t see that haircut much anymore.” You nod. “Thanks.” He smiles. “Oh no, don’t go giving the bloke a big head.” Simon rolls his eyes. “Whatever, I’m gonna go find Paisley. She’s nicer than you.” Soap rolls his eyes. “Nice meeting you, lass.” He smiles. “Nice meeting you too.” You wave.

Simon lingers behind. “Why’re you not relaxing?” He laughs. You blush, looking down. “Can’t sit down for too long or I’ll think about what you said last night.” You laugh. “Ah. That makes sense.” He laughs. “I can give you something else to think about if you want.” He chuckles. “Jesus Christ.” You roll your eyes.

“I think Soap is getting impatient, Ghost.” You call him by his nickname and he freezes up. He laughs. “Don’t call me that. Not unless you’re moaning it.” He turns to walk away from you, hearing you laugh. Mumbling a ‘Jesus’ under your breath.

—

As he works, training new recruits, helping out anywhere he can, preparing for missions. He thinks about you.

The jealousy he felt earlier with Soap, it worries him. He’s getting too close to you. He knows it. The last time he did this, he got hurt. Irreversible damage to him that he still suffers from. He needs to stay away from you, but he fears it’s too late.

You’re so kind. Naive in a good way almost.

You’re so nice, so sweet. Even Paisley likes you.

He can’t focus on work without thinking about you. Zoning out as he loads everything up. The way that you sounded with his face buried between your thighs, he thinks about how you’ll sound when he-

He groans out in frustration, earning a couple glances. He throws down the wrench he’s holding, cursing under his breath.

Soap and Captain Price exchange a worried glance as he storms off.

Soap can’t help but laugh when he’s gone, the door shut and latched behind him. “Something going on with him?” Captain Price asks. “Yeah, a girl.” He snickers. “Ah. Trouble in paradise?”

“No.” He laughs. “She’s his neighbor and they aren’t.. anything just yet. But I guess he had an encounter with her.” Captain Price nods. “Women. They’ll do that to ya.” He laughs, picking up the box of ammo and walking to the back of the Humvee. “Tell me about it.” Johnny smiles, digging through the box of tools.

Captain Price sets down the box of ammo in the back of the vehicle, swiping his hands off together to get the dust off of them. “Suppose I’ll go talk to ‘im.” Captain Price mutters as he makes his way into the office that Simon had gone into. He opens the door, seeing him sitting at the desk. He’s got a water bottle in front of him and it’s already almost gone. “You alright Simon?” Price sits down in the chair across from him. Hearing Simon sigh. “M’fine Price.” He mumbles. “Johnny told me a bit about your troubles.” He smiles. Ghost rolls his eyes at this. “It’s alright, maybe we can talk about it. Maybe it’ll make you feel better.” He shrugs. “What, is this a therapy session?” He jokes. Earning a snort from his Captain. “I’m serious, I’m a wise old man with a lot of advice.” He smiles, setting his hands in his lap. The dad energy that Price gives off warms Simon’s heart in a way. “I don’t know. She’s my neighbor and she’s a lot younger than me.” He sighs. “I just think I’m going to end up getting myself into something dumb with her.”

“Well.. what’s she like?”

“I.. I mean she’s nice. She lives on her own. She.. said that she just got out of a relationship.” He sighs. “Oh? Did she say why?”

“He cheated on her because she wasn’t ready to… take the next step with him.” Ghost shrugs. “Hm.. do you know anything about her background? How responsible she is?”

Ghost shakes his head. “Not really. I’ve only talked to her twice but the second time.. we were alone and things escalated.” He mumbles. “So.. you had sex?”

“No.” Ghost laughs. “She’s.. a Virgin.”

Captain Price’s eyes widen, and he shifts uncomfortably. “How old did you say she was?” He asks.

“20.”

Captain Price nods his head. “Hm.. well. What does she do in her spare time? Do you know?”

“She.. mostly just works so that she can pay her bills and hangs out with her friends.” He shrugs. “Do you know where she works?” Simon nods. “A bookkeeper for a construction company. She’s worked there since she was eighteen.” He nods.

“So.. she’s got a stable job.. can take care of herself.. she seems really mature.” Price shrugs. “I know it seems weird that she’s so young, but women mature a lot faster than men.” Captain Price nods. “You’re both consenting adults, who are responsible and can take care of yourselves.. I know you’re afraid of being hurt.” Captain Price sits up. “But you’ll never find your forever if you don’t put yourself out there and be vulnerable for others.” He smiles. Simon nods his head. “I know.”

“You’ll have to bring her around, let me judge her myself.” He smiles. Earning a snort from Simon. “Yeah, Johnny said the same thing.”

Price stands up, patting Simon on the shoulder as he goes to exit. “You’ll never know until you try, Simon. Don’t give up just yet.” He nods.

Simon sighs when the door closes behind him. What the hell was he getting himself into.

Later that day, Simon had come home. He didn’t see you and decided to leave everything be for now. Deciding to watch a show and drink a beer. Give himself time to relax, as bad as he wants to spend this time with you. He sighs, hearing Paisley scratching at the door, whining. She’s pacing back and fourth. “It’s probably just a Racoon. Down girl.” He breathes. But she doesn’t calm down. “Paisley, please. Give it a rest darling. I’ve just let you out.” He groans.

Nothing seems to calm her. He stands up, setting his beer down. He makes his way over to the kitchen to discard his empty beer bottles, setting them by his sink. He glances up through his kitchen window for a second, when something catches his attention.

You’re talking to a guy.

Not just any guy either, your ex-boyfriend. Ghost feels himself stiffen up, eyes narrowing as he looks outside the window. It seems as if you’re having a normal conversation with him. Ghost quickly moves to the back door, cracking it open and holding Paisley back as she tries to force her way outside. “Stop, sit.” He growls.

“Look.. I’m sorry okay? I miss you.” He hears him say it. Ghost can feel himself tensing up. "You need to leave. I won't ask you again." You breathe. "And if I don't?" He sighs. "What are you going to do hm? Nobody will come for you. You're just a stupid girl Y/N." He can hear him. He can hear you laugh. "Go." He hears you growl. "I'll tell the neighbor if you don't go." Simon's smile is too wide upon hearing that. "The neighbor? What, are you friends now?" He hears him scoff. "Come on, let's just talk baby, I can take your mind off things for a while."

"Simon!" You yell, Simon stands up immediately, ripping his door open and stepping outside. He can see that he's got a strong grip on your upper arm. When he sees Simon step down the few concrete stairs, he lets go. "Seriously?" He can hear him scoff. "She doesn't need you, go back inside and mind your own fucking business." He growls. Simon makes his way across his lawn, crossing the gravel of your driveway. "She is my business. She is now." He crosses his arms. "And if you want to leave here in one piece, I suggest you get back in your car and drive as far away as you can." He says it casually. "Yeah? Or else what?" He asks, making Simon raise his shirt up over his hip, not only does he expose his insanely fit body and v-line, but there's a pearl gripped pistol sitting in his waistband. A whistle leaves his lips and Paisley bursts out of his house, bolting to stand next to him at attention, staring your ex-boyfriend down. "Go." Simon nods.

He scoffs, shaking his head. "What, you fucking him?" He looks at you, teeth gritted behind his pursed lips, you glance at Simon before looking back to the ground, swallowing hard. "Some virgin huh?" He shakes his head. "This is fucking stupid, don't even know why I bothered with you." He growls. He walks down the concrete path by your door, walking around and climbing into his car, speeding off. "Go home." Simon mumbles to Paisley. "Hey. You okay?" He asks. You nod your head. "Yeah.." You shake your head. "I'm fine. Just.. yeah." You breathe. "Cmon, I'll make you some tea." He tilts his head for you to follow him. You nod your head, following after him. He leads you into his back door, closing it behind you. You notice Paisley laying in her bed in the living room. "I didn't think you'd be able to hear me." You breathe. "Was worried for a second." You laugh nervously. "Paisley was stressed out, kept harassing me. I happened to notice.” He mumbles. “You were listening?” You ask. “Just.. making sure nothing happened. Suppose it’s a good thing I was though.” He reaches up into his cupboard, shirt rising until you could see the Pistol grip.

You’ve never been more sure of anything in your life.

“Simon?” You say, stepping closer to him. “Yeah?” He asks, turning to face you. Once he’s close enough, you lean in, kissing him hard, cupping his cheeks so that he can’t pull away. “W-woah.” He breathes. “Are you okay?” He asks. “Just kiss me.” You pant. He sets everything he has in his hand down, returning his lips to yours and moving you so that he could pin you up against the countertop, feeling you moan into his mouth. He reaches down, grasping the back of your thighs and lifting you up until you’re on the countertop. You rest your hands on the countertop, pushing your hips forward. Like you wanted him.

“What’s gotten into you?” He asks. You pull away, looking at him, reaching forward and raising his shirt up. Getting a good look at his gun. “Nobody’s ever done that for me before.” You look up at him, taking a deep breath. “What? Told some scumbag off?” He laughs. “Defended me.” You breathe. “Seriously? Not ever?” He asks. You shake your head. “Please keep kissing me, Simon.” You whine. He leans into you, kissing you again. Stiffening up when he feels your hand on him through his jeans. He groans into his lips when you palm him hard through them. He pulls away, resting his forehead against yours. “Do you know what you’re getting yourself into?” He breathes. “Yes.” You whine. You sit up, reaching with both of your hands to unbuckle his belt.

He reaches down, hand gripping onto the cool metal of the pistol, setting it down on the countertop. Leaning in to kiss your neck as you pulled his belt apart and started on his jeans. You can’t help but glance at the gun as it sits there. You’re starting to realize just what kind of man Simon is.

A strong military man. A guarded one at that. He’s nice but gruff, quiet and observing. And something you’ve noticed since meeting him, since Paisley got stuck in your fence.

He’s protective of what’s his.

“Simon.” You pant. “What baby?” He breathes.

“I want you.” You breathe. “But.. you.. you’re..” he looks down between the both of you.

“Please, I want you to take my virginity.” You whine. Pushing your hips out. He takes in a deep breath. “Are you sure?” He asks. You nod your head. He pushes his pants down his thighs just enough to reveal himself to you, hearing you sigh when you see the size of him. “S’alright. Will only hurt a minute.” He moves closer to you. He tugs your pants down, discarding them to the side somewhere. Seeing all of you once again. He spits in his hand, focusing it on the tip of his cock. “Are you sure? Once I take it, it’s gone.” He breathes. “I trust you. I want you to take it.” You pant. He pushes your legs open, getting a good look at you. “Just relax for me.” Your heart is racing and he can hear it thumping in your chest from where he stands.

“If you let me do this..” he trails off, circling your opening with his fingers again, going to take his time stretching you out before he takes what’s rightfully his. “You’re mine.” He leans into you. Lips ghosting over your throat, right where your jugular vein sits beneath the surface. “Simon.” You breathe out.

“I think I was always yours.” You look him in the eyes, watching him stiffen at your sentence. Eyes darkening as he stares at you. “Fuck.” He growls, gritting his teeth. He presses the tip of his cock up against your entrance, tip pressing between your sopping wet folds. He forces you to look at him, taking his time thrusting every inch into you. He holds your throat, not cutting off your oxygen but just enough to hold you still. When your eyes flick down to watch him sink into you, he growls. “Look at me.” He growls. “Keep looking at me.”

“Simon.. it hurts.”

“I know baby.” He breathes. “S’alright, just for a minute. One minute.” He pants. You’re so tight on him, he can barely contain himself. He finally closes his eyes, sighing out as he bottoms out inside of you, hearing you cry out. He leans into you, holding you steady as he slides out, rocking his hips into you. “It’s alright. I know it hurts.” He takes in a sharp breath, hating that you hurt so bad, but he felt so fucking good. He keeps a slow, steady pace. Letting you adjust to him. He notices a little bit of blood, but it doesn’t bother him any.

“Simon..” you’re breathless when you say it. “Hm?”

“Fuck me.”

He shakes his head. “I don’t want to hurt you.”

“I can take it, please.” You hiss, pushing your hips into him.

He wraps his arms around your waist, holding you tight as he rocks his hips into yours faster, a little harder than before. Pushing your legs up as he slides deeper into you, hearing a gasp leave your lips. “Oh my god-“ you breathe.

He keeps up this pace for a few minutes, letting you get used to him. The last thing he wants to do is hurt you.

“How does it feel huh?” He pants, voice unsteady and desperate.

“‘M fucking your pussy.” He hisses, feeling you tighten around him. “Took your virginity.” He breathes. “How’s it feel?” He smiles. “It- it feels so good.” You whine. ”I feel so full Simon.” You hiccup with watery eyes. “Yeah? That’s how you’re supposed to feel. Supposed to feel overwhelmed and good.” He chuckles. He rests his hands on the undersides of your thighs, gripping you and keeping your legs open for him. Smiling when he sees you gripping the countertop like your life depends on it. He lifts his shirt up more, showing off more of his toned stomach.

“Fuck!” You cry, letting your head tilt back. He’s picking up his pace, getting you so close. You can feel swirling in your stomach, feeling something building.

A pant leaves your lips and you move up, trying to adjust yourself. “Simon. Feels weird.” You gasp. He lowers his hand to rub at your sensitive clit.

Just a little bit of that and you’re crying out for him. Clenching hard around him, your pussy milking him for every bit of his spunk.

He’s panting hard, moans unsteady as he approaches his orgasm. He’s going to cum hard.

He slides out of you last second, pumping his cock until he finishes on your stomach, groaning out, his body jerking as he finishes. “Oh fuck..” he whines.

After a moment of coming down from your highs, it finally hits you. You’d really just given this man, who’s way older than you, way more experienced than you, who you aren’t even in a relationship with. Your virginity. You’re staring at him with wide eyes as he cleans your skin of his filth, making sure you’re completely clean, even wiping down between your legs. He wants you to be comfortable. He sighs when he sees your nervous appearance. “It’s alright. I know.” He breathes. “Cmon, let’s go warm up by the fire.” He breathes. Lifting you up and bringing you with him to the couch. He sets you down, throwing a blanket over you.

You’re silent for a while. Not nervous or upset, more content than anything.

Simon is so caring of you, and he barely knows you. Which tells you everything you need to know about him. That he’s going to be the best thing for you. That he’ll take care of you. He finally sits down next to you after starting the fire. Throwing an arm around you so that you could lean into his chest. “I’m sorry if I took advantage of you.” He breathes. Hearing you laugh. “You didn’t. I’m a grown woman, I know what I want.” You smile. “Well.. good.” He smiles. “I just hope you don’t want it to be a one time thing.” You mumble.

“I was wondering the exact same thing.” He breathes.

“I know you just got out of a relationship and all but.. you’re mine.”

You smile up at him. “Always.”

“Oh yes, one more thing.” He mumbles, standing up and disappearing up his stairs for a minute, returning back down holding a box.

“Here.” He smiles. You take it from him, confused. “Simon.. I told you not to get me these.” You look up at him. “Open them.”

You open the box up, noticing a brand new pair of shoes. You can’t even imagine how much they probably costed. “Simon this is way too much.” You laugh. “You need new ones, I can help out. Let’s see how they fit.” He kneels down again.

“You’re doing too much for me already.”

He scoffs. “What I’m doing is the bare minimum. You’re just used to below average darling.” He laughs, tying the laces. You can’t help but smile at this.

“Thank you Simon.” You breathe.

“Always.”

[rashomonss]

The brothers and the Human Realm

a/n: so ik ‘jealous much’ won the poll but it’s still not done yet so have this instead!

context: a part of me still finds lessons 40-43 funny because the brothers have never really been to the human world that much, and they don’t really know how certain things work. Take the slow cooker and ice cream truck for example. So these are little headcanons I have for when all of y’all are together in the beginning of their stay in the human realm.

enjoy <3 , also these are in no specific order

you all are hopeless…

Solomon and MC would so fuck with the brothers while being in the human realm.

For example they’d take Lucifer to the shadiest mexican restaurant possible then after they finished eating they would tell the waiters it was Lucifer’s birthday and watch the Avatar of Pride sit there with a big ass sombrero on his head as they sang happy birthday to him.

MC later took a picture and sent it to Diavolo who then made it his lock screen.

Satan and Belphie tried to electrocute Lucifer by throwing a toaster in the bathroom while he was in the middle of a shower. This happened after the fact you told them not to put water on the toaster because it could electrocute someone. 

Beel ate an entire bottle of ibuprofen liquid gels because he thought they were hard gummies.

Beel also ate the food and cake shaped wax candle melts you had bought for Asmo as a gift

Beel lastly ate your whole brand new container of melatonin and it knocked him out for 15 hours straight. Needless to say Lucifer was very concerned for his wellbeing, and Belphie soon questioned if you had anymore.

Belphie and his brothers were never taught stranger danger, because who in their right mind would be a danger to them in the Devildom?

So after you had explained to him what an ice cream truck was he vowed to go to one with you.

However when a creepy old man in a white van offers him candy he believes it to be the same as the ice cream truck so he gets in the van.

When the brothers relay this information to you, you begin to lose your shit explaining how that was not in fact an ice cream truck he got into but instead a kidnapper van.

The brothers don’t know how to eat certain human world foods.

Such as a banana, watermelon, mango, pineapple, kiwi, avocado, cherry, dragon fruit, papaya, onion, etc.

So when you first buy one from the grocery store and leave it out before cutting it they automatically think it’s some weird shaped human food and bite into it eating the skin or seeds and all.

After they tell you about the weird but delicious taste of it you ask if they cut it or spit out the seeds before eating it, and when they reply with a puzzled look and a no your heart drops.

Thank god they’re demons. You then proceed to buy the same thing again this time cutting it up in front of them so they know what parts to eat of certain things.

Expanding on the cherry part, did y’all’s parents ever tell you not to swallow watermelon or cherry seeds because if you did a cherry tree or whole watermelon would then grow in your stomach??

I know mine and some of my friends parents would tell us that when I was younger to make sure we didn’t swallow any seeds.

If they didn’t then oh well, anyway…

Continuing with Solomon being an ass, he would so tell something like that to the brothers. If he happened to see Beel swallow a cherry whole he would then proceeded to tell Lucifer not to let him do that.

And when the oldest asks why Solomon would then go onto explain that if he swallows cherry pit then a cherry tree will then grow inside his stomach.

Of course this freaked out Lucifer so for the next hour he tried getting Beel to spit out all the cherries he ate.

You would have to organize their fridge and pantry in the new house because they don’t know which human world foods need to be refrigerated or not.

After you arrive at the house you spent a good three hours explaining to them not everything can go in the pantry because some of it will spoil after you open it.

Then you proceed to gag when you pulled out an expired chunky milk container from the pantry.

They find the concept of drive thru or fast food places astonishing. The fact that you can just order wait in a line for a few minutes in your car then get your food is crazy. They do however all panic though when you get to the front and they don’t know what to order off the menu.

Car washes are also something they found themselves favoring. You would turn up the music as you slowly pulled in and joked by telling the brothers you were going on a ride of sorts.

Which in turn shocked you when they did believed you as the car wash stared. Each of them were staring out the windows with starry eyes as different colors of soap were thrown on your car.

You laughed to yourself as they all admired the way the soap blended together, Asmo and Mammon found themselves taking pictures of the whole thing. While Belphie was telling Beel how this looked like a starry sky.

And Levi went on to tell Satan how this reminded him of an anime scene. Lucifer also found himself sitting quietly in the passenger seat enjoying it too. (Lucifer is a certified passenger princess, fight me on that)

Each brother questioned you on how this was possible and you replied with smile. After the car wash was over and you drove through the dryers they all asked if you could do that again, to which you replied smiling “maybe some other time”.

Lucifer watered the fake succulents and plants you put around the house for two weeks straight until you said something.

They love watching true crime documentary’s to the point you’d have to physically pull them away from the tv.

It happened one afternoon while a few of them were relaxing in the living room and you were looking for a channel to watch.

Deciding there was nothing interesting on you put on an old true crime documentary and began watching it. As the brothers heard the story of the crime from the tv they each became immersed in it.

Telling you things such as “how could humans do that to each other?” or “wow humans are more brutal than we thought” or even adding in their own comments on how they could have made the crime worse.

It became a guessing game between all of them to figure out who killed who during each episode you watched.

Much to everyone dismayed Satan was the one who won every time.

Meanwhile while they were all immersed in the tv you noticed Lucifer standing behind you, arms crossed also watching tv. You told him to sit down and watch with all of you but he denied, claiming he wasn’t really interested in stuff like this anyway.

Yet he never moved from that same spot each episode.

Each of the brothers have made something explode in the microwave.

Lucifer stained it red when he went to reheat pasta, but he put it in for to long and it exploded. Mammon overfilled his ramen thus causing it to leak then explode.

Satan and Levi also happened to be reheating takeout at the same time, but both of the containers were styrofoam and exploded. Levi got annoyed and Satan threw the microwave at Lucifer.

Asmo put some skincare product in there because he found something online about a certain hack, and it exploded causing the microwave to smell like burnt strawberries.

Beel put too much food in the microwave causing it to all melt together then explode.

Belphie put a coffee in there to reheat and it exploded, but he was too lazy to clean it up so he just left it. Lucifer was then next to use the microwave and got coffee all over him.

You made all seven of them watch the entire twilight series as a joke but ironically they all actually enjoyed it.

Satan even went out and bought the books, and finished all of them in about 2 hours

Bonus

Solomon distracted Diavolo for 3 hours straight by making him watch 5 minute craft videos.

Diavolo then proceeded to break things to try these said crafts which caused Barbatos to have a meltdown.

Barbatos destroyed an entire sidewalk because he saw two rats run across it into the sewer.

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

[jonnywaistcoat]

Hey, Horrormaster Sims. I have a wildly different question that barely relates to TMA (Sorry about that) but its about your own process. Please, if you could, can you tell me how your first drafts made you feel? I'm on the fence about writing my own thing (not a podcast, and again, not Magnus related, though I have a million little aus for that delightful tragedy you wrote, thank you for that!) But I'm discouraged by the collective notion that first drafts are always terrible, because there's no ... examples I can solidly use to help the dumb anxiety beast in my brain that tells me everyone who is in any way popular popped out a golden turd and not, well, you know. One of my friends said 'Oh I bet Jonathan Sims's first draft was nothing like what he wanted' and I got the bright idea to just. Send you an ask, since you're trapped on this hellsite like I am. Anyway, thanks for reading this (if you do) and if you'd rather ask it privately, I am cool with that. Alternatively, you're a hella busy man with Protocol (you and Alex are making me rabid, i hope you know) and you can just ignore this! Cheers, man, and good words.

To my mind all writing advice, especially stuff that's dispensed as truisms (like "first drafts are always garbage") are only useful inasmuch as such advice prompts you to pay attention to how you write best: what helps your workflow, what inspires you, what keeps you going through the rough bits. There are as many different ways to write (and write well) as there are people who write and so always consider this sort of thing a jumping off point to try out or keep in mind as you gradually figure out your own ways of writing.

On first drafts specifically, I think the wisdom "all first drafts are bad" is a bit of unhelpful oversimplification of the fact that, deadlines notwithstanding, no piece of writing goes out until you decide its ready, so don't get too hung up on your first draft of a thing, because a lot of writers find it much easier to edit a complete work than to try and redraft as they go. It's also important to not let perfectionism or the fact your initial draft isn't coming out exactly how you want stop you from actually finishing the thing, as it's always better to have something decent and done than to have something perfect and abandoned.

But the idea of a "first draft" is also kind of a fluid one. The "first draft" you submit to someone who's commissioned you will probably be one you've already done a bunch of tweaks and edits to, as opposed to the "first draft" you pump out in a frenzy in an over-caffeinated weekend. For my part, my first drafts tend to end up a bit more polished than most, because I'm in the habit of reading my sentences out loud as I write them (a habit picked up from years of audio writing) so I'll often write and re-write a particular sentence or paragraph a few times to get the rhythm right before moving to the next one. This means my first drafts tend to take longer, but are a bit less messy. I'm also a big-time planner and pretty good at sticking to the structures I lay out so, again, tend to front load a lot of stuff so I get a better but slower first draft.

At the end of the day, though, the important thing is to get in your head about it in a good way (How do I write best? what helps me make writing I enjoy and value? What keeps me motivated?) and not in a bad way (What if it's not good enough? What if everyone hates it? What if it doesn't make sense?) so that you actually get it done.

As for how my first drafts made me feel? Terrible, every one of 'em No idea if that's reflective of their quality, though, tbh - I hate reading my own writing until I've had a chance to forget it's mine (I can only ever see the flaws). I suppose there's theoretically a none-zero chance they were pure fragments of True Art and creative perfection, but Alex's editing notes make that seem unlikely.

[lewisvinga]

young and beautiful | oscar piastri x fem! reader

summary; due to her pregnancy, y/n wonders if oscar will always love her, if he will love her after she’s had their baby, after she’s no longer young and beautiful

warnings; mentions of pregnancies (duh), body image, insecurities, reader is mentioned as religious at the end but it will make sense 😣

taglist; @namgification

word count; 1.2k

note; think this is the longest written fic i’ve done lol

‘born to die’ series masterlist !

f1 masterlist !

“What should we ask Daddy to bring us, little bee?” Y/n hums, patting her swollen belly as she rummaged through her closet for her silly pajamas.

Oscar was about to leave a meeting and promised to bring her whatever she wanted. It seemed like the bee, their baby, was craving Mexican food. Y/n hums to a tune as she sends a quick message to her husband before grabbing the silky pink pajamas.

She kept her hands on her stomach out of habit. Now that she was nearing 8 months, her stomach had grown significantly. She missed her small bump from the first trimester, but having a huge stomach was inevitable.

Y/n lets out a deep sigh as she takes off the maternity dress she wore for errands. She glances in the mirror and notices the bright red marks on her stomach. She applied many types of creams to try to avoid getting stretch marks but she couldn’t avoid it.

As much as she loved how hard her body was working for her and her baby, she hated seeing those same red marks. Her mind wandered off to how she was going to look after having her baby.

She’s seen plenty of videos on motherhood. A few talked about how different a mother's body will be after childbirth. Many gain weight and many have loose skin that will stay forever unless they get plastic surgery. She’s also heard stories of women whose husbands or boyfriends left them due to how different their bodies looked afterward.

Y/n began to overthink as she stared at herself in the mirror, dressed in nothing but a comfortable pair of bra and underwear. She knew she would no longer have the body she had before becoming pregnant.

Her skin will be all loose. Her stomach will be all flabby. Her chest will become bigger than usual and most likely end up uneven from breastfeeding. She was absolutely terrified that Oscar would no longer love her.

Even if the Australian driver practically praised the ground she walked on, Y/n was terrified of him leaving all because her body wouldn’t look the same. She hadn’t realized how much time had passed and how her eyes were tearing up until she heard his voice.

“Y/n? Love, where are you?”

“I’m changing!” She calls out in a panic, pushing her thoughts to the back of her head as she rushes to put on her silk pajamas. She rushes out of their shared room and down the stairs. Oscar calls her to be careful as she approaches the dining room.

“Osc! We missed you.” She says with a soft smile, wrapping her arms around him as much as she can despite her belly. He kissed the top head in reply and gently patted her stomach.

“Hope you’re hungry because it smells amazing.” He says with a chuckle, taking the boxes of food out from the brown bag. Her craving for Mexican food quickly covered up her insecure thoughts from moments before.

She had forgotten about them until she had just finished doing her skincare routine before going to bed. She had struggled a bit to lean down to wash her face.

Oscar was quick to notice her mood as she walked waddled back into their shared room. She lets out a huff, laying down on her side beside him, and keeps her eyes on the TV playing some random movie.

“Love, are you okay?”

Silence fills the room as Oscar asks the question. Y/n couldn’t help but tear up at his gentle tone. She felt stupid for overthinking that he could ever leave her when he’d do everything for her, even stopping by the grocery store after getting take out because she only liked a specific vanilla ice cream with her churros.

“It’s stupid.” She mumbles, wiping her tears away before he could notice. Unfortunately for her, he immediately noticed. The McLaren driver furrowed up his eyebrows in concern as he shuffled closer to her, gently wiping away her tears.

“It’s not stupid if it makes you cry, my love.”

“It’s just-“ She began, pausing to take a deep breath. “My body looks so different. I appreciate it for growing our little bee but it’s going to look so different. I already have so many stretch marks and after I have our little bee, my stomach is gonna be all flabby and stretched out!” She cries out, turning to look at an even more concerned Oscar.

“Love-“

“And I’ve heard stories of husbands leaving their wives after childbirth and after getting older and having multiple children. I’m not gonna look the same as I did a year ago, Oscar.” Y/n takes a deep shaky breath, letting the tears go, “I’m scared you’re gonna take a look at me with disgust. Will you still love me after? When I’m no longer young and beautiful? I hope you will. I mean, I know you will. But it’s just-“

“Y/n.” Oscar interrupted her, cradling her tear-stained face with her hands. He wiped away the tears from her rosy cheeks as he gently kissed her. “I will always love you. From a year ago during hot summer nights in mid-July, when we were wild, to a year from now when we’re holding our baby in our arms. Y/n, you’re the most gorgeous woman I’ve ever laid my eyes on. I love everything about you, your pretty face and electric soul. Yes, your body will look different but that’s because you’re working so hard to give our little bee the growth she needs. But I will always love you, when we’re young, when we’re old, and when we’re nothing but souls floating around.”

His words made her tear up even more. He lets out a chuckle, wrapping his arms around her shoulders and pulling her in close. “See this?” He questions, holding up his hand and showing the gold ring on his ring finger. “You’re stuck with me forever whether you like it or not, my love.”

Y/n lets out a shaky laugh, sniffing as she uses her tear-stained silk sleeves to wipe her nose. She looks up at him with nothing but adoration. Her face immediately seemed to light up compared to how she was feeling before. She reached up to gently caress his cheek. He was like her sun. He always knew how to make her shine like diamonds.

“Bee and I are so lucky to have you, Osc.” She whispered as she leaned in, kissing his lips softly. Oscar pulled her in as close as he could, deepening their kiss.

“More like I’m lucky to have you.” He whispers against her lips, “I’d be dead without you.” He adds as they pull away. She lets out a small laugh, lightly hitting his shoulder as they settle in bed.

She wasn’t overthinking anymore due to his reassurance. She lay against his chest as they watched the movie that was playing softly in the background.

Y/n started to get tired when she noticed Oscar became fast asleep. She lets out a yawn and gets comfortable against his side but not before whispering a quick prayer.

Dear Lord, when I get to Heaven, please let me bring my man. When he comes, tell me that you’ll let him in. Father, tell me if you can.