#but i think a lot of the texts on the linked posts are important outside of cat analysis (obviously) | Explore Tumblr Posts and Blogs

storgicdealer · 15 days

Text

one of my BIGGEST and important rambles on ava that questions a lot of stuff that was accepted as factual a lot of times

dimensions, rocketcorp and virtual reality in ava

initially inspired by these tags from @sticksstonessteel and the thinking about rocketcorp simulations. and a certain hc i saw on ao3 once and remembered

eventually it turned into an existential crisis. im sorry moots

warning: OKAY. so. this is very clumsily made and its an assumption made both of canon info and theories that might feel as a complete reach.

this text touches upon possibility AND obscure ideas that might not have definitive proof in canon. there might be not a direct link of events here. but it is very, VERY long and touches many different subjects at once. takes of this long ramble are bold (i could also mention strangely opposing points in the text because i re-thought many concepts along the process of this ramble and mightve not noticed it)

i was wondering about the way the technical-machine device stuff intermingles with the whole literal mercenaries (and a box used for torture) thing. but these tags made me think not only of that

what we've seen so far is that rocketcorp controls a variety of tech, both pc-like interfaces that only they have access to and more "regular" tech, like tvs on which videos from youtube can be played on. [kings backstory]. we've also seen a variety of different tech in the wanted-the box episodes, but not much of it can be used outside whatever advanced shit theyre doing inside the corporation. one of these things however can be used which is surveillance tech, it feels like an important thing to note given that the importance of the corporation might suggest that rocket is responsible for city surveillance in one way or another as well

yet how exactly does a tech corporation tie in with mercenaries, weaponry (and literal torture)?

• rocketcorp

given, again, the grand variety of tech they possess and advanced technology they use, them using literal devices that real world users/sticks from a pc would use (control panel of the box) and it being restricted to them only made me think of something. the whole story of ava/m is built inside digital realms, outernet and internet. taking that into account, obviously, any kind of technological advances in these worlds are crucial to the way of how sticks in it interact with their already technological reality. which made a tech company like rocketcorp so influental in the first place

due to a piece of rocketcorps existence in the king episode and ava s2 teaser and prior to the release of the box i had a thought that the company specializes and presents itself as a "domestic" tech company. not the kind of company that meddles with grand technology and digital stuff, but the one that is accustoming citizens of the outernet with regular tech such as the mentioned tvs. the work of the mercenaries was always perceived to me as just an underground shady work of a company. but the box and a reminder of the chosens wanted poster made me rethink and question whether rocketcorp specializes on technology that changes and affects the reality they're living in, outernet and dimensions itself

i tried to observe the possibility of it and came around to three big thoughts, the most major one being the last

first thought that can give something to this thought is that mercs tech weapons influence physical properties of their world — ultimately damaging objects and people (like it was with the corndog stand and chosen), rendering the objects out of their usual state and bringing actual pain or messing with the state of a stick.

(its also worthy to mention that in the corndog short, prior to the merc and chosen chase appearing onscreen people in the short were already running away, and it does make me wonder if it happened out of potential fear of these weapons or, maybe, potential fear of the chosen one? bringing me back to my post on thinking how chosen & dark crimes were perceived in the internet and possibly outernet)

the fact that weapons changing literal existence of an object and glitching them are available to mercenaries of rocketcorp is a pretty big thing

another potential argument for it is about the memory scanner itself — a thing used for intrusion into a literal brain (code?) of a person. the obvious thing aside – the scanner literally looks like a vr helmet and i initially thought that it was its function before i saw what it was used for

the whole fact that this kind of advanced technology exists, honestly, surpassing the already existing level of technology in stickcity is something that could potentially connect victim and rocketcorp respectively to an ability to meddle with a literal living being, their memory and potentially their code. victim, aware and knowing the process of being directly created from someone's hand might've acquired the knowledge of influencing a stick's literal process of living over the course of all the years. which brings me to my major point:

• dimensions

we all know about the fact that initial pc programs are able to be used in the outernet, which by itself is an interesting discussion of internet and outernet intertwining once again. we know that rocketcorp and pc sticks use interfaces that real world users use. and we know about the existence of the adobe tool board that agent uses literally all their screentime and the adobeflash instruments in victims office. it wasnt a surprising thing to see given that we have mostly explored the way of how pc and internet programs work throughout the series, and it was thought about that well! nothing surprising about these tools being in the outernet as well, mustve acquired it from somewhere! (and honestly, given all the new insane character plot i didnt think about that deeply either)

over the course of events happening in the outernet we have never really seen pc apps used there physically prior to season 2, except for one time of alan's cursor being used there... that required an insane amount of coding and manifestation of the cursor in the outernet space that couldnt be achieved without a stick that is familiar with with a pc.

not only talking about yellows feats, the creation of darks portals is something worth mentioning as well. we know that he is extremely skilled in coding, with it most likely being his main activity (aside from terrorism) in his life in the outernet. no sticks that we've seen created something like literal dimensional portals, like dark did — and he is a stick that is accustomed to the pc and internet as well. and oh, orange. bringing their stylus to outernet and have it revoked almost immediately when caught (which is not surprising at all anymore, that the mercs and rocket workers took an immediate interest in it given canon information and all these theories lol)

and, unsurprisingly, purple, king and the unknown merchant in "the king" episode as well. we know that the minecraft icon could be accessed through a travel to a pc, and that purple was first introduced literally inside of a mac — and the whole bit of purple coming to alanspc trying to steal the icon that the cg had.

(another thought to mention is about the interdimensional travel — the whole fact that the internet and the pc realm is able to be accessed through programs brought to the outernet. (e.g. minecraft portals). but again, these programs were initially coming from a pc, and didnt exist in the outernet. where the actual hell did the blue merchant in the king episode come from????)

this whole fact shows that the only way to access pc programs in the outernet is for something or someone to bring it there.

and victim, posessing all the tools of the whole program he was created in, wouldnt be able to get it through regular means. whether that means acquiring it from someone's elses hands or going to a pc by themselves.

• virtual reality and the position of rocketcorp in outernet

now, im going to bring up outernet and internet intertwining again. outernet sticks do not interact with pc programs physically, like all avam main characters do.

the only times we've seen pc programs and apps physically interact with outernet were shenanigans with the cg, hollowheads, purple & king. people that actually had access to a pc in one way or another.

(..and the damn merchant.)

the fact that these programs existence is quite rare in outernet and maybe even unknown to some, having rocketcorp being a full-on restricted company with classified information, having high influence over tech, exchange of pc programs being seen as a shady activity(!!!!) (the king episode),

— could rocketcorp be somewhat of a main corporate that controls the fabric of the outernet and internet itself, being some sort of a power force and government-ish corporation to the outernet? perhaps, them being seen as officials that have limited knowledge of unaccessible pc programs and internet itself and exclusive (even divine?) power of it that only they are able to possess, providing it to the outernet, initially making them "the people in power" that stand higher than regular sticks of the outernet?

(essentialy, making victim a literal fucking dimension mastermind)

• important part about outernet sticks (that ill probably ramble about in an another post independently)

supposing that rocketcorp does possess power... would they have control over what they decide to stream and show with their tech?

the tv that we've seen in the king episode didnt show any other episode except for the minecraft one. heck, it could've been the only thing shown there.

and in general, it begs the question: are outernet sticks that never traveled beyond its space even aware of internet?

and could've they interpreted the episode above as just fiction, along with the confirmation that our main characters are the ones that are inherently tied with the pcs and the internet in different ways?

(PLEASE tell me if there's proof that confirms otherwise because its a very bold statement given how much outernet and internet are interlinked in the main story. its 2 am i havent slept sometimes i have amnesia and i might be forgetting something very crucial. this assumption was not fully comprehended by me before specifically because most outernet sticks are the same type with the cg and it was confusing when i was just getting back to avam a few years ago)

we also know about the box itself. or, to be more accurate, the boxes. the ones that both chosen and second were trapped in, at the same time, in different places. the ones that were, quite literally, simulations. the ones that have also used pc programs tools.

simulation isnt something that was seen as an ordinary occurence, but it was literally seen twice in the rocketcorp in the same episode. creation of a simulation doesnt seem like an activity that could be used by ordinary sticks either. giving potential highest influence of rocketcorp over pc and internet technologies and its providence, are they able to give simulation experience to others, allowing regular sticks to experience different dimensions in a controlled way? say, for example, in a game?

whoa finally i got it out of my brain. im going to drop family guy pose style

afterthought rollercoaster:

• as far as i remember we didnt see outernet citizens interact with internet like users do, but we do know they possess tech such as television again, that can be bought. there IS tech such as computers (tdls room) but we havent seen them being used by sticks that werent exposed to the concept of the pc and the internet. there is a possibility i missed out on outernet sticks using phones or other tech, but even with this, its possible that our internet is simply not accesible there

• given the possibility of rocketcorp delegating all technology and simulations, providing it to others, possibly allowing smaller companies to use their resources in different cities... is there a possibility that rocketcorp might've been responsible for the gold simulation incident?

• going back to weapons of the mercs, i do wonder whether, even with the pc apps ability to be used in the outernet, the apps themselves having any kind of influence over processes in the outernet — given the whole glitching thing that literally messes with physical objects and people. it is just my own theory, but i dont believe that the glitch thing that is embedded in these weapons comes from the outernet, either

• okay this is going to be a wild concept you dont have to read it

talking about the creation of outernet and the whole race of stickmen, right now i am tending to believe that outernet is still an extension of internet that might've appeared with its creation. i was always open to accepting it but slightly confused by the concept of outernet being natural (bc i constantly try to find logic in worldbuilding el oh el) and tried to suggest a theory that sticks of outernet might've also been created directly (which does feel like a reach atp). with the concepts i discussed in this ramble i dont really feel that confusion, but im honestly not abandoning the idea of creation at some point, either: specifically i had a thought that when outernet first appeared first sticks of that dimension were also created, potentially them finding a way into outernet in some way. but eventually outernet was built as an independent place for their kind and prospered by itself like any civilization would

oh my god im going to drop with exhaustion. but im so happy i got it out

self portrait of my sticksona right now

#animator vs animation #alan becker #animation vs minecraft #animation vs animator #ava/m #ava headcanons #ava theories #ava theory #animator vs animation theory #storgesinsaneramblings #hhhaabwhirkr. some of these concepts make me go insane #if any of my ideas make sense im going to make this post into a bingo when new episodes come out

61 notes · View notes

fairuzfan · 2 months

Note

During ancient times there was the kingdoms of Judah and Israel. But according to the Tanakh (Hebrew Bible) there was also the United Kingdom of Israel. BUT the thing is that a lot of ancient history about Jews is written in the Tanakh. And you can never really 100% trust religious books as historical sources. The Tanakh was written on stuff that can actually be preserved. While possible other sources on history of the Jews and other groups were written on things that perished. There is a lot of debate about the extent of the United Kingdom of Israel or that it even existed.

You have two kinds of historians when it comes to the Hebrew Bible:

The maximalists: accept everything unless proven incorrect by outside sources. https://en.wikipedia.org/wiki/Biblical_maximalism

The minimalists: Hebrew Bible is limited in historical value. https://en.wikipedia.org/wiki/Biblical_minimalism

Thanks so much for these links actually while looking at "biblical minimalism" I recognize some of the authors being cited in some of the works I read. I should check them out.

Also love reading academic beef the way that both groups named each other's "study" but neither operates with those labels lmaooo classic academics.

But also so people don't misunderstand me or try to take me out of context regarding this whole discussion: I also don't think the Quran is a 100% accurate historically, and it's stories are mostly used to educate on certain topics and ideas as it's primary purpose (think of aesop fables when i say this). Of course religiously I believe in the Quran, but most of the Quran is written in poetic verses in arabic and even as a baseline Muslims believe there's more to a quranic translation than just the direct translation. In quranic book history what we focus on a lot is the way books were made throughout history moreso than the actual contents (which religiously, we are not supposed to change at all... I believe the Hebrew Bible also is like that? Would love if someone could tell me more about it tho).

Even with the Birmingham Quran (the oldest quran that has been carbondated to around the time of Prophet Muhammad), i dont think its as important for the text itself (other than comparing contemporary and ancient to see if any changes happened through the few leaflets that survived), the most valuable parts of it is the fact we can carbon date it and see what sorts of materials they used back then and to see when the earliest surviving fragments came from. Plus we can analyze the script and rubrication to see if this was actually used to be read or used as a mnemonic device.

I can't say too much about archeological study more than this and that other post though. That's not exactly my field of interest or expertise. If people want to share more I can't provide much input unless you're talking about book history LOL.

But yeah just wanted to clarify so people don't assume bad faith/try to use my words to push their own agendas. In general historical studies should separate themselves from religion I feel if they go beyond analyzing societies the time in which the books/material were made or written.

Also here's a direct link to Birmingham Quran if the above one doesn't link:

#palestine #history

54 notes · View notes

cr-pisacs-evil-brother · 9 months

Text

Pathologic Bachelor ARG Megapost

This post is a culmination of months of (mostly my own) research into the Bachelor ARG. For far too many days and far too many hours, I’ve been doing my best to solve this, with the help of a few other people. I looked very deep into most Fyodor Vitin posts, played through The Marble Nest several times, looked extensively through the Pathologic wiki, and read/analyzed countless outside sources for this post, and I will link as many of them as I can. (If there are links that you think would help the ARG that you’d like included in here with credit please let me know.) For any people that are credited, an “@” before their name implies that it’s a Tumblr username, while a “u/” proceeding their name implies it’s a Reddit username. I have discovered and analyzed dozens of leads, some of which are more likely to be important or intentional on the part of IPL than others. The primary purpose of this post is to give all of you Pathologic fans new leads and theories to analyze in pursuit of solving the mystery behind this ARG, so many of the things within this post should be looked into further! With this post, I will lay out my findings in a series of sections, all of them having several connections to each other. This post is more than 10,000 words and is not meant to be read all at once, so feel free to read sections, take breaks, re-read sections, or skip around if you'd like. “Observations, Research, Analysis” is a vast majority of this post and consists of observations made about the ARG material, as well as any research I did into those findings that bore fruit, and analysis/connections to other things. The additional notes section consists of some of the conclusions I’ve reached after putting all of my evidence together, as well as some connections I didn't really make in the previous section, but keep in mind they’re still just theories so they could obviously be wrong. I would like to emphasize that I am not a native Russian speaker, but I did have many native Russian speakers helping me along the way, and in particular, I’d like to thank @kurury-chan for her massive help with this. She transcribed the newspaper for me, provided tons of consulting, translated many other Russian sources, and actually went out of the way to go on an irl tour of a certain ARG-related location to see if my theories about it could hold any ground! Because I'm not a native Russian speaker, the sections where I'm required to analyze Russian text (notably the newspaper section) will probably be the least interesting and I'll probably end up making a lot of points that aren't valid. Additionally, I’d like to thank @cryingsyren (who also happens to be my bf) and @ded-not-ded for their help. As for formatting, since Tumblr doesn't have tiered lists for some fucking reason, all main points will be written as bullet points, and any sub-points within that bullet will then have numbered points afterward. For example like this:

The first main point about a topic

Sub-point of the first point

Second sub-point

The second main point about a topic

I'll either do that or I'll do it like this:

First main point

First sub-point First sub-sub-point

Second sub-point

Second main point

Edit 1: I've had to revert much of the Chat text (the font I used for the sub-points above) to regular text because of a formatting glitch that irreversibly changed most of the Chat text to bold, which was very confusing.

Depending on which looks better in the context of the points. Because that formatting is so awkward and clunky I'll try to minimize the use of tiered lists as I convert this from the Google Docs format to the Tumblr Format. Most of the time that I use tiered lists here it's to deal with the character limit Tumblr has on single blocks of text within a post. With that out of the way, let's just get into the post.

Observations, Research, Analysis:

"The Accident" Fyodor Vitin post

The first thing I noticed about the newspaper when I took a good look at it was the use of bolding with certain letters. If you look at the Newspaper you’ll also see ink splattered on the page in several areas, which could be a clue toward noticing the bolded letters, or it could be something else I’ve yet to discover. I knew I wouldn’t be able to transcribe the entire newspaper by myself, not being a Russian speaker (although I’ve just started learning!) so I enlisted the help of @kurury-chan, a native Russian speaker, and she transcribed the entire newspaper for me in Cyrillic. After getting this transcription I went through and spent a couple of days looking for which letters were bolded, writing them down, and coming up with possible translations/meanings. I’ve come up with lots of possible meanings for these, but for many of them I couldn’t figure anything out, and I’d love help if anyone has any idea what they could mean! To me many of them seem like word fragments that are simply missing one or two letters, and so in the document where I list all of the bolded letters I put some words/phrases that are very close to the seemingly fragmented words. Once again keep in mind that, while I’m trying to learn Russian, my understanding of the language is still rather weak, so I may have mistranslated some of these. Another small detail to mention is that there’s a prominent crease on the left side of the paper that runs through a decent portion of the bolded words. First, I’ll start with the bolded letters on the left side of the page. I may have missed a couple, and I may have written some of them down as bolded when maybe they aren’t supposed to be seen as such.

Here is a link to a list of all the letters I think are bolded on the left side, which lines they’re on, and possible meanings, many of which I’ll be discussing here. I will not go individually through what I believe all the bolded letters mean, but I will go through and explain the ones I think are most meaningful and important, as well as some connections I’ve made with them. And here is a link to the original Russian transcription and my best attempt at an English translation.

It’s possible that the crease that runs through the left side of the paper and notably runs through many bolded words somehow denotes that those particular bolded words are special, or perhaps that they should be seen as separate from the other bolded words.

Line 15 has a rather interesting bolded phrase, because it actually appears to make a somewhat coherent 3-word phrase, but one of the words seems to be a surname, “Pepe.” Additionally, the crease on the left side of the page starts right above the word “ПЕПЕЛИЩЕ” in the title, and splits it so that “ПЕПЕ” is separate from the rest of the word. (ПЕПЕ is Pepe in Cyrillic.) If you want to know what the non-Pepe words say, skip to the next bullet point, because the rest of this one is my analysis of the ПЕПЕ part. So, of course, I looked into the name a bit, looking through all notable historical figures with the last name, and found one that I think is of special interest: Guglielmo Pepe. Born in the small ancient town of Squillace, Pepe entered the army at a very young age, and was an Italian commander during the early 1800s, but his military career was fraught with trouble, as he also had rather revolutionary politics, which angered both the government he was serving and many of his peers, and he was exiled on several occasions. Upon Pepe’s return to Italy at the age of 30, he was given the rank of general. After this, the most notable events in his life would largely consist of his attempts at going rogue in revolutionary attempts to change the existing power structure, for which he was usually punished. (It’s also perhaps worth mentioning that his brother was part of the attempted French invasion of Russia.) All of this is to say, Pepe obviously shares some striking similarities to General Block, perhaps the most striking of which is his status as a 30-year-old general, which is an aspect of Block’s character that is highlighted several times. So, of course, I looked into Block’s character a bit more, and discovered that in the Russian version of the game he is called “General Ash” instead of “General Ashes.” “Strange,” I thought, until I saw that in Russian, Ash is “Пепел” which is pronounced as “Pepel” for anyone that isn’t familiar with Cyrillic. If we look into it, we do see that the letter after the Пепе is л, but it is notably not bold. This is, if you're counting, two separate times in this paper where the plural for ash, пепелище, is split up so that only the пепе is emphasized. As for other connections between Pepe and Block, we could look at them both harboring some revolutionary tendencies and being punished for it, both by The Powers That Be and his peers. General Block also tells Artemy that he was born in a town not too dissimilar to the Town on Gorkhon; this is interesting because there are some connections to be drawn between Squillace and Gorkhon, primarily that both of them preserve the beauties of ancient times that have all but been lost to most people. Related to this, it should also be noted that I believe the plot of The Marble Nest was heavily based on the plot of The Seventh Seal, which is the same movie that inspired the character Alexander Block.

The rest of line 15 is also interesting, but I’m not sure exactly what it’s supposed to mean yet. It translates to “Heaven on Pepe” basically. I consider the “Pepe” part to probably be the most important, since there’s a large crease that runs through it, which I think probably denotes a level of importance? The line’s meaning might be related to the fact that “heaven” is sort of a synonym for “utopia,” or the character that Block is based on is the protagonist of a movie that revolves around the ideas of heaven and Christianity, which is something we saw very briefly with Block in Pathologic 1. If you have any ideas please post about them and tag me, or simply comment/reblog this with your ideas!

Line 1 and line 18’s bolded letters both start out with “ов”, and for my English speakers out there it is pronounced sorta like “ove.” ов is interesting because if you translate it as о-в it actually is the shortened form of “island” in Russian. Line 1’s bolded letters read as “ов попо”, and for people not familiar with Cyrillic попо is basically “popo.” There are, apparently, many Popo islands in the world, and I couldn’t find one that I think directly connects to the ARG or Pathologic, but maybe someone else out there will, or perhaps that line has a different meaning to it. As for line 18, it says “ов испустивших” and according to Russian wiktionary, the second word is one letter off from the word “Emitted.” I looked a bit deeper, though, because that didn’t satisfy me (why would they use the incorrect spelling of a word after all?) and I didn’t see much, but I did find two things that used the exact word “испустивших” that interested me: A Saudi Arabian newspaper that has been translated into Russian, as well as a Russian poem from 1777 celebrating the birth of Grand Duke Alexander Pavlovich, also known as Alexander I of Russia. The latter is more interesting to me for numerous reasons, the first one being that it might serve my theory about the connection between line 1 and 15, as line 1’s bolded letters end with попо and line 15’s end with пепе. The connection is weak, too weak for me to make it a separate bullet point, but strong enough for me to want to explain. So, as we know, there is a connection between line 1 and 18, it’s what this whole bullet point is about, and this theory (using the term “theory” loosely) relies on us seeing them as very closely connected. Basically, Alexander I was the ruler of Russia during the French invasion, which is interesting because, if you’ll remember, Guglielmo Pepe’s brother, Florestano Pepe, took part in the French invasion. This, to me, is an interesting connection, but I do admit it’s definitely a reach.

That’s where I’ll stop talking about the bolded letters on the left side of the paper. If you’d like to see what other bolded letters there are, what they could possibly mean, and try to decipher the meaning for yourself please go to my linked Google Doc(s).

As for the right side of the Newspaper, there are some bolded letters, but I can't seem to make much sense out of them, and by this point in my research I was starting to pursue more promising ARG leads, so this section is rather incomplete. Just as a reminder, the right side of the newspaper is an advertisement for a lantern/kerosene shop. I personally think the right side is more interesting than the left for a couple reasons, but most of them are either self-evident or will be discussed later.

The lantern on the right side of the paper is the same model that’s used throughout the Haruspex’s route, but most notably it’s used a ton during The Marble Nest as set dressing. And when I say "a ton" I really mean it.

I also remembered vaguely an unused lantern item found in the game files of Pathologic 2, so I went to the Pathologic wiki to look for it, and surely enough the exact lantern used by Artemy, the one that appears so many times in The Marble Nest, is also an unused item present in the game files. When using console commands to give yourself the item, you’re able to click on it and select the “touch” option, upon which you’ll see the number 6192355001378070 where the name of the item should be, and 6192355001378072 where the touch text should be. I’m not sure exactly what these numbers are supposed to mean; my first thought was that they seemed long enough to be coordinates, so I put them into google maps and it does lead to a location in Russia! Nonetheless, the numbers are a little bit too long to make sense as cohesive coordinates. Still, it might be something worth investigating. You'll see later in this post just how significant numbers and number patterns are in this ARG.

The word used to describe one of the victims of this inferno, “academician,” has sorta interesting connotations in countries that were once part of or heavily influenced by the USSR. This person is referred to as “Mr. F.L.” in the article. This guy is also said to be a historian and a “бытооописателя,” which as you can probably tell by the fact that I’m not using the translated English version is a weird word. Perhaps the strangest thing about this word is the fact that it clearly has 3 o’s where there should only be one. The actual meaning of this word is odd, as it’s very rarely used, and according to all sources I could find (including native Russian speaker and linguistics enthusiast @kurury-chan) it is either an archaic term for a historian or a term meaning “writer of everyday life.” I’m honestly not sure what that means, and at first, I thought it meant something like a blogger. The most complete and coherent definition I could find describes it as “author of works describing everyday life.” A different translation I found seems to say it means something like "chronicler," which I suppose makes some sense.

In the bottom right part of the paper, you will notice what at first appears to be a signature. Admittedly I had almost no hand in this part of the investigation, except for the isolation and upscaling of the text. Most of the work here was done by @cryingsyren with some help from @kurury-chan and @ded-not-ded. Here is the image that I got for them of the text, and here is our current interpretation of it: It at first seemed to be Russian cursive (and it probably is supposed to be), which complicates things quite a bit, and @cryingsyren spent a couple days trying to figure out exactly what it says, (with some help from @kurury-chan) and as far as we can tell it’s four letters, which are separated into either two or three sections. I think we have a decent grasp on what they’re supposed to be in Cyrillic, but the interesting thing is that they do look a lot like both Russian and Latin cursive. I’ll describe them now using what Latin character they look like in quotes followed by what Cyrillic character they look like in parenthesis. The first section is an “M” (М) and a “K” (К), which are very clearly connected. The next section is either an “H” (Н) or an “H” and an “n/u”. We’re not exactly sure whether the H and the n/u are supposed to be connected, but the n/u being lowercase seems to imply it is. The interesting thing about the n/u is that, while it looks like it could be a Latin n or u, it also looks like it could be a Cyrillic и, which is the italicized version of the Russian letter и. It seems all too coincidental that all of the letters they used have almost exact visual counterparts in the Latin alphabet. At the moment our working theory is that it could be initials, and this is where I come in, because for days I knew I recognized the "MK" part of the signature, but I couldn't remember exactly where from until today. For anyone that has played too much Pathologic Classic HD like me, you may recognize the "MK" signature from the center of the loading screen in that game, scrawled in a way that most people wouldn't pay attention to it, and certainly that most people wouldn't have it committed to memory like me. During the roughly 170 hours I've spent playing the game I've probably looked at that MK more than I've looked at my youngest brother. This presents the question, who is MK? Well at first I thought it could be Mr. Katzman, as referenced in the "Mask" post, but that didn't seem right to me. This is when the fact that so much of my brain is Pathologic lore facts came to help again, when I remembered state inquisitor Mark Karminsky, who you may remember as being one of the men people thought would come to the town before Aglaya Lilich showed up. As for the rest of the writing, I'll leave that up to you guys to figure out.

Something to note for later on: We know there to be 19 inquisitors when Pathologic takes place, and in this ARG the number 19 becomes very important with later clues.

"Mask" Fyodor Vitin post

Arguably this is the Fyodor Vitin post I’ve done the most research into, and it eventually led me to develop a very deep and passionate interest in the Buryat peoples that has so far caused me to read several books and around a dozen academic papers about them. I haven’t only done research into the Buryats for this post, though, because although the Buryats are the primary inspiration for The Kin, they’re not the only inspiration. Despite all of this research work, this section will be rather short because I’ve already been through and exhausted most possible leads I’ve found, and this is what remains. Since the post is in English, and I think everyone that follows me presumably knows English (если вы не говорите по-английски, я хвалю вас за то, что вы зашли так далеко) I won’t summarize it, so I’d recommend reading the Vitin post and then coming back.

We see in the post the mask of “Muu Shubuun,” which we’ll immediately notice is almost the exact same mask as is used by the Executors in the game. Actually, in the Marble Nest, you can acquire the Executor mask, and its touch text reads, “The mask of Muu Shubuun, ‘the wicked bird.’ Part of the Reaper costume from the local theatre.” I have found several different sources that lead me to believe this is based on actual Buryat folklore, however, I’ve heard several conflicting accounts on whether Muu Shubuun is an evil spirit that tricks people by taking the shape of a beautiful woman, or if it’s closer to what we see in the game/ARG, but both seem to be documented as existing within sources on the Buryats. I think this confusion between the two likely means the stories and connotations associated with Muu Shubuun vary based on different groups of Buryats. An alternate spelling I’ve seen used is “Mu Shuvuu.” Possibly related to this is the character “Shar Shuvuu” (which means “eagle owl”), who appears in The Marble Nest during the “marriage” scene in the steppe camp behind the cathedral. In fact, a surprisingly high number of NPC characters in this DLC are named after birds.

The phrase used in the post to describe a seasonal festival, “dosoo ba beshē tēēhēē” is where I’ve devoted much of my research, with most of that research being from about a month ago. Only the third word in this phrase, beshē, appears as a kin word in the games as far as I know. However, we can use a method here that people in the Pathologic community have been using for years to figure out the meaning of kin words: Most of the steppe language in the game is based on one of many languages: Buryat mostly, Mongolian sometimes, Tibetan sometimes, and some parts of it also take inspiration from other languages of similar origin to these. A majority of the language seems to be based on Buryat, and many Kin words come straight from the language. A few words in the game seem to be made up entirely by Ice-Pick Lodge, and many are based on words from the aforementioned real languages but tweaked slightly, as if to indicate that the steppe language spawned from those languages but has some distinctive elements. To determine what this phrase means, I tried my best to dig into the languages and find parallels:

“Dosö” in Buryat means “inside”

In Mongolian “dooshoo” means “down”

In Mongolian “ba” means either “and,” “we,” or “sorcery”

In Tibetan, “ba” means “cow”

“Beshē” in the game’s steppe language means either “not” or “other”

The prefix “të-” in Buryat means “to transport”

In Mongolian the prefix “te'e-” also means “to transport”

As for the “-hee” part of the word, I have not found a single source that could tell me what it means. I’ve found several Buryat words that end in “he,” but I can’t seem to find a connection between them strong enough to suggest what it denotes.

Upon first seeing this festival mentioned, I believe I commented somewhere on the Pathologic subreddit that it might be the same one we see in the Kin’s camp behind the cathedral in The Marble Nest. While I’m not 100% convinced still, I also don’t doubt it that much. One interesting thing to note for any people that might wanna investigate this in the future is that I’m pretty sure what we see in the Marble Nest is the same thing that Nara and the Haruspex perform in the abattoir, as they both seem to happen on day 10, and if you look close you can see that Nara is the one that is cut open in The Marble Nest. Seemingly with the Haruspex gone, there is no one that knows the lines and so the ritual doesn’t go as smoothly as it could.

“Messages” Fyodor Vitin Post:

This particular Fyodor Vitin post is the third one, which if you know Ice-Pick Lodge certainly has some importance to it. The post is a series of letters and images, one depicting an Executor and one depicting Voronika Kroy, who's a minor character in Pathologic 2 and the main character in the Pathologic Feverish Feelings ARG. The letters detail how the recipient’s reports about Voronika Kroy have been seen and have started an investigation by the Federal Bureau. What’s most interesting to me are two things: the jumble of (Latin alphabet) letters in the bottom left, and the number used within the letters (the post-card letters in this case).

The number in question is “196-17-1” which is apparently the case number used for the Voronika Kroy investigation. This number will be more important later in relation to other clues. One interesting thing I've found is that the RGB value for 196-17-1 is a deep red.

The jumble of letters at the bottom of the picture is “eiamrucdvrturxoevecid”. It is 21 letters and can be divided up into chunks of 3 or 7 letters. 3 and 7 of course being Ice-Pick Lodge’s favorite numbers. Up until this point, it has been assumed that this is an anagram, and I have no reason to doubt that. It has already been pointed out in the Pathologic subreddit that the words “Executor” and “Corvid” can be found in the anagram, as well as the Latin words “Cura”, “Curare”, “Curari”, “Medici”, and “Vivam.” Credit for finding the Latin words goes to u/apostforisaac who is apparently studying Latin at university! Additionally, u/Own_Sympathy_9814 deduced a possible meaning by unscrambling the anagram and finding “MAVRUD + VERIDIC + EXECUTOR”, which they believe hints toward the answers lying in the Marble Nest (I wrote the entire Marble Nest section of this post before finding their post about that, so I do feel pretty validated by it). Many people have been approaching this anagram, like many other parts of the ARG, as if they have one right answer, and frankly, I just don’t think that’s in the style of Ice-Pick Lodge. I’ll quickly list out some words/phrases I found in the anagram and what they mean/how they could relate. I will also include words that have already been discussed, and they’ll be marked with a “*” so you don’t think I found them. Most of the ones marked with a * I won’t be discussing, as most have already been discussed extensively. I also won’t be discussing the ones that I think probably don’t have much meaning, but I’m including them because it still could be something later on down the road.

I am You don’t actually even have to unscramble the letters to get this one, as the second, third, and fourth letters of the jumble simply spell it out. What's interesting is that the 7 "I am" discourses are a crucial part of the Christian Gospel according to John. The Gospel according to John was an important clue during the Feverish Feelings ARG, which revolved around Voronika Kroy and her Inquisitor father, Peter Kroy. If we're speaking of the four canonical gospels, we must also address the Gospel according to Mark, which coincidentally is the name of an inquisitor that has popped up elsewhere in this ARG. Following this theme, there is actually a non-canonical Gospel According to Peter, which seems too cool to be a coincidence.

Eve This is one you don’t have to unscramble also. Interestingly, Daniil is often compared to a snake, even being called a snake-man in Marble Nest by Shaazgai, a man belonging to the Kin. In the biblical story of Adam and Eve, it is a snake, often thought to be the devil, that convinces Eve to eat the forbidden fruit from the tree of the knowledge of good and evil.

Retroviridae The scientific name for a retrovirus. If I was more knowledgeable about biology I would say more, but this seems important.

Rex Iudaeorum Translating in Latin to “King of the Jews,” this was the inscription that allegedly was put on the cross that held Jesus of Nazareth, as detailed by 19:19 in the book of John. Very interesting as Daniil does compare himself to Jesus at least once in the Haruspex route, on the night before Aglaya comes. The Gospels, as discussed before, all detail the life and crucifixion of Jesus Christ. The "19" connection is also interesting because of the inquisitor detail, and I'll talk about more of the connections to 19 later in the post.

Cardio Commonly used medically as a prefix for heart conditions, “cardio” is a Latinized version of the Greek “kardia,” which simply means heart. Heart imagery is very common and significant to the Bachelor.

Eva This is similar to the Russian version of Eve.

Corvid*

Cura*

Curare*

Curari*

Medici*

Vivam*

Mavrud*

Veridic*

Executor*

Order Could relate to the committee in The Marble Nest and the fact that after they’re replaced by tragedians the absurd order begins getting sent out to the orderlies.

Carex ericetorum This is a plant that would almost definitely be present in/around the Town on GorkhonThis is a plant that would almost definitely be present in/around the Town on Gorkhon

Creature

Marble Nest:

The Marble Nest, as we know, is very concise, only really lasting half a day in-game. Because of this, the dialogue does tend to feel a lot more intentional, as though the named characters are not necessarily speaking only to The Bachelor but also trying to convey a message to the player. This, of course, is because The Marble Nest takes place inside Dankovsky’s head. If this ARG will be revolving partly around The Bachelor, as it seems to be, then there’s no better place to start than digging into his head, which is why I’ve played so much of the Marble Nest for this.

There are several specific stories/myths/historical figures that are mentioned through Marble Nest. First, we’ll go through some of these.

There is a very interesting conversation that The Bachelor has with Georgiy Kain, where he is trying to justify his decision to lift the quarantine restrictions to The Bachelor, who is rather upset obviously. I’ll cut down and paraphrase most of the dialogue, since if I didn’t this would be much longer, but basically the conversation goes as:

[Georgiy introduces himself, and says he decided to let The Bachelor sleep so that he would have the strength to face the upcoming trial] [Daniil asks if Georgiy lifted the restrictions and let the plague into The Stone Yard] Georgiy: “Quite so. It's plain to me that you are on the verge of shredding me into pieces. But still your wrath. As a great Athenian once said, ‘Strike, if you will, but hear.’” Daniil: “Themistocles, I know. He met a rather gruesome end, by the way. Died of plague.” Georgiy: “No, it was Pericles. You are a learned man, but history is not your strong suit. Which is why you should listen to me. Perhaps it will help you see something that you missed in your previous studies.” [Georgiy then goes on to explain a bunch of other stuff about the plague, which as far as I’m concerned isn’t all that useful to the task at hand.]

I find this so interesting because The Bachelor, in his own head, poses a question to himself, gets it wrong, and then has another separate figment of his imagination correct him, and then proceeds to tell The Bachelor that he’s not great at history and should listen to Georgiy more. What’s even more interesting is that, as far as I can tell, Georgiy and Daniil are both wrong, it was actually Themistocles that said “Strike, if you will, but hear,” and it was Pericles that died of plague. I found this interesting enough to look into who Themistocles and Pericles were, and here’s what I found:

Themistocles was a politician and general that broke the mold by being non-aristocratic and populist, which gave him the support of the people but put him at odds with the nobles and some of his peers. He turned 30 in 494 BC, which qualified him to run for the position of Archon, which he did, and won the position the following year. He had a prominent rivalry with another politician named Aristides. Whereas Themistocles was populist, Aristides primarily fought for the upper class. Themistocles eventually 20the rivalry after Aristides was exiled. Years later, though, Themistocles himself was exiled, and while he was gone his enemies took the opportunity to charge him with treasonous activities, knowing he could not defend himself. Because of this, Themistocles could never return to Athens, and so found employment and a home among the people that he once fought against while serving Athens. Given military command once more, he was actually Themistocles who said “Strike, if you will, but hear,” and it was Pericles who died of plague. I found this interesting enough to look into who Themistocles and Pericles were, and here’s what I found: Pericles, to me, has less interesting things about him in relation to Pathologic, with the main two being that he rehabilitated the image of Themistocles and he died of a plague. What could be interesting is the fact that General Block and Captain Longin are in both Pathologic 1 and 2 often compared to Achilles and Patroclus, two Greek soldiers from ancient folktales, primarily known for being two of the most important characters in The Iliad. To me, drawing a connection between Achilles and Block, as well as Pericles and Longin, isn’t that absurd. What could also be interesting to note is that Pericles was the main character in a play written in part by William Shakespeare. While Themistocles' life almost exactly fits the character arc of General Block, down to the weird connection between him dying of the plague in The Marble Nest and Themistocles drinking bull blood (as well as Dankovsky thinking Themistocles died of the plague), I think how Pericles fits in could lie in the Shakespearean play, as we all know how important theater is to Pathologic. You see by now at least partially what I think this alludes to, but I’ll talk more about it in the additional notes section.

Next, I’ll discuss a mythical story brought up in the Marble Nest: The Tower of Babel. This is brought up by the clerks sitting directly outside Georgiy Kain’s house. I think most people would talk to these guys right before talking to Georgiy, but I have more to say about it so it’s written second. When talking to one of the clerks during their argument about the plague, one man mentions that he thinks The Polyhedron is at fault, and no matter how Dankovsky replies (he has 3 options), the man then says “History already knows an example of people trying to erect an impossible tower. It ended in tragedy.” I could go on explaining why I believe this guy is talking specifically about the Tower of Babel, this post is already long enough so just trust my reasoning here, please. Notable to the point I’m trying to make, one of the other clerks brings up that he thinks the plague was started because of the irreconcilable differences between The Kin and the town, and the fact that the Kin have been forcibly mashed into the town. When Dankovsky asks the man if something is holding the Kin in the town, preventing them from leaving and returning to the earth, the man says “Someone is… our rulers. They have embedded the steppe people into this town, carved them into its warm flesh. This isn't a town, it's an honest-to-God minotaur. A chimera. And chimeras have remarkably short lifespans and bad health. Can you breed a snake and a crane? You can, yes. But the progeny won't live long.” This dialogue is interesting for a few reasons, one related to the tower of Babel and two related to other possible ARG clues. The first interesting thing is that what he’s describing, drawing a connection between the Tower of Babel and the Polyhedron, actually makes a lot of sense. To him, the Polyhedron is not only an affront to God, but its accentuation of human hubris coincides with a beating down of nature and the earth, represented in part by most of the Polyhedron’s mass being concentrated far above the earth while also piercing the earth’s heart. The story of the mythical tower, to oversimplify it, is essentially a tale of people from many different walks of life all coming together to construct a giant, seemingly impossibly tall tower in order to avoid the possibility of a second biblical flood destroying most of humanity. God sees this attempt as an affront to both him and the natural order, and so before the men are able to finish the tower he divides them all by making them speak different languages, making it impossible for them to understand each other. So, in this second clerk’s interpretation, the plague is a result of the town both rebelling against/abusing nature and also taking the Kin into itself. Unlike the first man, who believes the tower itself is at fault, this second one believes it’s all because of the town making itself into a “chimera,” which he believes cannot live long. What’s clear to me, though, is that although these men believe they disagree, their explanations complement each other very well, which brings us to our third man, who has a rather simple but somewhat confusing explanation. This clerk believes that this plague occurred in the town because men should not be “remodeled or altered,” and when asked what that has to do with the epidemic he replies “I don’t know… It wasn't we who designed the world like this. I believe in men, Doctor; in superhumans, I do not. This earthly life wouldn't fit them. Immortals have no place in the world of the living. This is just how it works. Take from it what you will.” This man seems to be implying that Simon Kain, the immortal man, is the reason why this plague appeared in the town. This is when it all started to come together for me: these men's stories do really all complement each other, because here they are posing the Polyhedron, chimera, and Simon as all the same. This will further be explained in the additional notes section. Three parts of one whole if you will.

Now, the mention of the Tower of Babel is interesting for two other reasons, one of which will be discussed in the additional notes section and one of which I’ll discuss here. In the Fyodor Vitin “One can work here” post there are numerous items displayed in the room pictured, but perhaps most interesting to me is the golden bull statue that sits at the front and center of the photo. My first thought when seeing that image was “Oh! This reminds me of the biblical story of the golden calf statue, which I bet is what they’re referencing.” For those who aren’t familiar, I’ll be oversimplifying another biblical story now. While trekking from Egypt to the holy land, Moses leaves his people behind to climb to the top of a mountain and commune with God. Moses is gone for forty days, upon which the people are fearful that he will not return, and so they molded a calf statue out of gold to worship. God, upon seeing this, sends Moses down to the base of the mountain to punish his people for their sins. Moses burns the golden calf in a fire, ground it to powder and water, and forced his people to drink it. He then killed all of them basically. My thought process was related to the fact that The Bachelor is punished severely by The Powers That Be for his own affront to God, the pursuit of immortality. Now, after that previous discussion about the Tower of Babel, I am noticing some very interesting things in this picture, and primarily that there are two other related statues. Now that we have the previous context about The Tower of Babel and the clerks in our mind, we can see new meaning in these statues: a black statue of a centaur, and a white bust of a man. The interesting thing about the centaur should be obvious, it is another chimera. The bust of the man, which seems to be made of marble, reminded me somewhat of ancient Greek statues that are chiseled to glorify certain leaders and make them seem somewhat perfect while also immortalizing them in stone. You can probably see the connection I’m making here, and so I will leave the rest of the explanation for the additional notes section.

Another thing that's interesting to note is the aforementioned three men, unlike most characters in Pathologic 2 and the Marble Nest, do not stop moving when you pause the game; their animations continue to play even after you bring up the pause menu. If you’re unaware, there is actually a small detail in Pathologic 2 where pretty much everything nature-based or that is a natural force of the world, as well as everything that’s supposed to be seen in a meta-narrative sense, does not stop moving when you pause the game. This includes rain, leaves falling, the particle effects that come off the clocks, fire, executors (not orderlies), plague particles, etc. Once I noticed this (while trying to get a screenshot of some things to analyze) I tested out some other NPCs in The Marble Nest, and all of the other people I tested seemed to freeze when the game was paused. However, this is not to say that no other characters in the Marble Nest move when the game is paused. I only tested about 4 guys besides the primary trio we're discussing, mostly just to make sure it's not a thing that all Marble Nest characters do. If one of you people reading this would like to go through and see which characters in The Marble Nest also possess this trait, it could prove fascinating.

Finally, I’ll talk about two somewhat modern (at least modern compared to the previous two) stories that are brought up in The Marble Nest, although not directly: The Time Machine by H.G. Wells and The Masque of the Red Death by Edgar Allan Poe. Admittedly, I have not read either of these stories (it’s possible I read the EAP story 5-6 years ago and just don’t remember it), but I do actually know quite a bit about the stories and their themes from a couple of literary studies on specific genres I’ve done over the years. Additionally, for this section, I have done some more research on the plots and themes of these stories which yielded fascinating results.

The Time Machine is brought up when The Bachelor visits The Cathedral and speaks to a Tragedian standing within. The Tragedian talks about how the building is not a temple, but a machine. Daniil asks what kind of machine, and The Tragedian responds “This is a time machine. Time works differently on the inside and on the outside. It's frozen now. I think something's broken.” To which Dankovsky can say “A time machine? Are you saying it can transport me to the past or to the future? Like in that Englishman's book, what's his name…” For this, I did some research into what book he could be referring to, and almost instantly Time Machine stood out to me for a number of reasons. I think there might be something interesting to be said about how this relates to the ARG, but I’m not going to be the one to say it, because I’m honestly not sure how or if it does. I will describe how it connects to Pathologic though, in case that sparks anyones mind. The work is apparently seen as popularizing the idea of time travel and the time machine, which relates to what IPL has said about The Bachelor’s route I suppose. As for the plot, it’s about a Victorian man using a time machine to travel to the year of A.D. 802,701. He meets two races of people, one descended from the oppressed working class and one descended from the pampered owning class. Over hundreds of thousands of years of this lifestyle, the two races have started to diverge, with the owning class becoming child-like and basically useless, while the working class has been forced into a life of toil and hardship which has shaped them into a race of underground-dwelling animalistic race of people. Essentially the novel is a depiction of class struggle and the class contradictions inherent within capitalism, but with a bit of a metaphorical twist. The toiling of the working class underground is what allows the upper class to live in abundance without the need for work. There is very interesting commentary here to be made on the worms/odonghs in the game, as well as the eternal youth that is present in some elements of the stone yard, but this isn’t a Pathologic essay, it’s a Pathologic ARG essay.

The Masque of the Red Death is alluded to by The Bachelor in a dialogue with a wandering citizen, who opens up the conversation by saying “A masquerade ball will be held in the main square this evening. People want to celebrate our victory over the sand pest. You don't mind…?” To which The Bachelor has 3 possible replies, one of them being “I seem to vaguely remember a rather famous story about a masquerade held to celebrate a victory over a plague. Remember how it ended?” To summarize, The Masque of the Red Death is about a group of noblemen taking refuge in an abbey to hide from a plague (the plague is known as the Red Death). The plague’s symptoms are gruesome, and all people who contract it apparently die within a half hour. The main character, Prince Prospero, and his fellow noblemen believe themselves to be entirely safe, though, as they have welded shut all the doors and isolated themselves in the abbey. To entertain the guests, the prince holds a masquerade ball that takes place in seven of the rooms of his abbey, each colored differently. The first six rooms are blue, purple, green, orange, white, and violet, with the last being black and illuminated by a red window. No guests venture into the seventh room, as they are all scared to enter it. Every hour a clock in that room chimes, upon which the guests freeze and go silent momentarily, before resuming normal activity once the chiming stops, only to do the same thing after an hour. Once midnight comes, a person appears in robes covered in blood and resembling a funeral shroud, wearing a mask that depicts a person clearly infected with the Red Death. This figure walks through six of the chambers before the prince starts chasing them with a dagger. Confronting them in the seventh room, the prince immediately falls dead upon seeing this person’s face. The other party-goers all charge the figure, stripping them of their clothes and mask, only to find that there is no one underneath. The conclusion of the story states that the figure was not a person, but rather an embodiment of the Red Death. The Red Death also appears as a reference in the novel The Phantom of the Opera, as well as several film and musical adaptations. The titular phantom dresses up as The Red Death, and in many adaptations wears a skull mask as part of the costume.

I believe Hamlet is also brought up at some point in The Marble Nest, but I can’t seem to find the dialogue so I’m unsure if that’s true.

Next, I'll talk about another random Marble Nest clue

The Bachelor’s hover text for the beetle item says “I used to collect these as a kid. Left the collection with my father.” @pseudoquiddity found that a paper on the top of “The Beginning” Fyodor Vitin post spells out Mechnikov, which is almost definitely referencing Ilya Ilyich Mechnikov, who was a Russian zoologist and immunologist who achieved incredible scientific discovery during his life, and notably for us he was largely focused on the issue of aging and extending human life. Mechnikov was actually brought up in an IPL teletype post as one of the Bachelor’s main influences scientifically, alongside Albert Einstein and Max Planck. The relevant thing about Mechnikov here is that, as a zoologist, he did many notable studies on insects throughout his career to see how their bodies reacted to things compared to how ours did. One thing that’s interesting to me is that the type of beetles we see in the game, I believe, are based on Trypocopris Vernalis, commonly known as the spring dumbledor or spring dor beetle, which is not known to inhibit the region that the Town on Gorkhon would reside in. Another thing I find interesting is the touch text from the Alpha version of the game, which reads “Some fifteen years ago, the Soul-and-a-Halves, the gang of children who are defined by sharing special bonds with their pets, actually considered to allow flower chafers as their "Halves" due to the beetles ‘looking as though they knew something’. The idea was quickly abandoned as ridiculous.” Maybe I’m just 8.6 thousand words into this post and have finally gone insane, but I think the beetles “looking as though they know something”, combined with their close connection to Dankovsky, it seems too intentional.

In the “Feverish Feelings” ARG, the Beatles (the band) were brought up indirectly and used by the players as a clue to get more information. This also related to the clue relating to the Gospel according to John. Additionally, speaking of Mechnikov, u/Fantastic_Advice5593 theorized that the numbers on Daniil’s train ticket from one of the original ARG notes could be hinting toward the date May 15th, or 5/15 (15/5 if you use the non-American dating system I believe), which is Mechnikov Day, and is commonly recognized as Mechnikov’s date of birth. Proving this connection further, the “Messages” Fyodor Vitin post was posted on May 15th. Another interesting thing is that if we convert the time that the “Messages” image was posted to the time scheme used in Pathologic (that is, a 24-hour clock), it comes out to 19:35 (Using GMT+3 time zone, as that’s where Moscow is located.) This is interesting because “Messages” was also posted 19 days after the previous post, and I know for a fact that 19 is an important number in this ARG: The newspaper from the “The Accident” post was labeled as issue number 19, the bible passage that we saw referenced in the anagram from the “Messages” post is John 19:19, the jumble of letters that we found in the touch text for the unused lantern item includes “19,” and so does the 196-17-1 number from Messages. In a way, the number 19 is sort of a self-checking method to substantiate some of the clues we’ve found thus far.

Griffins’ Tower

Many of the details in this section wouldn’t be possible without @kurury-chan who, upon my inquiry about the tower and its accompanying pharmacy, actually visited it, got tons of cool pictures, and translated a ton of the history for me! I literally cannot thank her enough for her help with many elements of this post, but especially in this section. In the original Pathologic ARG, “Feverish Feelings,” the Griffins’ Tower is brought up a couple of times throughout, and was part of an intensive fandom discussion because many elements of it paralleled many themes and plot points of Pathologic. The following connections/possibly related facts are a combination of fandom discussion from the time and my own research:

The tower is connected to a pharmacy that has existed since the 18th century. Both were once owned by the Poehl family, who were a rather eccentric yet somewhat mysterious rich family. Rumors from the time (The 18th/19th century) speculate that members of the family engaged in “…alchemy and witchcraft, and in the basements of the house he turned mercury into gold and bred griffins. Since ancient times, it was believed that griffins, mythical creatures with the body of a lion and the head of an eagle, were the guardians to secret sacred knowledge and treasures.”

In 1994, the artist Alexey Kostroma, together with the society "Here and There" (Tut i tam), organized a demonstration/art-piece to advocate for the preservation of the tower and the revitalization of the city, which they believed was falling apart before their very eyes. During this demonstration, they hoisted a large egg (approximately 1.5 meters) onto the top of the tower, and they painted (I’m not sure what was used to put the numbers on the tower, but I assume it was paint) numbers on almost every brick of the tower. While the purposes for the those two additions rarely get brought up in conversations surrounding it, the egg and the numbers are now some of the most well-known parts of the tower, despite the fact that neither of the two are there anymore. The Polyhedron, as we know, is a tower that at the top houses children and is made from its own complex blueprints. Additionally, in the Marble Nest, but also throughout Pathologic as a whole, there is a common piece of imagery that connects eggs and the Utopians. In the opening of The Marble Nest, the item that’s used on the loading screen is an egg. If you look at the egg sprite in P2, you’ll see a crack in it that heavily resembles the Polyhedron. Daniil Dankovsky commonly uses the Latin phrase “ab ovo,” which means “from the beginning” but when literally translated means “from the egg,” and his touch text for the egg in Marble Nest reads “To understand anything, start ab ovo — ‘from the egg.’”

While playing through The Marble Nest several times for this ARG, I noticed something that gave me more confidence in The Griffins’ Tower playing a role in it. If you guys have played Pathologic as much as I have you’ll know there’s a tower in between the Stone Yard and the steppe that you can’t enter and is barely ever really explained. If I’m picking apart my brain correctly for Pathologic 1 knowledge, I believe it is implied to be a Focus of some sort. If you’ve only played Pathologic 2, or you haven’t played through The Bachelor’s route in P1 enough, or you haven’t read through the Pathologic “Corpus” entries, you probably have an incomplete idea of what a “focus” is and all that it entails. I won’t go too deep into it now, but it’s said in one of the Corpus entries that, on top of the Polyhedron, Cathedral, Stillwater, Crucible, etc., there were a number of experimental Focuses that were built for Simon Kain to test the limits of what buildings could capture the human soul and memories. It’s a building you can’t ever enter, but it does have a visible door, which is very similar to the way that Simon’s focus is described by Victor Kain. I’d like to draw your attention to the visual similarities between that tower and the Griffin Tower. I’d also like to draw your attention to the fact that, in the original design concepts of Pathologic 1 every character is associated with a specific animal, and Simon Kain’s is a griffin. What is a griffin? Well, it’s a fusion between two drastically different creatures, a lion and an eagle; a griffin is a chimera.

Interestingly, in 2005 (the year Pathologic came out) the pharmacy connected to The Griffins Tower was closed for a while because it became flooded with water while trying to extinguish a fire.

There is a photo in the pharmacy connected to the tower (which has now been converted into a museum about the history of the place and pharmacies in general) that depicts, during the early 1900s, the pharmacy sitting next to a theater called “Simpatiya” (Sympathy).

While @kurury-chan was on a tour of the pharmacy/museum she found an interesting marmite that was on display. It was created by Samuel Clarke and it’s called “Pyramid,” and the marmite has an accompanying poem: Когда ночи темные, подумайте о Кларке, который попал точно в цель. Его ночные огни создают светлые ночи, в которых вы прекрасно видите. (When the nights are dark, think of Clark hitting the mark. His night lights create bright nights in which you can see perfectly) This is interesting largely because the poem reminds me somewhat of the body text for the lantern ad found in the newspaper post.

In the original email mentioning the Griffin’s Tower, Voronika Kroy appends the message by saying “P.S. I feel like I’ll need this memory later.”

Seventh Seal

I watched this movie after discovering all of the allusions to General Block we’ve seen thus far, but being unsure what to do with any of them. For those that don’t know, the movie The Seventh Seal’s protagonist Octavius Block has been listed as one of the main inspirations for Alexander Block, and since IPL seems intent on leading us to analyze certain works of literature/film/theater for this, I decided to look into it. What I found is incredibly interesting I think, because it seems that one of the main inspirations for The Marble Nest is The Seventh Seal.

The title is based on a bible verse (from the Book of Revelations) that reads “And when the Lamb had opened the seventh seal, there was silence in heaven about the space of half an hour.” This verse appears both at the very beginning of the movie and then again toward the end. This thirty minutes/half-an-hour element appears prominently in both this story and The Masque of the Red Death. One other place it appears is on the pocket watch in the first Fyodor Vitin post, where the time on it is 2:30. I am very confident that it also appears in The Marble Nest once or twice, but despite looking I was unable to find it. If anyone else knows where it might be, either comment on this post or message me, and I will put it in this section and credit you.

The movie's plot revolves around Antonius Block, a disillusioned medieval knight returning from the Crusades. Block is struggling throughout the movie with his inability to believe in God and his realization that his whole life has been wasted. He wishes more than anything to do one last deed before his death to give his life meaning. The movie is set during the Black Death, with prominent elements of the story revolving around the plague. The movie largely focuses on how Block takes in several poor and out-of-luck folks fleeing the plague, inviting them to stay at his castle and escorting them along the way.

Toward the beginning of the movie, Death comes to take Block, but he convinces Death to play him in a game of chess for his life. This game of chess continues throughout the movie, with Death allowing Block to take several breaks in order to find clarity about his life and death. Toward the end of the movie, he allows Death to take his queen, effectively ensuring he would lose the game in the next turn, so that his companions could get away without Death noticing. After returning to his castle, everyone has a nice meal before Death arrives and takes everyone, excluding the people that Block helped get away by tricking Death.

Many things from Pathologic seem to take inspiration from this movie; most notable being the storyline of The Marble Nest (Dankovsky’s “People” screen categorizes people as chess pieces, essentially implying that his struggle against death is a sort of chess match), but there are also some smaller things. For example, there is a scene where the characters encounter someone afflicted with the plague who cries out for help, and one of the women tries to get closer to give the man water, but another person stops her, as giving water to a plague victim is futile and dangerous; almost immediately after this, a personification of Death appears. This heavily reminds me of the intro/tutorial of Pathologic 2, where a similar scene occurs.

While watching the movie, it’s very easy to see how Block was directly inspired by the main character, but it’s hard to convey exactly how without describing many scenes in detail, so I will simply describe one of them. After leaving a church confessional where he admits to his faith faltering and wanting to perform one meaningful deed before he dies, Block encounters a young woman who’s about to be burned at the stake for allegedly having ties to the devil. He takes pity on this woman, seeing something special in her, and believes she can tell him about life after death. This, to me, seems very reminiscent of Block’s storyline with the Changeling in P1.

Another small lead before this part of the post is finished: This lead, I will admit, I stumbled across completely at random, and will not talk about much because there’s not much I can say about it that isn’t obvious. It might be worth looking into the Russian philosopher Nikolai Fyodorovich Fyodorov, and perhaps thinking about if Fyodor Vitin was based partially on him, since we know Vitin works closely with Daniil.

Additional Notes/Comments:

In the newspaper clipping, it is said that a man with the initials “F.L.” had been one of the apparent two victims of the fire that burned down several buildings. This man (who I’ll simply refer to as “F” from now on) is an academician, historian, and writer of everyday life, which obviously fits well with the man that we know as Fyodor Vitin, and it has been assumed up until this point that he was the victim of this fire. I think there are three possibilities here: Fyodor Vitin was not the victim of this fire somehow, Fyodor Vitin is not his real name, or the newspaper is lying to us. In connection to the light/lantern emphasis in the newspaper, it might be worth it to note that the word “vitin” in Faroese means something like “the lighthouse”/“the beacon”, while in old Swedish it means something like “to know.” What’s more interesting is that Vitin in old Swedish is a second-person plural present indicative, and for people that got a useful education, that means it’s a verb that’s used to factually describe the current actions of the people that the speaker is saying it to. If Vitin isn’t his real surname, his username could mean “Fyodor beacon”, or “Fyodor (that you all) know”.

As discussed extensively in the section on the Tower of Babel, there is a direct connection drawn between the Polyhedron, Simon, and chimeras. We elaborated a bit on this connection in the section on the Griffins’ Tower. What’s especially interesting then is the fact that, in The Marble Nest, the Polyhedron is labeled as “focus,” implying that Simon’s essence is infused in the Polyhedron, as is what happens in the first game. This, I believe, confirms our theory about the connection even further. What then makes this even more related to the ARG is the fact that in the “One can work here” post by Fyodor Vitin, we see the three statues depicting the golden bull, the centaur, and the marble bust of a man. It is then worth noting that this bust of a man made of marble could be a reference to The Marble Nest, perhaps trying to get us to look there for clues. I believe, if the golden bull is meant to represent the Polyhedron (or at least the Polyhedron argument in The Marble Nest), and the centaur is meant to represent the chimera, then the marble bust of the man is meant to represent Simon (or, once again, represent the Simon/immortal man argument from the Marble Nest). This is supported by my point about the marble busts both immortalizing men and also making them more into concepts than men (as the statue can only depict a small part of a man’s life, usually depicting him in battle, leading a governmental position, etc). In the original game, and as can slightly be seen in hints of the second game, Simon is sometimes seen as more of a concept than a man; he is the ideology of the utopians incarnate, the perfect man that represents everything humanity could be. As a chimera is vital to Burakh’s quest, so too is it vital for Dankovsky’s (and it’s interesting to note that Burakh has the chimera revelation while in conversation with Dankovsky.) If the Marble Nest is used to represent the stone yard, or the “town” in its purest form, then Simon Kain is the marble man. It then becomes important to figure out where the “One can work here” picture is supposed to be depicting. I believe, if the statues there are supposed to represent all that we’ve said so far, the location should be representative of Dankovsky’s fight against death, and therefore I say it probably has to be Thanatica.

Now, as for all the connections with General Block, there are obviously many of them, from the Guglielmo Pepe hypothesis to the mention of Aristides/Pericles to The Seventh Seal to the whole “ash” thing, it seems far too much to be a series of coincidences. I don’t think it’s too crazy to connect the prominent appearance of the number 30 in the Block/Pepe/Aristides context to the prominent appearance of the number 30 (as in half an hour) in The Seventh Seal, which makes the appearance of the number 30 in that first Fyodor Vitin post even more interesting. It’s long been theorized that, from what we see in the Haruspex’s route and what we’ve seen in Pathologic 1, the Bachelor’s new route will probably feature General Block much more prominently. Perhaps, as the first ARG was so focused on the inquisitors, we’ll also get to learn more about the army in this one. Maybe General Ashes even had something to do with the building that was reduced to ashes?

The topic of religion, and specifically Christianity, comes up a lot in The Marble Nest. I think all the connections I’ve made in this post to Christianity have convinced you that it’s seemingly an important part of this ARG. In the first ARG, there were certain biblical passages that acted as clues, specifically from the Gospel according to John, which we talked about in the section on the “Messages” post. As is also mentioned in that section, the connection to Inquisitors Peter Kroy and Mark Karminsky seems to be driving us toward looking into The Gospel according to Peter and The Gospel according to Mark. It’s also talked about in that section how these both relate to Daniil. Mark Karminsky specifically also seems to have had something to do with the "Accident" mentioned in the newspaper, and so perhaps combining numbers from the newspaper within the Gospel of Mark could lead to some clues.

Still, as much as I’ve said in this post, there is more I wish to analyze but have not yet. This post has been in the works for a while, though, and I don’t want people to be waiting any longer, so I’ll have to save that other stuff for another day.

If anyone can somehow get into the game files of the Marble Nest and retrieve the texture/model for any of the letters or books (like the two linked images), that will end up being very helpful.

Other screenshots from Pathologic 2/The Marble Nest that could be of interest:

Grigory Gorky (Pathologic 2) Grigory Gorky (The Marble Nest) Mikhail Goba (The Marble Nest) Daniil Death Certificate (The Marble Nest) Rug (The Marble Nest) Book (The Marble Nest) Familiar Bloody Handprint (The Marble Nest) Tipped Over Lantern (The Marble Nest) Staff Sergeant Plover (The Marble Nest) Avrely Gubar (The Marble Nest) Odd use of Roman Numerals (The Marble Nest) Cathedral Letter (The Marble Nest) Plant that I found several times in the Cathedral (The Marble Nest)

#pathologic #pathologic 2 #pathologic arg #daniil dankovsky #мор утопия #Bachelor ARG

153 notes · View notes

born-in-hell · 29 days

Text

WHY Q!BADBOYHALO IS PROBABLY FED:

SPECIAL GUEST THEORY - THE MASTERPOST

Important Information!

Hello! This post was written in january and febuary, before the workers at Quackity Studios came out with their stories. Ever since then, i haven't been following the QSMP as a server, despite still writing a fic based on it and following the situation with the workers somewhat closely. I just can't care about it as much as i did. Im posting this theory because it meant a lot to me at the time. I truly believed i was right, and that Badboyhalo would be the main antagonist. I even had the throry that the QSMP would end in a dispute between q!Fit (Madagio + The Rebellion) and q!BBH (Fed). I worked for such a long time gathering evidence for, organizing and writing this post that it just feels bad to keep it in. Today (30/4/24), another ex-admin, named Elk, released a statement, that said: "There was an odd rule where main island lore was never allowed to tie into creator-specific lore, despite creators actively wanting to involve themselves with the federation and being permitted to do so and certain creators having a HUGE influence on the overall lore.". This just erased any and all motivations i ever had to make a theory that links everything together. There was never a truly coherent story. Which makes not only this theory, but any and all theories that link the player characters to the main island lore, useless. Being honest, i just didnt want this post to go to waste, mostly because i worked a lot on it. For that, this post is very much not finished. Most texts are not fully written - my ideas are not as developed as i wish they were. And i apologize for this, i just dont have the energy to finish this. If you want to know my take on the QSMP lore, you can check out my fanfic. Despite all this, I hope you all enjoy this.

---------------------------

This is a compilation of all the evidence we have to support the Special Guest Theory.

I created this mainly to show people that don't have as much free time or are just dont have the energy to think about or remember all this why the Special Guest Theory does make sense.

This is a colaborative work, as I wouldnt be able to think about all this without these wonderful people: @lionheartedmusings @demodraws0606 @lxrd-ren @skullhalo @windchime-of-teeth

---------------------------

Where it all started: The ARG Emails

On Feb 21, Quackity Studios posted this tweet, that had an ARG puzzle.

The "special invitation" also grasps my attention, but it might be coincidental wording.

Decyphering the puzzle, it lead to a Google Doc, that had many emails.

Among them, there was this one:

[Respectful greetings, We are seeking quotes for the purchase of 1393 muffins to satisfy the extra demand of our special guest. For those who are not aware of the situation, it was pointed out that it is an obligation to share two muffins per person in the workspace to guarantee happy and productive work. We wish to receive your commercial proposals as soon as possible. We appreciate your commitment and effort in preparing your offers for evaluation. Sincerely,]

So uhm... muffins right? Who could it possiblly be referencing?

I honestly can't think of no one else besides q!Badboyhalo, even outside of the qsmp, whose brand is so intrinsically connected to this little cake things.

The number is also very specific. If every worker needs 2 muffins, why is the order an odd number? That just isn't divisible equally to everyone.

-> I will make a separate post detailing what i think the 1393 could be referencing.

I want to mention here that, by the way this email is written,

q!Badboyhalo's Teaser Post

Ok, so there are a coulple things to pay attention about this post. First the muffins are a clear reference to Bad (there's no arguing here, he is the muffins guy).

Second, where it was posted; unlike all the other cc teasers ─ that were posted on @/quackity4k, quackity's alt twitter account ─ this one was posted on the official Quackity Studios account, along with the arg post that is.

-> These are the other QSMP cc teasers:

Third, its the only teaser thats accompanied by "welcome to the QSMP". All the others either include something related to the cc (like a bird emoji for Jaiden), or teasing words (closer; up next).

Fourth, the milk emoji. Its curious, and out of place. It is so odd and specific that it deserved to be discussed.

Especially considering that, coincidentally, this is what Badboyhalo responded to the QSMP teaser that i'll talk about later:

Milk is often ─ surprisingly ─ a symbol commonly used with villains in media, to symbolize various things, but mostly to cause a discomfort in the audience, as milk is associated with purity and childhood. So pairing it with ruthless and cruel villains creates an unsetteling atmosphere.

-> Some reference links: 1 // 2 // 3 // 4

The Teaser Video

-> click here to watch the video

The video starts off in a dimly lit room, with some boxes, and, most notably, a tv, a vcr player and a chair. A shadowy figure enters the room, and inserts a cassette on the player. A promotional video of Quesadilla Island starts playing. It shows the figure watching the video, and the scene is interrupted by a black screen with "20 years later" written. It ends with two other shadowy figures (Quackity and Slime, presumably) talking in the train that took the first group to our current Quesadilla.

The only thing that we can notice on this person, is a little white marking on both their left and right hand.

Some theorized it could be qFit, but he doesn't have the marking on his right hand.

Right side /// Left side

The only character, from the first group of islanders, who has a white marking on both hands is q!Badboyhalo.

And q!Badboyhalo being part of the fed in 2003 does also make sense in his lore; he's never mentioned where he was or what he was doing around the late 1990's and early 2000's.

Unlike fit, who was 13 in 2003. He was a child ─ he was only a bit older than q!Cellbit during the war.

This is, in my opinion, one of the most substantial evidences we have of q!Badboyhalo being involved in whatever the fed is doing.

The 2013 War

When qCellbit started researching the fed, as a child, he was forcefully exiled from Quesadilla, because he found out too much about what was going on. Maybe the tests on children (q!Baghera and the other deceased hybrids), as he says this on his letter to q!Bagi:

[...] I saw everything inside, they were doing all this beneath our very feet… it’s horrible, Bagi. You don’t deserve this, I don’t want you to have to live with these guys. So meet me on the other side of this ocean Bagi. I’ll be going now, I don’t care if I have to swim until [...]

-> You can check q!Cellbit's old diaries translated into english on this post

He ended up, somehow, in a war, where he, coincidentally, first met q!BBH.

q!Bad has stated he was in the war to overlook it.

Antoine's Comic

This comic was given it was given, from Cucurucho, specifically to q!Badboyhalo.

-> check this twitter clip of antoine's talk with cucurucho to see the full conversation

The Purgatory Puzzle

Codeflippa lead qBBH, qAypierre and qMaximus throughout the maze, into a white room with a red button. Before activating the button, this was shown to them:

-> Could the asterisks mean Badboy? or maybe Mr. Halo?

They pressed the button, and then recieved this book:

Via a warpstone, they were taken to another maze, this one with a puzzle and two pictures of cucurucho.

After going through some rooms, they found a small pillar, with Dapper's hat on top of it, as you can see here:

Why? Why was dapper's hat there?

If this is a foreshadowing to the fact that Dapper would always be the eggs that would be freed from purgatory, independently from the roulette, than why Dapper?

What makes Dapper special, or different from the other kids, that earned him this, and possibly his life?

The group found themselves in a circular room, with three die. These die, coincidentally, had the same colors as q!Badboyhalo and Dapper: black, red and white.

There was a chest, and in it, they recieved this books:

Badboyhalo was shortly after teleported into the middle of the room, so he could play the game.

He thew the die and got a 7.

He then was gifted this ticket:

Again, why q!Badboyhalo? What makes him different?

It can't be him being a demon, since Mouse and Tina were already on the island.

So what makes him so special that, not only theres a full puzzle dedicated to him (as evidenced by Dapper's hat, and qBad being the chosen one for the game), but he's the first person (not counting q!Bagi nor q!Carre) to get a ticket? He's the only islander that had to go through this puzzle to get it, the other ones were just teleported into the room. Not even q!Max or q!Pierre got tickets that day.

#qsmp #qsmp lore #qsmp theory #qsmp badboyhalo #qsmp fit #qsmp duck #qsmp purgatory #qsmp discourse #qsmp neg #qadmin situation

36 notes · View notes

tillthelandslide · 9 months

Text

Same For You (7) Hate Missing You

Series Masterlist

(6) The Dinner

Series Warnings: slow burn romance, eventual smut, age gap, complicated relationship (low-key unhealthy dynamics), eventual love...

Taglist: @scooby-doodoo @thereisaplaceintheheart @theoriginalwhatsername @eaglestar31 @thefrontofmymind @fallingforel @partoftheairforce @procrastinatinglikeapro @poisonmedaddy13 @xthe1975 @all-things-fic @jstbeeingme @rossgirly @juliardk (add yourself using the link in my bio 😊)

A/n: hi everyone 👋 just wanted to say a huge thank you to all the support on this series so far, it means a lot to me. I hope you continue to enjoy it, let me know what you think, my inbox is always open so share your thoughts, predictions, what you'd like to see, who you're rooting for, whatever 💞 also once again, next part will be posted once this reaches 100 notes :) - love Lou

She had been avoiding both of them like the plague. She had seen Charli a few times, the girls going for drinks a few times, but neither of the men were mentioned once, a clear rule y/n set down the moment they were with each other. She was thankful Charli didn't mention it, she didn't press, didn't demand a reason as to why she didn't want to talk about either of the guys. She had even spoken to George a few times and seen him twice, the two of them chilling in his and Charli's house and sharing ideas for songs, Y/n sharing some demos that George took to work on.

The distance didn't stop either of them from constantly texting or calling her. They both started to get worried when she took a while to reply, or didn't pick up the phone. She would text back hours after their messages were sent, with an excuse, although most of the time they were in fact true, such as "sorry been writing with this artist" which was true, but she had only allowed said artists to book time in with her so she could distract herself.

She was currently sitting in the garage, working with an independent artist called Emma, she had written a song for her and they were currently recording it. She currently was sat alone at her computer, they were taking a quick break so Emma could smoke in her back garden, outside the shed. She's distracted by the buzzing of her phone, Matty's name lighting up her screen with a picture they had taken from the day they got coffee. She had since changed his name, seeing "bestie" every time he called was just confusing her further.

Emma walks back in as she stares at her phone.

"You can take that if you want" she says and y/n shakes her head.

"no it's okay" she says, turning her phone over so their picture isn't staring back at her.

"Nothing important" she tells herself this although she knows it's a lie. She missed hearing his excited voice on the other side of the phone, missed the late night phone calls when he'd ramble about music and art. They finish the song and Emma leaves, by that point it's pretty late at night.

When she eventually looks at her phone she sees 6 missed calls from Matty and 4 messages, 4 missed calls from Ross and 6 messages. She sighs deeply texting both of them the same message.

"Sorry was in the studio working with a girl called Emma" it only takes a minute to receive two texts back.

"Been working a lot recently, don't wear yourself out love... P.s miss you xx" - Ross

"No worries darling, look at you go aye! Miss you xx" - Matty

She ignores both messages, leaving her home studio and returning to her house.

The truth is she misses them both, so much. But she needed time to think, not that she had done much of that. She had been making herself busy so she was distracted and it didn't leave much time to think. She wasn't doing herself any favors and she knew that.

❀•°❀°•❀•°❀°•❀•°❀°•❀•°❀°•❀ •°❀°•❀•°❀°•❀

The band do their usual set in the usual bar in Soho, the same, usual people standing right at the front. Her eyes flick to the back table where they're usually sat, but she doesn't spot them. Charli is sat with George, and their overlapping friendship groups. Carly and Adam are even here. But they aren't there. Ross and Matty...

They hadn't come. She shouldn't really be surprised, not only had she been avoiding the two of them but they were an internationally famous band who clearly had better things to do than seeing a small band perform. She knew they were on a break from touring, hence why she had seen so much of them recently, but she still wouldn't be surprised if they had other things to do.

The cheers from the crowd don't feel as good, not when she knows they aren't there screaming along. She didn't know what she expected, she had brought this upon herself. When they get off the stage her band goes to greet their friends, but she exits the building, grabbing a cigarette from her pack hidden in her pocket. She shakes the thought that she was being rude away from her brain. She hadn't officially met Carly yet and felt bad that she hadn't immediately went over and introduced herself, but she needed a fag, right now.

The door opens behind her and a pair of arms wrap around her frame, a sweet scent following behind them. Charli.

"You smashed it as always" she says, pulling back from the hug.

"Thanks" she murmurs, taking a sharp inhale of her cigarette.

Charli doesn't mention either of the men and she doesn't know whether she's thankful or whether she wants to hear the reason they're not here. She stays quiet, silently smoking her cigarette. The dark haired girl's hands finds her shoulders, pulling Yn so she's facing her. She had hoped they'd be here, that she was forced to see them, she could tell herself it was out of her control, that she couldn't do anything about it. She could pretend she had no other choice, when in reality she just wanted to see them. Being without them both, was torture.

"Hey are you okay? What's going on with you?" She says and y/n sighs deeply. She wants to tell her, she wants to tell her everything. She knew she wouldn't judge and truly she was the only person she could see who wouldn't hate her for the whole situation. The band would say she's messing up their chances. George would probably feel entitled to tell his friends, for they were his best friends in the whole world. And she didn't have anyone else to tell. She couldn't tell either of the men in question because they wouldn't understand and she could (and probably would) lose both of them.

"I'm just tired Char... Promise" she drops her cigarette and allows Charli to pull her into a hug.

"If you need to tell me anything... I'm here" she says and y/n mumbles a thank you. One thing that the absence of Matty and Ross had caused was her close bond with Charli, she was thankful for that.

"Now come join us" so she does, she sits with Carly and Adam, introducing herself to the smiley girl. She compliments Y/n and her band, mentioning "the guys wouldn't shut about you... you put them to shame really" it makes her laugh and the three begin talking about all sorts. Matty and Ross slip from her mind a little bit, not fully disappearing but slightly less present. The group laughs and has fun and she's distracted again. Blissfully blocking both men out. Fairly successfully too.

❀•°❀°•❀•°❀°•❀•°❀°•❀•°❀°•❀ •°❀°•❀•°❀°•❀

A pile of scrunched up papers are scattered around her, the studio floor barely visible through the white sheets. She arrived early this morning, surprised to see George already at the sound board, editing bits and bobs. She has avoided both Ross and Matty for exactly 6 days now, but she knew today that would come to an end, she'd be forced to be near them and she knew that her unclouded mind would be foggy again and she'd be right back at square one, just as confused as ever.

One particular loud sigh (among other annoyed, restless and agitated noises) draws George from his work at the computer, spinning around in the chair and looking at her.

She looked tired, bags were under her eyes and he noticed how her thumb on her left hand was bleeding slightly. He leaves the room, going to the bathroom of the studio and grabbing a sterile wipe and a plaster. He approaches her slowly, leaning down and sitting with her and even that doesn't draw her attention away from her notebook. He gently takes hold of her left hand, bringing it towards him, and that's what makes her look at him.

"What are you doing?" She asks, eyes briefly drifting away from her writing and landing on George's hand. It's a funny sight, his huge hand, the most gentle she had ever seen it, holding hers as he cleaned her abuse. It was a sweet moment, between two friends and she was thankful for it.

"You're bleeding love" the "oh" that falls from her lips before her eyes are back on her book and she's withdrawing her hand from him, tells him everything he needed to know. This was a common occurrence for her, they hadn't spent enough time alone together for him to know what she was like when she was anxious or agitated, he didn't know the tell tell signs of such feelings. But he takes her hand back into his as he tears the packet with his teeth.

"Let me do this for you okay?" He asks and she nods, allowing him to clean the wound, the blood (although not very much) sleeps into the wet fabric and it stings slightly. She flinches and he murmurs a sorry.

"Talk to me... What's up?" He asks. Truth is he didn't know her all that well, but he wanted to, just like Ross and Matty... Well maybe not just like them. He wanted to be her friend. They had spent a fair amount of time with each other but it was mostly for work. Of course, she was easy to get along with and George saw just as Matty and Ross did, that she was kind and a good person to be around. He cared for her already, he supposes that was something obvious about her, she drew people in, even just as friends. They wanted to know her.

"Nothing what are you talking about?" He furrows his eyebrows at her and scoffs.

"The scrunched up and ripped paper around the room says otherwise love"

"I just can't get this song right okay?" She says and he nods as he wraps her thumb in a plaster, letting her take her hand back.

"thanks"

"No worries... Whats the song about?" She thinks it's the first time in the whole time they've been working together, that someone has asked what the meaning of the song was and it throws her off for a second.

"I want to write a song about... how I always go after the wrong guy... Always end up getting my heart broken" she explains and George nods. He pulls her notebook and reads the words out loud.

"My brain twists and turns Craving for a touch that burns Every time I try to put myself first I drown in this pain, my heart might burst I wish it didn't have to hurt so much I'm in a million pieces, my soul I can't touch I'm screaming inside, my emotions I can't clutch" his eyebrows furrow, thinking about he words, before he looks up at her.

"what's wrong with this? It's good"

"i don't feel like it captures how I feel" he nods along.

"how do you feel?" It's a simple question, but the answer is far from simple, she doesn't know how to explain it, which is why she thinks she's struggling to get it into the paper in front of her.

"Okay... We're doing this then?" She asks and George looks confused, furrowing his eyebrows at her.

"What do you mean?"

"If I tell you, you have to promise it doesn't leave this room"

"of course... Now explain" she's thankful that he's there for her, that he wants to know. She's aware this is the first person she would've even hinted at how she was feeling.

"So I always seem to go for guys who just break my heart... And now... Hypothetically there might be a guy who is so god damn good and pure... And what... What if I don't deserve that? What if the reason I loved so hard before but ultimately got my heart broken .. is actually because I just don't deserve it and what if... I'm pushing him away because it might actually be good for once" she asks and George frowns.

"that's what I want to write about"

"Well purely hypothetically... If said guy is perhaps one of my best mates... Hypothetically I'd say you do deserve that love" she shakes her head at his words. She briefly wonders which one he's referring to, but shakes the thought from her mind.

"listen y/n... If you loved the wrong person that deeply, imagine how deeply you'll love the right one... And if they're the right person... They'll love you just as much"

"you're quite wise George Daniel" she leans her head onto his shoulder as a silent thank you and he smiles. She thinks about mentioning Matty, explaining that she felt something (although what and how deeply was not clear yet) but before she gets the chance, the door opens revealing both Matty and Ross who both smile at the sight of the two of them. Suddenly they're both right there again, stabbing at her heart and mystifying her brain , she realises her attempt to avoid them, to ice them out was futile because they're there, clouding her every thought, painting her brain with beautiful hews of Ross and Matty.

"Are you bonding?" Matty's voice rings out and both of them groan as they stand up.

"Shut up" George says as he returns to the sound desk. Matty walks towards her and is quick to pull her into a hug.

"hi" he says smiling down at her.

"Hi" she smiles back. Matty leaves to look at what George has been working on and she takes the time to walk over to Ross, who is smiling widely down at her.

"Hello stranger" he says and she feels guilty immediately but allows him to pull her to him, hugging her tightly. His lips graze her cheek quickly, not able to help himself. He breathes in her hair as he mumbled a "miss you". She's half expecting him to say something about how she was clearly avoiding him but he doesn't and she's unbelievably thankful for that.

She doesn't tell him she misses him back, she just smiles into his chest, finally pulling away when she hears Matty and George talking.

"How was the show on Saturday? Sorry I couldn't make it, Jamie needed me for a dirty hit thing" Matty explains and she smiles.

"Yeah it was good... George and Char came... And Hann and Carly too" she says and Matty raises his eyebrows. Her voice is slightly withheld, withdrawn, distant. He frowns at her, it was like two strangers talking to each other, like this conversation was more of a duty rather than between two friends who were genuinely interested in catching up.

"Good...." He says turning back to George who frowns up at him. She goes back to the papers, collecting the crumpled up ones and discarding them, Ross joins her. And his presence is suddenly too close for her so she stands immediately.

"I'm going outside for a bit" she announces, leaving before anyone has a chance to say anything.

When she's gone, the three guys share a look, and it's a matter of time before one of them speaks up.

"what's going on with her?" Both Ross and Matty ask George at the same time. He feels like a deer caught in the headlights. He quite successfully feigns ignorance, shrugging his shoulders. But then he feels it's not fair on his best friends.

"Maybe you should talk to her instead of asking me" George says, turning back to his screen.

"Mate I've been trying all week..." Matty speaks up

"she's been busy mate" Ross says and Matty's eyes find his.

"You know that's bullshit... She doesn't need to work with other people, she's doing this for a reason" he then argues. Ross cant argue with his logic, he can't find a fault to his reasoning, because it was true. It was obvious she was avoiding both of them, but neither knew why.

"I don't know what you want me to say" George says. Matty is then leaving before Ross gets a chance to attend to her first. He wanted to be the one to console her if she needed it, but of course Matty beat him to it.

"Just leave them mate, trust me... You're good. She's fine" Ross doesn't know what George means, but he shrugs and sits down anyway, eyes trained on the door just waiting for the moment it opens and she's back again.

Matty finds her smoking, nearly at the end of her cigarette. His eyebrows raise at the sight, not knowing she smoked. He doesn't comment though. He stays silent for a second.

"You've been avoiding me... Why?" He asks abruptly making her turn to look at him before turning back away from him.

"I haven't Matty... I've been busy" again it feels like a stranger is talking to him, not someone who he was considering to be one of his closest friends now. Not someone who got him, who he cared deeply for.

"If you say so love..." He inhales a puff of his own cigarette and suddenly her eyes are on him, watching as he breathes it out deeply. She's missed him, that much was obvious.

"Enjoy the vinyl I sent you?" He asks and she nods, eyes trained on the cigarette lying limply in-between his teeth as he talks, his hands clasped around his phone as he types something out. He doesn't see her nod so his eyes snap up, awaiting an answer.

"Yeah... Been playing it a lot recently actually" she says, and it sounds like her again, not withdrawn or pulled back, just her. His friend, his y/n.

"What's your favorite?" He asks and she pauses to think. He shoves his phone back in his pocket, fingertips clasping the cigarette again, his other hand dropping to his side. She suddenly feels the urge to take his hand in hers but she doesn't.

"I love all of them... But Sad To Breathe or Boyhood are my favorites at the moment" she says and Matty smiles.

"I'll tell Amber... She'll love that" she smiles at that.

"Sunshine Baby is a great song too" his eyes sparkle, and they smile at each other. He steps forward and she lets him, he drops his cigarette and so does she as he wraps his arms around her.

"Missed you, y'know" he says, face burying into her hair.

"Missed you too Matty" she admits. He doesn't ask why she was avoiding her again, he doesn't bring it back up and she doesn't know how to feel about it.

"You can avoid me all you want... But don't do that to Ross, he doesn't deserve that" his words are like a ton of bricks falling on her and she doesn't know how to react. So she doesn't, she just nods and murmurs a silly little "sorry"

"Let's get back inside" he says and she agrees, walking back to the studio with his arm hooked over her shoulders as he asked questions about the girl she was working with.

"I actually ended up writing a song after working with her that I really like" Ross and George catch that part of their conversation, both smiling at her before George speaks up.

"Let's see then" he says, she retrieves her notebook from where she discarded it, flicking to the right page, she wonders whether she should show them this. Would this reveal too much? she thinks. She hands the book to George first, his eyes flick over the words as Matty and Ross watch. She stands next to him, bringing her thumb that is wrapped in the plaster to her mouth before realising she couldn't abuse it like usual.

Matty notices the plaster, so does Ross, both wondering what happened. The injury was minor, but the both of them were still worried.

George's eyes find hers and he raises his eyebrows, silently asking "you sure?" she nods at him and he nods back.

"I like it" he confirms, handing her back the book. She passes it to Matty, him and Ross read it together.

Hate Missing You: I'm drowning in sadness without you, can you hear me? Hold my breath and count to three, who am I without you? You're the part of me I cannot see, won't you just let it be? I miss the feeling of being home, I feel lost without you I miss you but the feeling of my heartbeat makes me nervous That way you smile and my heart skips a beat, it makes me dizzy Sorry for the distance, it's tearing me apart, it's hard And there's no way to return your message from my heart So I make myself busy, giving me an excuse as why I can't see you, I can't choose between two halves of myself

They're lost for words, both looking at her, not speaking. She feels unbelievably nervous, awaiting a response that doesn't come for a few moments.

"This is.... its good Y/n/n" Matty says, she senses that its not all he has to say. If she could creep into his mind she'd see all his thoughts and she'd notice there was so many of them. Who was this about? Is this really how she felt? Is she okay? How can he help?

"It's powerful, raw.... its good love" Ross then says, but again she senses that he wants to say more. He wanted to know who this was about. Who got to have these hauntingly beautiful words written about them? Who was the one she missed? And how could he take the pain away?

They begin working on the song, Ross records some bass lines in the absence of Clara, Matty and Y/n both record some guitar bits and Y/n also records some piano bits. George adds in some simple drum beats.

Things with Matty seemed okay, almost back to normal. But things with Ross were suddenly different and she wasn't sure whether she liked it or not. Sure, lingering touches that screamed "I want you" were still shared, and looks that shouted "my soul yearns for you" happened more often than not. But ever since having dinner at Charli and George's house, ever since she kissed his cheek and left him on her door step, ever since she woke up from that blissful dream, something had shifted. They seemed to be avoiding things more, he hesitated before making his usual comments, comments that were once flirty seemed a little bit apprehensive now.

She knows he's only doing what she said, she told him they couldn't, so he was trying to respect that. But sometimes, when that thought slipped from his mind, the normal things that were 'them" happened, like those touches and stares. But even through that, something felt off. Her mind was still reeling from him holding her thigh with such a grip that it was as if she was his anchor keeping him on the ground. She swears she can still feel the way his thumb grazed the skin, even 6 days later, 6 torturous days she spent avoiding him. And she'd be lying if she said she hadn't found herself staring at those hands of his one too many times when he played the bass.

She excuses herself from the studio and the three men, explaining that she just needed a moment alone. They had been working for what felt like hours now and she couldn't handle one more of those longing looks from Ross, or one more of those eyebrow raises from Matty when he caught her staring at Ross.

She finds her coat that she had hung up upon her arrival, slipping her arms through it and going outside. Her hand finds the inside pocket, finding the pack of cigarettes she reserved for special occasions like this. When she was well and truly confused and stressed. She lights the cigarette easily, she takes three long drags before the door opens.

She knew it was only a matter of time before one of them found an excuse to join her, despite her request to be alone. She rolls her eyes slightly as she looks at Ross, who has his eyebrows raised at her, eyes flicking towards the cigarette in-between her fingertips.

She chuckles and shrugs her shoulders. He hadn't seen her smoke before and it was clear it wasn't a common occurrence, and that fact alone makes him wonder why she needed one now.

"Are you okay love?" He asks and he truly knows something is up when she just nods and deters the conversation.

"How'd you manage to get away from them?" She asks and he laughs, pulling his own pack of cigarettes from his pocket and lighting one. She gives him the same look he gave her, sure she had seen pictures of him smoking, but she had thought he was more of a social smoker. This might have proved that, that was not the case.

He raises his eyebrows back and says a quick "sorry to disappoint you" which she just shakes her head at, for she was also smoking so she didn't care if he did too. It was actually kind of hot. Oh for God sake woman stop.

"Matty got a phone call so I slipped out and said I was going for a fag... George didn't care..." Ross explains and she nods.

His eyes wander over her features, taking in the way she's breathing deeply, in and out, smoke falling from her lips and nostrils. She smokes effortlessly and Ross can't help but like the sight. She looked good, as always, slightly tired but just as beautiful as the first time she took his breath away. But something was off, that much was clear.

"Are we okay?" He asks and she nods, but doesn't speak.

"Maybe try that again... But more convincing" he says and she can't help but laugh. She takes one last puff and drops the cigarette to the floor, stubbing it out with her booted foot.

She steps towards him, wrapping her arms around his waist, needing a hug from him more than anything. The door that was cracked open, is now swinging open, nearly snapping off it's hinges.

"I'm sorry I've been off and avoiding you... Just didn't know how to act around you" she admits into his chest. He forgets about the cigarette he was nursing, dropping it to the floor and letting it burn out as he allowed his arms to wrap around her. He rests his head on top of hers, breathing her in. The new mix of her with the addition of tobacco is even more addicting and he can't help but sigh.

"Don't be sorry... It's hard, I've felt it too... all day in fact" he admits and she feels slightly more at ease at that.

"I know you said we can't... And that's fine... But I can't keep acting like this, it feels wrong. If I wanna hug you I wanna hug you. If I want to hold your hand I want to hold your hand.... Is that okay?" She knows she should shake her head, say no, it's not okay. But she couldn't help herself. She was addicted to him and he was even more addicted to her.

So she nods, she pulls back to look at him and nods, placing her head back against his lower chest and hugging him tightly.

"So what does that mean then?" He asks, his own way of saying what are we? They clearly weren't just friends, but she wasn't allowing them to be truly more than that. They were in some kind of limbo between both of those identifiers.

"We're just us... Is that okay?" And he nods, and smiles widely down at her. He could deal with that for now. It was better than the alternative which was not having her in any way, and he couldn't live like that.

"And Matty?" Ross asks, and she raises her eyebrows, unsure what he was getting at.

"I know you said nothing is going on... but I cant help but sense something there... if you say its nothing its nothing... Just be honest with me, I can take it" Ross says and she nods, sighing deeply.

"I'm still figuring that out..." its the first time she's been truthful about Matty, not just to Ross but to herself.

"Okay... I can deal with that" he says, smiling down at her.

They return to the studio finishing up the song. By the time they leave, its dark outside, George had bid them farewell maybe 20 minutes earlier, hugging her tightly and telling her he was there for her if she needed. The exchange didn't go unnoticed by the remaining men. London is cold but the lights sparkle and she gets that childish glow in her eyes as she walks down the steps from the studio. Ross and Matty can't take their eyes off her but for once she doesn't notice. Matty breaks first, eyes falling from her to Ross.

He notices the glint in his eyes and the way his dimples show deeply, the way his eyes crease. He's seen a similar look before, but nothing of that calibre. Matty's smile drops, he had to stop this. He had to.

That look. That look on his best friend's face, it told him everything he needed to know. That he liked her perhaps more than Matty did, maybe not, but he would always, always put his friends needs and desires before his own.

The problem was, Matty was unsure he'd be able to stop. He didn't know if it was possible. But he'd try... even if it destroyed him.

"Hey um" he hesitates, their eyes fall on him "you guys go ahead, I've left something upstairs" he says. Ross frowns at him.

"You sure mate? We can wait" yn nods too.

"No it's okay... go" he smiles at his friends and then he begins walking up the steps. They begin walking down the path, with Matty watching. Watching the way he made her laugh, watching the way one arm came to rest against her shoulders, watching the way, she, the one he so desperately wanted, seemed right in his arms... At home.

Note: low-key don't really like this chapter... But oh well. The only bit I actually like is the george x yn bit :(

(8) Studio Sessions

#same for you the 1975 series #the 1975 #ross macdonald #matty healy #the 1975 fanfic #matty healy x reader #ross macdonald x reader #george daniel #adam hann #ross macdonald fanfiction #ross macdonald fanfic #ross macdonald fan fic #matty healy fan fic #the 1975 fan fiction

138 notes · View notes

theladyofdeath · 1 year

Text

Back to Orynth {Rowan x Aelin}

Written with @snelbz

Rowaelin. Canon. The castle in Orynth. NSFW.

Based on prompt: Rowaelin mutual masturbation fic, but then they just can’t keep their hands off each other and they fuck. But in canon. Not AU. by anonymous.

Word Count: 4,166

A/N: We've decided to take a little bit of time and post more OS! We have a very long list that we're set on tackling, and although we do a lot of AUs, I like that we started with one in canon. We hope you enjoy!

WARNING: NSFW. 18+ ONLY. The following story contains descriptions of sex. No one under 18 should continue past the link.

Aelin stood on the balcony outside of her bedchamber and watched as snowflakes drifted toward the ground. It had been a fairly mild winter for Orynth, but she still couldn’t imagine that flying through the snowy winter was all that pleasant, no matter how much snow fell. Yet, she kept her eye on the horizon, expecting to see a familiar white-tailed hawk soaring through the falling flakes at any given moment.

Aelin was growing impatient. He'd better hurry.

It had been nearly two months since she’d last seen her Mate, her husband. There had been suspicious activity along the northern border and Rowan had led the charge in the investigation, then went on to make sure that the entirety of Terrasen’s border was secured.

Which was all fine and good, but it did mean that Aelin’s bed was cold and her heart was only half present.

The grandfather clock in her sitting room chimed six, and knowing that the sun would soon be setting, Aelin was growing impatient. She wondered if she screamed, as loudly as she possibly could, if that would make him come faster. Surely he would hear her, he’d have to be close enough, and nothing worried Rowan Whitethorn Galathynius more than his wife in danger.

Even if he knew perfectly well that she could take care of herself.

Territorial, over-protective fae bastard.

Just as she was about to give up and go back inside, she could see him, the tiniest hint of his animal form in the distance.

He flew directly towards her, without having to even think about it. It was not his first homecoming, and it certainly wouldn’t be his last. As he grew nearer, there was a flash of light, then he was landing on the stone ledge with a thump. His boots were filthy and he had a new scratch on his cheek that hadn’t fully healed, which Aelin knew meant that the original gash must have been pretty deep.

Yet, the moment he changed, his eyes were soft as he smiled at Aelin. “Nothing better to do than wait for me to arrive?”

“Well, I have a kingdom to run, but your impending arrival was distracting me,” she said, watching him fondly as he approached.

“Glad to know I’m more important than your meetings,” he crooned, pausing before her. “I do hope you gave Lord Darrow the respect he deserves.”

“Absolutely,” she replied, eyes sparkling. “After he interrupted me for the third time, I called the meeting and spent the rest of the day in our private library.”

Save for the threat at the border, things had been prosperous since Aelin’s rule began. Trade was booming, the rebuild of the land was tedious, but created jobs the territory needed. The meeting on foreign affairs was more for pomp and circumstance than it was for a specific need.

“Our private library, huh?” He cupped her face in his hands and leaned down, finally bringing his lips to hers. The kiss was brief, but full of promise for later. “Surely you weren’t reading the texts on ancient battle strategies like I’ve suggested?”

Aelin hummed as she slid her palms up his chest and around his neck. “I assure you the strategies that I indulged in were far more…useful than any ancient battle strategy.”

Rowan chuckled as he shook his head. “If any member of our court were to wander into our library and stumble upon a book of yours, they would be appalled at such filth.”

“And that is why I keep all the good ones in our private library.” She kissed him again, and he groaned quietly against her mouth. “You smell atrocious.”

Rowan let go of his wife and stepped inside. “It’s been weeks since I’ve had a proper bath, I’m not sure what you were expecting.”

“I was expecting you to at least take some soap with you in your pack. You’re a king, for the gods’ sake,” Aelin teased, following him into their sitting room and closing the double doors that led out onto the balcony.

Rowan snorted as he took off his pack and tossed it on the couch, then began unhooking his weapons, one by one. “Who do I have to thank for putting up with your sarcastic ass while I’m away?”

“Oh, the list is long,” Aelin crooned, watching the show he was now putting on. Once his weapons were gone, he began unbuttoning his dusty jacket. “If you’re going to thank them all, it’s going to be all you’re doing this week.”

Rowan shook his head, but she could see the slight twist of his lips as he shrugged off his jacket, adding it to the pile. “Maybe I’ll thank them by taking you off their hands for a few days.”

“Ah, I am a burden,” Aelin said, meandering over to Rowan and fisting her hands into the fabric of his thin tunic. “Are you sure you want to take on that task?”

“I think I’ll manage,” he muttered, before kissing her once more. Aelin reached up and ran her fingers through his hair, which was growing longer once again. She loved it.

“Take a bath,” she whispered, kissing his cheek, his jaw, his neck. “I’ll get you something to eat.”

“Don’t we have people for that?”

“I find doing things for myself keeps me humble.”

Rowan huffed a laugh before disappearing into the washroom.

As the water ran, Aelin hurried down to the kitchens, smiling politely and greeting everyone she passed. After collecting a platter of meats, cheeses, bread, and berries, Aelin was finding her way back to her rooms. The water was still sloshing around from the washroom, so Aelin placed the platter on their table before finding her way back into her bedchamber and her wardrobe. After slipping off her gown, she pulled on a thin, golden nightgown and a knee length robe, leaving it open. She pulled the pins out of her hair, knowing that her duties for the day were complete and she would not be leaving this room any more tonight.

Collecting the book she’d been reading earlier, Aelin curled up on the couch in the sitting room, filling a glass with wine from a bottle brought straight from the personal stores of the King of Adarlan. She sipped the wine with an appreciative hum before opening her book and picking up where she’d left off.

The love interests had finally just given into their attraction for each other, desecrating every surface in the mountain side cabin in the best way. The kitchen table, the wall, the bath, the bed, Aelin couldn’t get enough as she turned page after page—

The next thing she knew, she heard the door to their bathroom opening wide and she glanced up to where her husband stood, taking up most of the doorway with his broad frame. He wore a pair of loose linen pants and…that was it. No shirt and from how low the pants hung on his hips, from what she could tell, no undershorts either.

His eyes took in where she sat on the couch, on the glass of wine on the side table and book in her hands and he smirked as he headed for the platter of food laid out on the table.

As he passed in front of the couch she sat on, Rowan froze, nostrils flaring delicately as he scented the air. Raising her eyebrows, Aelin cradled the book to her chest. “Yes?”

“What exactly are you reading?” He asked, continuing to the table the food was laid out on and leaning against it. He plucked a bunch of grapes up before picking them off one by one and popping them into his mouth.

“Nothing of your concern.” Aelin let the book fall back open in front of her, her eyes scanning the page. Rowan watched her for a moment, slowly eating his grapes, before grabbing a slice of bread and walking toward the couch. He plopped down next to her and read over her shoulder with a curse. “I repeat my earlier sentiment. Your court would be appalled if they knew of your reading material.”

“My court should admire how in touch and confident I am with the idea of romance,” Aelin crooned, nudging her husband in the chest with her shoulder.

Rowan snorted as he bit off a piece of bread. “This is not romance. This is animalistic fucking.”

A satisfied sensation flooded Aelin’s body as she looked up and met his gaze. “I’ve had to have some sort of companion in your absence.”

His green eyes were bright as he shoved the rest of the bread into his mouth and swallowed. “Surely this doesn’t compare.”

“No?” Aelin asked, teasingly, as Rowan dropped his arm around her shoulder and kissed her temple. “I don’t know. Me and my books have had some remarkable nights since you've been away.”

Rowan’s eyes narrowed, and although humored, they darkened slightly. “So you’ve been well taken care of, then?”

“Don’t you admire how I can take care of myself?” Aelin asked, setting her book on the table beside the couch before giving her Mate her full attention.

“Always have,” he confirmed, brushing his knuckles down her cheek. “Although I feel it defeats my purpose.”

She loved it when he teased her, when he was playful. To the rest of the world, he was a nightmare come to life, a warrior with one intent, an ancient, powerful male who had the hands of death and the heart of a soldier. Aelin knew better. He was all of that, of course, but he was also a male who sat on the couch with her and flirted, who teased her and made her laugh.

Who made her toes curl and her most delicate parts throb uncontrollably.

“Is that all you’re good for?” Aelin asked, shifting on the couch to straddle his lap. Rowan’s arms went around her waist, the most handsomely seductive little smile twisting his lips. “Pleasure?”

“As the husband of a queen?” he asked, one brow raised. “Yes. Yes, I’m fairly sure my only duty is to bring undeniable pleasure to Her Majesty.”

“Hmm.” Aelin pursed her lips. “That’s quite the claim. And if I can pleasure myself just as well as you can?”

A low growl came out of Rowan. Even in their playful state, she could sense his jealousy brewing. “I’ll have to be the judge of that.”

Aelin’s heart began beating just a little bit faster, and she hadn’t even realized that her hips had begun to move, slowly rolling over his, until she asked, “Oh?”

As Rowan nodded, his lips brushed her neck. “Show me how you’ve pleasured yourself in my absence, my Queen.”

Aelin’s eyes rolled back and she bit her lip, fighting the urge to moan. Beneath her, she knew exactly where Rowan’s mind was at. Between the hard thickness she rocked against and his scent, excitement and need bloomed in her core.

“I don’t think you can handle such a sight,” Aelin said, her grin wild and devious. “A month and a half of travel has surely left you needy. Handsy. Possessive.”

“I think you forget how patient I am,” he said, quietly, fingers teasing the hem of her nightgown.

Aelin rolled her eyes. “You’re not patient. You just like to pretend you are.”

Rowan took her chin between his fingers and made her meet his gaze. “Try me.”

There was something about his tone that filled her body with fire and chaos. His eyes were bright, crazed, full of lust and longing. Aelin was sure that hers mirrored his. Every night that she had spent alone in his absence was full of wishing he was there beside her, holding her, loving her until her knees shook and every thought from her mind had evaporated. Now that he was here, all she wanted was to have him inside of her, but she would play his game.

She would give him a show until he was begging.

Still straddling his lap, Aelin shook off her robe and took the hem of her silk nightgown, slowly pulling it over her head until it was sitting behind her on the carpet. Rowan’s hands found her waist but she shook her head, smirking as she pushed them away, back down to the couch cushions. “No touching.”

His eyes blazed as they swept from hers, to her bare breasts, then back up again. Although his breathing had increased, he didn’t protest. Instead, his cock twitched beneath her as he gripped the couch cushions on both sides of his thighs.

Aelin took her time pulling her hair back until it was held snugly by a ribbon, and Rowan was practically growling by the time she slid her hands down her abdomen, to the band of her undergarment.

“Is that patience of yours thinning?” she teased.

“No,” he said, but the word was clipped, his jaw hard as his eyes trailed down her body and rested on her fingers, where they began to slide down the thin fabric of her panties. A slow, heavy breath left Rowan and his eyes darkened as the fabric swept down her thighs and every inch of her was bared before him.

He didn’t even try to hide his lingering gaze. A gaze that Aelin felt powerful under. As Aelin ran a finger through her slick folds, Rowan cursed, low and filthy. His fingers flexed beside him, but his hands did not move. He obeyed the command of his Queen, even as Aelin moaned into the quiet space.

Even the thought of her husband had left her wet and wanting. She could slide down on him to the hilt, effortlessly, but she wouldn’t. No— she wanted to see how long this game would go, how far she could tease him without him pouncing.

How long he could go without completely losing his shit.

She wanted him completely unleashed.

Their joinings after time apart were already nearly cataclysmic, neither of them leaving their bed chamber for a day or two. It reminded Aelin of the true mating frenzy they’d been robbed of when Maeve stole her off that beach. As if the time they spent apart built up until it blew, until it wasn’t safe for anyone but the other to be around them.

That suited her just fine.

Dipping her finger into the well of her center, Aelin gasped softly, watching Rowan as he watched her. His nostrils flared and she knew he was scenting her, dying to bury himself in her arousal. With her other hand, she dragged her fingers up her toned stomach to her breast, cupping one. Her fingers toyed with her nipple, rolling it and teasing it until the sensitive bud was tight and peaked.

Rowan’s tongue darted out as he wet his lips, the only sign that he was struggling. His features were still set in stone, as if he were unfazed by her ministrations, but those eyes were locked on her.

Aelin removed her hand from her sex, fingers still glistening and reached up to touch Rowan’s chest.

Faster than she could blink, his own hand had captured her wrist. Her fingers were inches from his skin.

“What is it?” Her voice was husky, yet dripping with innocence, as if she didn’t know what she was doing to him.

Rowan sounded like he was in pain. Only a few moments and she’d already worked him up. “You said no touching.”

She clucked her tongue, leaning in so her chest pressed into his. It pinned their hands between them. “I said you couldn’t touch me.”

“Then you can’t touch me.”

And before she knew what was happening, Aelin found her self on one end of the couch, her back to the plush, rolled arm, while Rowan sat on the other end.

Much too far for her liking.

He didn’t move. His eyes never left her. They trailed after her fingers as she settled against the couch cushions, her legs stretching out, her toes nudging Rowan’s thigh. His breathing was shallow as his eyes locked on the hand that palmed her breast.

His hands didn’t stay still, though. Instead, Rowan untied his linen pants before slipping them down his thighs, his hardened length springing free. Aelin’s bottom lip was pulled between her teeth to keep from moaning at the sight of him, completely ready for her. She throbbed between her thighs and every thought from her mind vanished as Rowan fisted his cock and stroked.

Aelin could practically feel him thrusting into her as the image flooded her mind. This time, she let a moan free as she began circling the throbbing ache of her clit that was begging for relief.

Rowan’s rhythm matched hers, and for a moment, nothing could be heard in the room except for their heavy, disoriented breaths.

“Your books don’t seem to be of much use now,” he teased her, not bothering to look at the object behind her she claimed gave her so much pleasure.

Smirking, Aelin spread her legs wider, baring herself further to him. There wasn’t an inch of her body he hadn’t seen, hadn’t tasted, and she could see the raw hunger in his eyes. “They’re only necessary when I lack the imagination needed to—”

Her words fell off with a soft moan as she circled her clit, watching as Rowan worked himself. The muscles of his abdomen were straining and his hips would buck off the cushions every so often. Her mouth watered as he teased his cock, stroking the head slowly as beads of wetness appeared. Aelin wanted to lick him clean, to taste the unadulterated essence of her Mate after such a long time apart, but this game between them was first and foremost in her mind. What had started as a way to tease him had backfired in the most glorious way, and as Aelin watched her husband pump his cock in time to the plunge of her fingers into her core, she knew there was no way she would break first.

She breathed his name as that familiar sensation built in her core and Rowan’s jaw locked as he watched her body writhe beneath the power of her own fingers. Suddenly, Rowan’s hand worked himself faster, and a curse of his own left his mouth while Aelin cursed.

“Is this what you do in my absence?” Rowan hissed, his tone half teasing, half undone. His shoulders tensed as his wife cursed again, a string of profanity falling from her lips.

“Jealous?” she asked, but the word was nothing more than a whisper. She could hardly get it out as her hips rolled into her hands.

“How can I be jealous?” Rowan asked, his tone only pushing her further towards her release. “I know what’s going on inside that pretty little mind of yours.”

Aelin’s fingers slowed to a tantalizing speed. “And what is it that I’m thinking?”

Rowan grinned, and the sight had a whimper sounding from Aelin’s closed lips. “You’re thinking how good it’s going to feel when I finally bury myself deep inside of you.”

Aelin scoffed, although it was clear that it was nothing more than an act. “I thought I made it clear…I get by perfectly well in your absence. All by myself.”

Rowan’s hand slowed, until his hand wrapped around his cock but it did not move. “Your soul is mine. You are never alone.”

There was certainly some romantic notion in that statement, but it was mostly an animalistic declaration. No, as her Mate, their souls were connected. There was never a second that Aelin pleasured herself that she was not thinking about Rowan, even when he was thousands of miles away.

That thought alone had Aelin breathing, “Touch me.”

No sooner had the words left her mouth that Rowan grabbed her across the couch, dragging her body over his, and crashed his lips against hers. One of his hands was in her hair, the other on her ass and Aelin adjusted herself until she felt him pressing against her center, thick and hard and ready.

Gods, she needed him and she didn’t want to pretend she didn’t, no matter what game they were playing. He was not weaker for needing her, not as he’d once believed, and she wasn’t either. As he ravaged her with his kiss, Aelin rose up on her knees, lining him up with her entrance and sank down in one stroke that had both of them gasping.

Rowan’s mouth found her neck as she rode him, kisses alternating from long, languid sweeps of his tongue that made her squirm, to biting nips of the sweetest pain that had her quivering around him. His lips continued down her neck and shoulders, over her chest, until he took her nipple into his mouth, sucking gently.

Throwing her head back, Aelin moaned, writhing atop him, threading her fingers through his hair.

Rowan’s fingers kneaded her ass as he sucked and praised. He thrusted up as she rocked and bounced, and they did not even try to hide the noises that were shamelessly filling the space between them, around them. Aelin hoped the entire castle could hear, hoped that they all knew her Mate was home and her soul was complete yet again.

Rowan’s lips found hers, hungrily, his tongue diving into her open mouth. Their bodies were pressed up firmly against one another’s but it still wasn’t close enough. It would never be close enough. Aelin would always long to be closer, even if they were as close as two people could be. She whispered his name and came crashing down upon him yet again, drawing a deep moan from the back of Rowan’s throat. His head fell back and he cursed before throwing her back against the couch and claiming her with a primal relentlessness that had Aelin seeing stars.

She loved him like this.

Completely unhinged.

Lost in all she had to offer, unable to control his needs and desires.

All of it, only for her.

The room filled with Aelin’s gasps and screams and cries of his name as Rowan fell into her again and again, urgently and meticulously. With one hand gripping her thigh, the other fell in that little space between them and his thumb rolled her clit until she was falling into oblivion, drowning in her sweet release. Her knees shook and her chest heaved as she swore, her nails digging into his skin.

Rowan’s eyes were bright as she clenched and spilled out around him.

It was only a few more frantic thrusts before he was following her over the edge, groaning her name as he came.

His head fell into the crook of her neck, both of them breathing heavily as they came back down. Aelin was the first to move, dragging her nails up and down his back in slow, languid strokes.

A quiet groan rumbled in his chest and she laughed softly as her fingers found her way into his hair.

“Your hair will need a trim before we hold any official court business,” she mused with a smirk as he worked to settle his breathing.

“Your court can take me as I am.” His response was muffled by her skin, but she could hear the exhaustion in his words.

She hummed as she finger combed through the tangles. “I guess you're right. I am queen, after all. What I say goes.”

Rowan snorted, knowing she’d never use her power for something so vain, but didn’t reply.

“We should clean up,” she said, glancing down. His body still completely covered hers, right down to where he was still buried inside her, their mixed releases making a mess on the couch.

“We can clean up tomorrow.” He still hadn’t raised his head, his warm breath on her skin. “Sleep now.”

“We have a bedchamber for that, you know,” she teased and he finally pulled back to look at her.

She had only seen her mate look so exhausted a few times, so completely and utterly drained that she knew the moment his head hit the pillow, he’d be asleep, so she leaned up, pressing her lips to his. “I missed you.”

“I missed you,” he echoed, wrapping his arms around her tighter. “Every day and every night.”

Without warning, he stood, carrying her into the washroom, making quick work of cleaning them both off before heading for their bed.

Aelin clung to him, refusing to let go even for a second. She had to soak up every minute before he was called away again to fulfill yet another duty in honor of the beautiful country that they had brought back from the ashes.

They never redressed before snuggling closely together beneath the heap of blankets on their bed, dwelling in the heat and comfort of one another’s bare body.

They remained in that bed together all night, intertwined and connected, and stayed there until the following night came.

#rowaelin #rowan x aelin #aelin x rowan #rowaelin fanfiction #fanfic #fanfiction #sjm #sjm fanfiction #snacmc collab #oneshot #tog #tog fanfic #throne of glass #rowan whitethorn #aelin galathynius #canon #fanfics #snacmc answers prompts

351 notes · View notes

pencil-peach · 4 months

Text

G Witch Onscreen Text: Episode 22

Welcome back to Part 23 of my Episode by Episode analysis of G Witch and its onscreen text. We're on Episode 22: The Woven Path.

<< If you forgot, Episode 21 will remind you of What You Can Do Now Or you can go to the Masterpost.

It's the dawn of a New World.

After Quiet Zero decimates the League's second attack, we get this brief display of it's current system report.

TEXT: (Lefthand side) - Link Strength with Aerial currently

(Middle) System Report -Permet Inversion Reactor STATUS:

Permet fluctuation reduced to [???]

Topological heat exchange catalyst replenished

Permet inversion reactor output decreased to 61%

Permet field stabilization in progress

(Righthand side) - Link Strength with Gundnodes currently

Lots of Permet based terms here that we might never fully understand...like what is "Permet inversion..?" Ahhh...I wanna know...

I wonder what the story is of the other staff members operating Quiet Zero are. Were they Shin Sei employees? I personally believe they were surviving members of Vanadis who were off base when the incident occurred like Bel, and who sympathized with Prospera's aims.

It's sweet of Guel to check up on Miorine, but I think even he knows he can't do anything for her now. She needs her wife....

The news report Rouji presents is from PNB, and the headline is:

Massive data storm, large number of GUND-type MS detected around mysterious Quiet Zero - Assembly League fleet devastated, evacuation warnings issued over wide area. - Suspicions that mastermind may be Benerit Group insider or [renegade?] "witch."

It seems that nobody is aware of who's really behind Quiet Zero, and a "witch" being behind it is merely speculative. That would explain why Shaddiq was able to take the blame for the crime in the Epilogue.

The bench where Suletta and 5lan have their talk (Left) is the same bench where El4n was supposed to meet her for their second date (Right).

We also learn in this scene that Suletta's wish list was actually just a bunch of stuff her mom suggested for her to do, and she just decided to go along with it for some reason. Even the things she "wanted" to do weren't wholly things she decided to do for herself.

Another thing that's interesting is that in this scene, wind is blowing. Asticassia is a closed environment, so there's no natural wind. It has to be produced by a strong force. In this scene, the wind begins blowing when Suletta affirms that she wants to stop Prospera and Eri, so I like to imagine that the strength of Suletta's will is what's causing the wind to blow.

I've already made a post discussing Guel and Suletta's final duel at length, but in brief, I think it's clear that at this point, Guel's duel with Suletta isn't about Miorine at all. I think it's about proving to himself whether he was truly a match for Suletta.

Guel and Suletta are rivals, in that they have the most onscreen duels with each other, and Guel's main motivation throughout the series is catching up with her.

But despite that, not a single one of their duels was ever fought evenly. One of them always had an unfair advantage, or there was some kind of outside interference on the outcome. And so, especially after the outcome of their last duel, Guel still isn't truly sure if he's caught up with her strength yet. And so this duel is the only one fought on perfectly even ground. No outside help, no interference. Just a pure one on one fight, to truly prove which of them is stronger.

And if you want to know why they chose fencing of all things, it's a reference to Char Aznable and Ray Amuro's fencing duel from the original Mobile Suit Gundam (Left).

On the whole, I can understand why some people might not like this duel (it's very out of left field) but personally, I like it, and I think it's an important conclusion to their rivalry, which was established in the first episode. I think it's just another victim of the absolute lack of time the series had to properly wrap up all its threads.

Suletta and Miorine's second heart to heart share some parallels/inversions to their first, so I will chronicle them here. (The first one is that their first heart to heart was in Episode 11, and their second is in Episode 22. Hehehoo !)

Firstly, the most obvious inversion is which of the girls is in pain. In Episode 11, it was Suletta, and now, it's Miorine.

Both girls believe, for one reason or another, that they've made a terrible mistake, and have receded into themselves as a result. Suletta believed that she was mistaken about her place in her friends lives, and should never have come to the school. Miorine blames herself for the tragedies at Quinharbor and Quiet Zero, and believes all of the choices she's made up till then were wrong.

In both cases, the other girl shares something personal about herself, and tells her that it's only because they met each other that that they don't have to keep running anymore.

At the end of their first heart to heart, Miorine refused to let Suletta see her cry, but at the end of their second, Miorine reveals herself to her fully messy and vulnerable, a sign of her complete trust in Suletta.

Their first heart to heart began with Suletta opening the door for Miorine, while their second ended with Miorine opening it for Suletta.

In the end, it's not violence that allows Suletta to rescue Miorine. It's love.

And while there (STILL!!!) unfortunately isn't an official release of EITHER track, the BGM that's playing during Episode 22's heart to heart is a soft piano cover of Season 2's opening, "Slash." This is a parallel to Episode 12's scene where Prospera manipulates Suletta, in which a soft piano cover of Season 1's opening, "Shukufuku" plays.

When Miorine and Suletta reunite with the rest of Earth House, the door they're standing in front of is numbered "7007." At the beginning of last episode, Felsi calls Guel about Petra from a similar looking hallway, and if you look closely, you can also see a door behind them with the plate number "7007." It's the same hallway, and I like to imagine the Earth House kids were there to see Petra, who might even be in that room.

Sometimes your father is a horrible terrible no good deadbeat sack of shit and you'll never forgive him.

And sometimes, he's still your dad.

Here's a quick visual reminder of the units at Plant Quetta that Prospera needs for Quiet Zero to operate at maximum capacity (Left). I wonder if these were internal or external units...probably internal.

It seems that Quiet Zero was being developed in (at least) 2 separate locations, and in their haste, Prospera and Godoy weren't able to retrieve the units before launching it proper. Hohn hohn hohn...

It makes you wonder though, what would Quiet Zero look like at full capacity? Probably woulda been scary.

Rolls up my sleeves

(Left, Top to Bottom) Quiet Zero - Current status summary

MOBILITY - After restart, movement velocity of enemy basepoint is predicted to increase - Velocity of each enemy MS also predicted to increase by average of 37% - Evasive Maneuvers of main unit will be complex

DEFENSIVE FUNCTIONS - Strong air defense barrier confirmed around Quiet Zero main unit, making it difficult to approach - Defense barrier strength 67942049 - Very difficult to invade domain while mutual defenses of basepoint and MS are linked

(Right, Top to Bottom)

WIDE-AREA DATA STORM CONTROL FUNCTIONS - Expands data storm domain and stabilizes it over a wide area - Domain is predicted to expand further in future

DATA STORM DOMAIN - 60%

PERMET DISPERSAL SYSTEMS - Permet dispersal index exceeds 200 - Permet density x 27.1 - Density increase is accelerating

REINFORCED LINKAGE BETWEEN QUIET ZERO MAIN UNIT AND GUNDNODES - Increases interconnectedness of overall enemy - Each MS appears to become a sub basepoint - Basepoint and all Gundnodes are linked - Link multiplexing confirmed, jamming impossible

A quick look into an analysis of Quiet Zero's systems. There's not much to say other than this really is an apocalyptic device. Interesting to note though is that even without the necessary units, Quiet Zero's capabilities are naturally increasing, presumably because Eri is slowly getting better at operating it.

In case you were curious, here's the description of the Demi Barding's Baori Pack, which allows it to operate without Permet Links

(Baori Pack) - Can be configured with various optional equipment evolved from the 'Daedalus' multi-tool system, an exclusive expendable stand-alone pack equipped with flight unit functions. - Can also be separated from the main unit...

The 'Daedalus' multi tool system...interessante...

In this scene, Guel expresses his concerns for Suletta's wellbeing to Miorine, only to be met with a confident gaze from her, an expression of her belief in and respect of Suletta's choice (Left). It's similar to the scene from Episode 9, where, in response to Shaddiq's concern, Suletta responds with a confident gaze of her own, affirming her belief in Miorine (Right).

When Miorine confronts Shaddiq, she asks him to believe in her, to which he breaks out into laughter. Maybe he's finally realized where he went wrong. Shaddiq cared a lot about Miorine, but despite it all, he never once trusted her. Not with her own company, not with her choice in Suletta, not with the future, not even with her autonomy.

If he had looked beyond his own ideals, if he had reached out and truly trusted her, saw her as an equal rather than something that needed to be protected, then maybe things would have turned out differently.

I won't bore you with transcribing the text from Suletta's flashback about uncovering the hidden message for Miorine from Notrette, but when Rouji decodes it, HARO uses the "Ytk-7791 Format" sequence to decode it.

Also, I'm a little obsessed with how Suletta is with Secelia and Rouji in this flashback. It occurred at some point within the ~10 days between Ep 20 - 21, and I wish we got an entire episode about it because I would love to know what lead up to this specific pairing...not to mention the dynamic....ARGH WHY DIDNT THIS SHOW GET MORE EPISODES FUCK !!!

Anyway, the interesting thing about the hidden message is that the Code actually follows a consistent pattern, so if you know the conversion rules, you can create your own messages. I'm sure it's already been done, but I went ahead and made a table deducing the conversions

I used the codes we see on the tablet and on the Quiet Zero terminal to intuit the letters we don't see.

The code is split between lowercase and uppercase versions of letters, starting with lowercase a as AAA.

If an acid sequence has a single asterisk (*), that means we don't specifically see that letter in the show, but was confidently intuited using the surrounding letters that we do now.

In the case of the punctuation, there was no real way to intuit the order, so those have two asterisks (**), indicating that I simply made my best guesses for placement.

'CGG' functions as a blank space between words.

So, for example, if you wanted to write, "I love you, Suletta." The code would be:

GTCCGGAGTATGCCCACACGGCGAATGCCACTACGGTCTCCAAGTCATCATAAACGT

In terms of numbers, we see on Rouji's monitor that the Number Table is separate from the Alphabet table, starting at 0 with AAA. (We know this because the screen shows both the Number Table and Prime Number Table, and by comparing the two, we see that AAG has to be 2.)

I think one day I'll try and code a tool that lets you convert messages to the code and vice versa, if you ever feel like letting your betrothed know you love them through. Nucleic Acid Sequences.

You don't need me to tell you how the scene with Suletta in Calibarn is a parallel to Elnora in Lfirth from the Prologue, but you might not have caught just how many of the shots are directly referenced.

But in the Prologue, Cardo Nabo refused to let Elnora make the choice to hurt herself for everyone else's wellbeing by raising the Permet Score, whereas Miorine, despite feeling that same concern, allows Sulleta to make that choice. (The moment when Suletta clears score five and Miorine bursts into tears...she was so worried...she was so afraid.......AGHHH)

Calibarn's entrance into Quiet Zero's data storm is a reference to Full Armor Unicorn's entrance in Mobile Suit Gundam Unicorn.

Sibling fights....

It seems the end is nigh. Is love strong enough to overcome all adversity?? Who knows...

To find out, Click here to go to Episode 23 >> Or maybe the Masterpost could remind you.

#g witch #gundam the witch from mercury

31 notes · View notes

mechanismslorearchive · 1 year

Note

I'm trying to find lore on Ivy, but somehow can barely find anything- I'm very bad at getting details out of big chunks of text so I was hoping to find someone's summary or explanation. Would you happen to have something like that? Or a link you could direct me to?

You know, this is a very good question! I don't honestly think anyone has written a post about Ivy's lore, I am quite tired atm, but I can bullet point out the main points!

Or well, some fun facts I guess, because thats me, travis, the fun fact guy.

Ivy was the third Mechanism to be Mechanized by Doc C, this is proven by the fact she appears in this doc carmilla art on Maki's blog!

Ivy was, presumably, mechanized either in a Space libary of Alexandria, of sorts, given the library theme, 'alexandria' etc etc. And the fact in her backstory fiction the entire everything

Ivy's age is unknown.

In several photos, Ivy is seen reading a [i forget the language rn, maybe german?] translation of a Tolkien book. So thats a fun fact!

flute player.

Ivy once upon a time had a song called The Librarian. This song was never recorded, and the lyrics do not appear on the site like Cyberian Demons, and this haunts me. It was preformed live at a DC&TM gig along with the fabled song Fantasia, and several Lorelai songs.

although, in her fiction, its sort of implied Tim was mechanized by the time she was mechanized? Or at least there. "a figure strides out of the smoke towards her, the hem of his coat smouldering, reflected firelight glinting in the glass lenses where his eyes should be."

his implies one of the dudes, coat implies tim somewhat, and so does 'glass lenses where his eyes should be', but given she was number 3, and Tim was well after the fact, either time is wobbly (VERY LIKELY) or this figure was Jonny. Either or. It could very well be Tim burned down a library for shits and giggles at some point, found a mortal ivy, went oh shit, dragged her out of the flames and left her outside, where Doc C picked her up. these are both just as likely tbh

you know rereading the fiction its heavily implied she is on the moon.

Tim is implied a LOT in this fiction so ???

Regardless, the bones of it is

Ivy does not recall and remember like a person, rather like a computer - an encyclopedia. She is a book not a person, its said in the text

If i'm missing anything very important, feel free to reblog with it!

#asks #mod gpdt #the mechanisms #not archive update #ivy alexandria

142 notes · View notes

rollercoasterwords · 1 year

Text

like. i still wouldn't want someone to copy and paste my fics into a large language model like chatgpt but it's not so much bc i'm worried abt my work being stolen (seems unlikely that an LLM would spit back out my exact words considering how it works, and even if it did, i doubt any individual would be able to like. publish and profit from those words, based on the nebulous status of copyright law when it comes to LLMs like chatgpt. and having my words fed into the LLM really isn't going to make much of a difference when it comes to corporations profiting off the tool in the first place; plus in instances of corporate exploitation i think there are more effective ways to organize than like...arguing for strengthened ip laws or trying to like make ip laws for fanfiction spaces). it's more because i'm wary of what that says about how a person is like...approaching my fic specifically + fanfiction more broadly. in two main ways:

1. i think it is just. basic respect to check with a writer before u take their work off ao3(or whatever fanfic-specific place it's been shared) and put it somewhere else. and like, this applies to lots of things outside chatgpt--reposting fics to other sites, posting them on goodreads/storygraph, printing + binding fics, etc. if u are treating fanfic writers as people who u are in community with, who are generously sharing a gift with u, then it seems like basic kindness to check in and see if they're alright with u taking that fic outside the space it was posted to do something else with it.

with chatgpt and similar LLMs specifically, a lot of people are wary because there's still so much unsettled in regards to how copyright laws might shake out, and most people (myself included) are unsure of how/whether our writing/data might be stored and used by these corporations that own the LLMs. i don't think ai itself is something that should be mythologized as like ontologically evil technology, but anytime a corporation is introducing us to new tech like this we need to be wary of where it's coming from and how it could be used--people have already pointed out a lot of very serious issues with the way this technology is being developed and how it could/likely will be/already is being used exploitatively--which, again, is more a matter of organizing against corporations than railing against ai tech itself, but is still a valid reason for writers (again, myself included) to be wary of having their work fed to LLMs without permission.

and like. sure, u don't have to care abt writers' feelings + boundaries and can just take their stories and do whatever u want with them. but to me that says u aren't treating fanfic as a community space, but rather a content farm in which fics are products that u are entitled to do whatever u want with. and i just think that's shitty! and if that's how ur treating fanfic then i'd rather not have u reading my fic at all

2. i honestly think it's a strange way to engage w storytelling by treating endings this way. like. story endings are usually v important + intentional, and can completely change the entire tone, themes, messages, etc of a story. i understand going to the writer and asking them abt what they had in mind for the story ending if ur looking for closure, and i understand imagining ur own story ending or even writing ur own ending to an unfinished story. what i don't understand is plugging a story into chatgpt and having it spit an ending out for u.

and like. maybe this is bc we've all been calling these LLMs ai, which evokes an impression of like. a sentient robot creating something. but that's not what these programs do! the first article i linked explains how they actually work really well, but essentially--chatgpt and similar LLMs cannot create new ideas. they can't take a story and synthesize its themes or pick apart its tone to then come up with an original idea for an ending. at the same time, they aren't just plagiarism machines that are ripping text directly from other writers and spitting it back out.

instead (to my understanding), what they're doing is compressing vast amounts of information by running statisical analyses to just save the most common trends, patterns, recurring info, etc, and then plugging that in to fill the gaps. it looks like it's writing something new, but it's essentially just paraphrasing already-existing information pulled from the internet. so i'd imagine that if u fed an ai a fic and said "write an ending," the ai would basically compare the fic to whatever similar stories it has saved and then spit out an ending that is most commonly found on the internet for that type of story. [not an expert here tho--this is just my best guess based on the bit of research i've done].

my point is--you won't be getting a new ending inspired directly by the story u put in. you'll be getting a paraphrased version of the most commonly recurring type of ending for similar stories on the web. and i just....don't see how that would be satisfying in any way. it seems, again, like a way in which someone would be approaching fic like a product, something that needs to be finished + complete bc ur entitled to it, rather than viewing fic as a piece of art with its own unique themes, message, and story that can't just be plugged into a one-size-fits-most ending generator. and like, i'm trying to avoid mysticizing writing as some sort of ethereal art form that would be blasphemously degraded by having someone plug in a shitty ending paraphrased from a conglomeration of various similar stories--i don't think someone creating a shitty ending for a story is like. a horrible evil thing. but i can understand where the satisfaction is coming from if you're writing your own shitty ending, where you get to come up with where u think the story would go + where u get to synthesize the themes u picked up on etc. but ai isn't even doing that--so again, i don't understand where the satisfaction is coming from aside from just going "well every story i read needs to be finished," which. makes me wary bc it just feels like a completely different way to approach stories and storytelling than i would hope to find in fanfic spaces, one that treats fic less as a creative place to explore and more as a transactional space where u are entitled to products.

anyway. feel like my thoughts + feelings abt ai keep changing the more i learn abt it + i'm sure they could change again, but rn my impression of this whole situation is like. i find the fact that some people are plugging fics into LLMs less concerning re: ip + ownership rights, and i don't think it's useful to exaggerate or mythologize abt what ai actually does (i think even calling it ai has kind of misled a lot of people, myself included). what concerns me more is that plugging fics into LLMs to write endings feels symptomatic of a broader culture in which people treat fanfic as an informal profit economy in which fics are product or content that a consumer-audience is entitled to, and i think that sort of approach leads to a whole plethora of other issues + makes fandom a more hostile space.

#hopefully this makes. sense #i am not a fan of most of the uses of ai/LLMs that i've seen #but i also am concerned that much of the backlash against it seems to be defaulting to this position of either #mysticizing writing in reactionary ways #and/or running into the arms of ip laws #which are a tool of capitalism and shouldn't be trusted any more than the corporations who profit from + exploit them!!#definitely feel like there are issues w plugging fics into LLMs without permission and would not want anyone to do that w my writing #but. moreso bc i don't want my writing being treated like content for consumption y’know #anyway the articles i linked esp the first and third r really good...highly encourage reading them #ranting and raving #txt

73 notes · View notes

leviathans-watching · 2 years

Text

chaos causer | chapter 1

includes: mammon x gn!reader (no pronouns mentioned)

wc: 2.5k | rated t | m.list | series m.list | ao3

a/n: welcome to the first chapter of chaos causer!! there will be four total chapters that are all already written and one will be posted every three days. to be added to the taglist, click here, and to see links to the original craigslist ad, the series summary, & the full list of tags, click here.

prev | next

please reblog!!

I should switch to eBay, Mammon thinks as he scrolls past the tenth unappealing ad in as many minutes. Why he's even using a human site like Craigslist is beyond him, but hey, you never know when you’ll find a gem. He doesn't sell on it, preferring to stick to Devildom-centered marketplaces, but he has no qualms when buying. Humans generally have crap and junk listed, but sometimes there will be something that appeals to him, something new to add to his collection.

An ad title catches his attention and he clicks on it with an amused huff. What could this be?

Alone for the holidays? Mad at your family? Hire me to ruin the night.

I am a human magic user that has recently had a lot of time open up to me with nothing to fill it. Why not use this time in a meaningful way? I asked myself, before dismissing the idea. I’m a young adult willing to pretend to be your date for any holiday dinner or party.

Thanks to my magic, I can play any age, except child (for obvious reasons), and have no problem changing my appearance as need be. I am a skilled actor and promise to sell my character well. Your satisfaction is guaranteed.

I revel in causing chaos and making things worse so I can and will do any of the following at your request:

Start instigative discussions about politics and/or religion

Openly hit on other guests while you pretend to not notice/care

Propose to you in front of everyone

Pretend to be drunk/otherwise inebriated early on in the evening

Start an actual, physical (or magical!) fight with anyone in the family, either inside or outside of the house

Use the worst manners you’ve ever seen in your life

Be pretentious or pretend to be knowledgeable about something I clearly don’t understand

Never stop talking and overshare way too much

& other things along the same line

I require no payment aside from the free meal. This offer is available to anyone in any of the three realms, as I have experience dealing with an assortment of humans, angels, and demons. Do NOT contact me with unsolicited offers or services.

Text or call me with offers at [your number].

The ad has to be a joke. Has to be! Who would go out of their way to do such a thing, especially on a night meant for family and friends? And who would be crazy enough to hire someone to do such a thing? Mammon can’t wrap his mind around it.

He reads it once more, this time pausing to imagine what it’d be like if he were to hire you to do something like you’re describing. He can’t deny the smile that grows on his face as he pictures it. Your profile picture looks deceptively normal, with you smiling at the camera, but something mischievous glimmers in your eyes that leaves him with no doubt that you’d be able to wreak havoc in a family if you so desired.

And it sounded like you desired, judging by the ad.

Shaking his head, Mammon shuts off his D.D.D., rolling off his bed. Even as he gets ready for the student council meeting Lucifer had made sure he knew about, your ad still lingers in his head, making it hard for him to focus.

“Mammon,” Lucifer says from behind him, voice ice cold. Mammon turns slowly, already dreading the inevitable lecture. How was he supposed to have known the guests they’d be hosting would be offended by his offer to trade valuables? It wasn’t like they had said they were important cultural items! And they were totally overreacting, they could have just said ‘no thanks’ instead of blowing it all out of proportion!

“What’s up, Lucifer?”

“Your behavior this afternoon was entirely unacceptable,” Lucifer snaps. “You just ruined decades of diplomatic work in a singular meeting! How someone manages to do such a thing is completely beyond me.”

“It wasn’t-” Mammon tries, but Lucifer cuts him off, eyes glowing red.

“I don’t want to hear any excuses,” he says firmly. “I am most disappointed in you. Diavolo has spent far too much time and effort on securing alliances and relationships for you to be so careless. It's like you don’t even care about the fate of this realm. Classic Mammon,” he continues, more to himself than to Mammon, “too self-centered to think of anyone but yourself.”

“Hey!” Mammon protests. “I was tryin’ to be welcoming! Trades are an essential part of any deal and I thought maybe they’d like it if they came outta this with some bonafide Devildom treasures! They shoulda been honored I was willin’ to trade with them.”

“Don’t lie to me.” Lucifer rubs at his temples. “You were just being greedy, once again. Honestly, Mammon. I have no idea as to why you have such a hard time with your sin. The rest of us are all afflicted by such things as well and we never cause scenes like you do.”

The shot stings, and he has no retort prepared. Why is he constantly in trouble for his sin when the rest of them can do as they please with it and have no one give a damn? Why is it natural for them to indulge but selfish and bad when he does it? And bullshit, ‘no one else causes scenes’! He can think up at least five scandals caused by his brothers in the last month!

“I have half a mind to banish you from the council altogether,” Lucifer says, and ice runs through Mammon’s veins. He wouldn’t do that, would he? “Diavolo already has enough on his plate without you causing trouble. Honestly, you’re lucky he’s so kind. If I were in his place, I would not stand for one fraction of the insolence and disrespect you show to him.”

Mammon’s hands clench into fists. So Lucifer cares more for Diavolo than he does his own brother? The realization, while not surprising, is still disappointing. His brothers all think of him as Lucifer does, don’t they? Scummy and troublesome and not worth the time. Anger - it’s anger, Mammon tells himself - stings in the back of his eyes.

They think he’s that bad, do they? Your ad swims to the front of his thoughts, clear and descriptive. Maybe he’ll just have to prove them right, once and for all.

Mammon makes plans to meet you in a small coffee shop in your town. It’s probably easier for him to travel to you than for you to travel to him. When he gets there, you already have a drink, picking at the edges of the cardboard sleeve around the cup. Again, you look deceptively normal, but when he sits, the smile you give him is nothing short of impish. You slide him a drink that had gone previously unnoticed, and he accepts it gratefully.

“Thanks for meeting me,” Mammon says, a little nervously.

“Thanks for replying to my ad,” you return, brushing the cardboard flakes onto the floor subtly. “I was beginning to think no one would.”

“I thought it was a joke, at first,” confesses Mammon. “Honestly, I still kinda do.”

Your smile turns rueful. “No joke, I promise. So, want to tell me about your family?”

Mammon struggles to find a place to start. “Well, we’re a pretty affluent family down in the Devildom. My brother is close to the Demon Lord’s son, Diavolo, and he’s pretty high-strung, so any time I’m out of line, it's treated as a grave offense.”

“That sounds tough,” you say sympathetically, and even though he has just met you, his chest warms a little at your understanding. How it that you, a stranger, supports him more than his own brothers do?

“Believe me. My other brothers are annoying too, though he’s the worst. Recently, we got into a spat where he basically told me he thinks I’m the worst outta all of them. He gets on me for things that he lets slide with them and constantly is in my business because he thinks he knows best. It’s really annoying. My other brothers poke fun at me and just get on my nerves, as they make jokes about my intelligence and other things that I can’t control. I’m pretty sick of it, so when I saw your ad it made me want to prove them all right, in a vindictive sort of way.”

He fears, for a moment, that you’re going to try to talk him out of it, or say he’s overacting, or something, something that will destroy what little composure he has left, but you just nod, pursing your lips.

“Well, I can definitely help.” You grin, suddenly, light dancing in your eyes. “You’ve come to the right place. Want to tell me more about the dinner itself and each of the brothers I’ll be dealing with and what my approach should be? I find it easiest when I do it with as much knowledge as possible.”

“You’ve done this before?”

“Not this situation, exactly, but similar stuff, yeah,” you say with a shrug, as if it’s not the most mindboggling Mammon has ever heard.

“Huh.” Mammon pauses to take a sip of his drink. It’s not something he would have ordered for himself, but you bought it for him, so he’s definitely not going to say anything. “Well, the night starts off at my house, usually. We all hang out there for a while, which is where I’d introduce you and everythin’, then we head over to Diavolo’s place, where we eat and make polite conversation and all that jazz. It's not a fancy event, per se, but you definitely don’t show up in jeans.”

“Is that something you want me to do?” you ask. “Show up horribly underdressed?”

Mammon can’t deny that would be funny. “I’m not sure yet. But that would set a good tone for the evening.”

“Let me know either way,” you say, and Mammon continues on with his explanation.

“Okay, so first is Lucifer,” Mammon sighs. “He’s my older brother and the one I always get into fights with.”

“Wait,” you interrupt, “like Lucifer, Avatar of Pride? Oh shit,” you say when he nods, “so you’re Mammon, Avatar of Greed?”

“Uh, yeah?” Mammon raises an eyebrow. “Is that an issue?”

“No, no,” you say hastily, waving your hands. “You said affluent, but I didn’t know you meant that affluent.” At his mystified expression, you clarify. “Your family is kind of a big deal to us humans. You’re like, the demonic version of the Kardashians.” This doesn’t help him, so you just wave your hand. “Never mind. No, it’s not going to be an issue, it just surprised me.”

“Okay,” Mammon says slowly. “Anyway, he can be a real asshole. He’s got a big stick up his ass and makes it his mission to let everyone know. And then Levi, one of my younger brothers - I’m the second oldest, by the way - uh, he teases me when he doesn’t really have a leg to stand on, so it gets on my nerves. He’s an otaku and pretty antisocial. Then there’s Satan. He’s got more beef with Lucifer than I do, which is saying something, and he can be a real dick. Thinks he’s better than everyone, especially me.” He continues explaining the rest of his brothers, then adds on where you probe.

“Okay, now that I have a good idea of who you all are,” you say, clasping your hands, “what kind of shit do you want me to pull. I’ve pretended to be an asshole but only where my ‘partner’ couldn’t see, but I’ve also done shit right in front of them before. Depends on what the person wants.”

Mammon thinks for a moment. “Right in front of me, but I’ll pretend to be so smitten that I don’t notice. And as far as the stuff on your ad goes, feel free to do any and all of it. Wherever you see an opening, try to cause some trouble. You mentioned in your ad you can use magic?”

“I can.” Pride is evident in your voice. “I’ve got a sorcerer's license and everything. I’m proficient in many different areas, including dueling, which is why I’d be willing to get into a magic-based fight, and I have experience in most types of spells, charms, and curses.”

“Impressive,” Mammon murmurs. He’s not going to encourage you to get into a magic-based fight, not against his brothers, since that’d be horribly unfair to you, but it’s helpful to know. “We’ll see where the night takes us on that. For now, just plan on being a complete and utter menace.”

“Got it.” Again, that sly mischief is in your eyes, and it sends electricity down his spine. “I swear I’ll do my best to do my worst.”

Mammon snorts. “That’s all I ask. And as for payment, I know you said only dinner but are you sure you don’t want any other compensation? I feel bad, puttin’ you through this and you getting nothing in return.”

“No, but thank you. Seeing everyone’s faces is its own reward,” you say. “And if we’re eating at the Demon Lords’ castle, then I at least know I’m eating good. So really, don’t worry about it.”

“If you’re sure.” Mammon’s still dubious, but he’s not going to push. “Hey, feel free not to answer this, but why put that ad up in the first place? Isn’t there someone you could be celebrating with instead?” You get a funny look on your face, and Mammon suddenly feels bad for asking. He’s not prone to regret, and the feeling sits heavy in his stomach. “Ah, I’m sorry,” he says, scratching the back of his head. “That was awfully invasive of me.”

“It’s fine,” you interrupt softly. “It’s only natural to be curious. And to answer your question, not really. I have friends, of course, but I don’t wish to intrude on their holidays, and my family, well. Let’s just say they’re not a viable option.” You laugh, but it’s decidedly less mirthful than before. “I figured at least this way I’d get some fun and a good meal. Do something I enjoy rather than feeling sorry for myself.”

“Oh,” Mammon says after a moment. “Well, like you said, the food will definitely be good, and if you don’t get at least a little bit of fun out of it, well, then, we did something wrong.”

“I’ll remember that,” you say, some of your spark returning. “If there’s anything else you think I should do, or if you have any other ideas, text me.” He already had your number from setting up this meeting. “And if not, then I look forward to seeing you next week.”

Because, yep, the dinner was next week. How Mammon would survive until then, he didn’t know, but excitement already crackled under his skin.

leviathans-watching's work - please do not copy, repost, or claim as your own

#obey me #obey me game #obey me shall we date #shall we date otome #mammon obey me #obey me mammon #mammon avatar of greed #mammon x reader #mammon x you #mammon x mc #mammon x y/n #obey me x you #obey me x mc #obey me x reader #leviswriting #leviswriting-obeyme #obey me swd #omswd #obey me fanfic

390 notes · View notes