#tried to follow the requests to the letter | Explore Tumblr Posts and Blogs

pathologicalreid · 3 months

Note

Hii I am making a Spencer Reid x citizen! F reader. They have been dating for a really long time but for a while reader has been dealing with a stalker, suddenly the stalker becomes much more violent and maybe even kidnaps her if we want to get real cray cray. Just lots of protective reid and angst to comfort!!

don't lose your head | S.R.

a stalker uses your work as a tudor history professor to follow your every move, so you go to the only place you can think of for help - the BAU

who? spencer reid x fem!reader category: angst content warnings: professor!reader, fiance!spencer, erotomaniac stalker, lots of tudor history facts, kidnapping, decapitation, happy ending, s11 (post-maeve), guns, death, spencer feels a lot of guilt, unhelpful police, exhaustion, nausea, dry heaving word count: 3.71k a/n: yall if i wanted to make this into a series would you read it 😭 i had so much fun writing this!!! and yes the title is a reference to six! thank you sooo much for requesting!!

you

You told Spencer after the fourth note. While the first two had been near your office door – harmless enough to have been brushed off as a student prank, the third note had been left on your desk. When someone had gotten into your locked office to leave you an intense love letter, you knew you were out of your depth.

After years of hearing stories about the BAU needing to battle the chain of command, you thought the best thing to do was to first go to the campus police. You were a professor, so the natural assumption was that they’d look into it.

They didn’t even take a report. No one listened to you.

From the campus police, you went into the city police, then the county, and by the time you marched into DC Metro, you hadn’t slept in a day. Spencer was in Utah on a case, and you didn’t have anywhere else to go. Once DC Metro told you there was nothing they could do without an open investigation or further evidence, you went back to your apartment.

The fourth note was there waiting for you, covering the camera that you kept on your front door.

Since you had the first three notes already in your bag, you plucked the newest one from where it was stationed on the front door and stuffed it in with the others before making the trip down to Quantico.

You had no idea when the team would be back, but the security guards at the front desk recognized you from the times you’d come to pick Spencer up or bring him lunch and they let you up anyway.

There were no notifications on your phone from Spencer letting you know that they were flying home, but the only place you felt safe was in their headquarters. The idea of going to see Penelope crossed your mind, but as a profiler-adjacent, she’d likely see right through you. You never dropped by, especially not when Spencer was away.

Settling yourself at his desk, you pulled an empty manila folder from a drawer, placed the notes neatly inside, and left it on Spencer’s desk before sitting in his chair and waiting for something to happen.

“Hey, Reid,” you heard a familiar voice from behind you. Slowly, you spun the chair around and looked at the team as they filtered in the glass doors.

Confused, Spencer tilted his head at you, clearly wondering why you were staking out the bullpen as he approached you. As he got closer, he observed the bags under your eyes, bloodshot from your lack of sleep over the last few days, “What’s wrong?”

Chewing on the inside of your lip, you clutched the folder like your life depended on it – for all you knew, it did. Your eyes followed Spencer as he knelt in front of you, accepting the folder when you handed it to him, “I think I’m in trouble,” you whispered, voice raspy from lack of use.

Your fiancé flipped through the pages, reading each of them a few times while you garnered attention from other members of the BAU. Tara, Derek, and JJ all crowded around Spencer’s desk, curious on your surprise appearance.

“I…” you faltered as you tried to explain what felt inexplicable. “The first one was folded over the doorknob of my office, the second one was slid beneath the door to my office, the third one was left on my desk, and the fourth one,” you glanced nervously at Spencer, “it was on the apartment door.”

Spencer’s eyebrows furrowed, “apartment door? Our apartment door?” As he questioned you, he stood up, leaving you with four federal agents staring down at you.

Despondently, you nodded, steepling your fingers in your lap and letting your shoulders droop.

“I’ll go get Hotch,” JJ said, nodding at everyone else to confirm her intentions before turning around, making her way up the steps to Hotch’s office.

From there, you ended up in the roundtable room. Tara had personally brought the letters for the lab to be checked for prints, and the techs had sent Garcia scans that were now projected on the screen. Each member of the team had them up on tablets, but you and Spencer knew the words by heart.

Shaking her head, Tara looked up at everyone, “I mean, who writes like this anymore? ‘But if you please to do the office of a true loyal mistress and friend, and to give yourself up body and heart to me, who will be, and have been, your most loyal servant,” she shrugged, continuing to look over the letters.

“They’re love letters,” you explained, tugging the sleeves of your sweatshirt over your palms before crossing your arms in front of your stomach. “The words aren’t original, they’re all passages from the love letters of Henry VIII to Anne Boleyn.”

Pointing to something on her screen, JJ frowned, “And what does his greeting mean? He always starts with ‘my rose without a thorn’.”

Nodding dejectedly, you focused your eyes on the now-empty manila folder on the table in front of you. “That was what Henry VIII called Catherine Howard, she was his youngest wife. It’s widely accepted among scholars that she was around seventeen when they got married, but others say she could’ve been as young as fifteen,” you answered, wondering if more details would help the investigation.

“So, we have Anne Boleyn and Catherine Howard, which wives were those?” Rossi asked, looking around the table for someone who knew the answer.

In the middle of scrawling something on an evidence board, Spencer answered quickly, “Two and five.”

Folding your hands in your lap, you scoured your memory for anything that could be helpful. When Hotch asked if those numbers meant everything to you, you just shook your head. “Is there any significance to the two wives he chose being Anne Boleyn and Catherine Howard?”

Your lips parted in surprise as the blood drained from your face, “They were the two wives who were beheaded.”

An eerie silence fell over the room, interrupted only by a chime from Penelope’s laptop, her shoulders slumped forward in abject disappointment, “The lab didn’t find anything on the letters. No prints, no hair… nothing, but uh…” her voice trailed off as she looked up at Hotch, it was almost like she was seeking permission.

Each member of the BAU looked at each other with the same concerned expression on their faces. “What do you all know that I don’t?”

“Two bodies turned up last week in the greater DC area,” Morgan was the brave soul who spoke up, “they were both missing their heads, and they were both college professors.”

Goosebumps spread over your entire body, a chill of fear causing the tip of your nose to feel cold, “Oh, I…” you fumbled over your words, standing up from your chair and rushing to leave the roundtable, nearly throwing yourself out of the bullpen on your way to the women’s restroom.

Entering one of the stalls, you haphazardly gathered your hair at the back of your head and you dry heaved into the toilet. You dropped to your knees as nothing came out.

A knock at the door barely garnered your attention, you didn’t even bother responding as Spencer was already entering the stall, “Oh, honey.”

That was it, you sat back on your heels as tears welled in your eyes, looking up at Spencer as he sat down next to you. Immediately, you turned your body to face him and leaned forward.

Welcomingly, Spencer grabbed you, firmly wrapping his arms around your torso as he pulled you into his lap, “I have you. I’m right here.” His voice was gentle, no more than a whisper as he kept a firm pressure around your body, “You’re safe with me,” he reassured you, using one hand to keep you upright and the other to rub your back as you cried.

Your face was buried in the crook of his neck as you wept, the sensation of fear ran through your body like electricity, and you felt content for the first time in days in the safety of Spencer’s arms. “I- I just teach. I’m n- not built for this,” you cried, words slightly muffled by his shoulder.

You were a history professor, teaching a course on the six wives of Henry VIII, this was never even in the realm of things you considered when putting together your syllabus.

Taking a shaky breath, you pulled away from Spencer, and he reached behind you for a wad of toilet paper to dry your face. “Spence,” you said, though it came out as more of a whimper.

“When’s the last time you slept?” He asked, cupping both of your cheeks in his hands while he studied your exhausted expression.

Shrugging, you shuffled off of him, dropping the wad of toilet paper in the bowl and flushing it, “A day? Two?” You weren’t entirely sure what day it currently was, the events of the last few had caused everything to sort of blend together.

Spencer nodded in understanding, “Okay,” he responded, slipping his phone out of his pocket before typing something out, “Why don’t you go lie down in Morgan’s office for a little while? He won’t mind.”

You blinked a few final tears from your eyes before affirming, “Yeah, uh. I need to grab something from my car.”

“Okay, are you parked in the garage? I’ll go down with you,” he offered, getting up and lending you a hand up, mumbling about the state of the bathroom floor as he did so.

After washing your hands, the two of you made your way through the hall and to the elevator before Garcia called out for Reid, “Hotch needs you for something, he said it’s urgent.”

Glancing back at you, he pursed his lips before selecting a lower-level special agent to go with you to the parking garage. “Be right back,” you told him as you stepped onto the elevator.

him

Once he was finished with Hotch, Spencer made his way back down the hallway, expecting to find yourself settling in Morgan’s office only to find it empty. Turning back in the hallway, he nearly bulldozed into Morgan and JJ, “Hey, what’s the rush?”

“Have either of you seen Y/N?” He asked, trying not to let panic rise in his voice, but there had been ample time for you to get to the parking garage and back. You should’ve been back by now.

The two of them shared a look, “Uh, no, I haven’t seen her since she left the roundtable room. Is she alright?” JJ asked, blue eyes filled with concern.

Pulling his phone from his pocket, Spencer hit the number one on speed dial – your number – and brought the phone to his ear before rushing to the elevator and moving to the side as JJ and Morgan piled in with him. Frantically pushing the button for the parking level, he cursed as the phone went to voicemail.

“Reid, what is it?” Morgan asked as the elevator started moving down.

Redialing your number, Spencer muttered to himself, hoping you’d pick up, “I sent her down with an agent. Hotch needed my apartment key so that Tara and Rossi could go look for anything.”

As the steel doors opened, the three of them drew their firearms, each of them taking a different direction when Spencer realized he didn’t even know where you had parked your car. “We have an agent down,” Morgan called out, calling Garcia and putting the phone on speaker. “Baby girl, we need medical and crime scene techs down to the lower-level parking garage,” he said into the phone.

“Spencer,” JJ called out, garnering his attention as he made his way through the garage to where JJ and Morgan were now stood, Morgan was applying pressure on Agent Franks’ wound, and JJ was looking at a car.

The passenger door to your car was open, and the vehicle was chiming as an alert to get you to close the door. As he stepped forward, something glimmered at the edge of his vision. Crouching down, he picked up your engagement ring from the cement, “He’s got her,” he said, a wave of déjà vu nearly toppling him over.

Impatiently waiting for the elevator to take him back up to the sixth floor, Spencer trudged to the roundtable room, desperate for another look at the evidence board. The dates of each letter that you had received, the content of each letter, and the reason for all of this didn’t make any sense to him.

It had to be an erotomaniac, it was the only thing that made sense. You were an object of someone’s desires, and their delusion had to have become so strong that they took you.

Quietly, someone stepped into the roundtable room behind him, “What are you thinking about?”

Imminent death. Statistics of harm and death in cases involving erotomanic kidnappings. “Synchronicity,” he answered simply, entertaining JJ’s conversation as he continued to study the letters. The love letters were at the core of it all, so the answer needed to be written in there. Everything that had come to you was almost an exact copy of words written by Henry VIII.

“Ah, that’s Jung, right?” JJ asked, her voice was kind, and she was using the same tone she used when doing cognitive interviews with victims. He didn’t have time for her pity, they were on a clock.

Sighing, Spencer picked his dry-erase marker back up and scrawled on the board, “It’s a concept that he introduced, yes. It’s meant to describe the occurrence of events which seem like they’re significantly related but there’s no discernable causation.”

JJ nodded understandingly, taking a spot next to him and looking at the notes, “And what occurrence of events are we thinking about right now?”

“I suppose more than anything, I’m wondering if there’s an action that I took in the past that somehow caused me to find myself in this situation twice,” he answered, circling the word ‘the place chosen by yourself’ on the evidence board.

Humming, JJ turned to face him, “Does Y/N know?”

Pressing his lips together in a thin, white line, he nodded tightly, “I told her years ago, when we had first started dating, actually. I never thought…” his voice trailed off as he set down the marker, “She came to me, JJ. She came here to be safe, and he grabbed her from the parking garage.”

“You sent her down there with an agent, you thought you were doing the right thing,” JJ tried to comfort him.

Scoffing dismissively, he stepped back and took a seat in one of the chairs, “I can’t stop thinking about if it would’ve made a difference. If her asking me for help would have fixed anything, or if it would have ended the same way.”

Taking a seat near him, JJ paused for a moment, seemingly at a loss for words, before responding, “We can’t really afford to think like that though, in our line of work.”

Spencer scoffed, “No, we can’t. Especially not now, but the timing of it is weird. It’s been almost exactly four years, and now…” his voice trailed off as his eye caught on something on the paper. “The timing is off,” he muttered, picking up the first letter you had received.

“What is it, Spence?” JJ asked, tilting her head to the side curiously.

Shaking his head, he read the letter again, “This letter, it’s from the first letter Henry VIII wrote to Anne Boleyn, but in this version, he says he’s been waiting for months to be with her, but they waited seven years to be together because they were waiting for his marriage to Catherine of Aragon to be annulled.”

Still confused, JJ leaned forward, resting her elbows on her knees, “Okay, what does that mean.”

“We ruled out a student because the crimes didn’t read as mature, but what if it’s a different kind of student?” He proposed, standing up from the chair abruptly and starting to write on the board.

Rolling her chair closer to the board, she shrugged, “I’m not sure I’m following.”

Holding up a single finger, Spencer wrote a name down on the board, “Y/N has a grad student TA, he’s been working toward his PhD for seven years. He’s been her TA for three months – that lines up with the timeline in the letters.”

“Okay,” JJ said, starting to follow along, she waved at the team members in the bullpen to get their attention before hitting the call button on the conference phone. “Penelope, what do you have on a Geoffrey Williamson? He’s a TA in Y/N’s class.”

There was typing on the other line before a sound of disgust came from the technical analyst, “He is a different kind of smarmy, it looks like he transferred programs two years ago to Y/N’s university after he… oh. It looks like he bounced from foster home to foster home as a kid, his parents never fully gave up their rights but couldn’t follow through on their case plan. He was unsuccessful in his last dissertation defense three months ago,” she continued clacking on her keyboard, “after which his mentor teacher dropped him and the school gave him one more semester before pulling his funding. He asked Y/N to be his new mentor teacher and it looks like she turned him down -very nicely, might I add.”

Scoffing, Morgan crossed his arms in front of his chest, “That sounds like a stressor and a trigger if I’ve ever heard one.

“Garcia,” Hotch spoke into the phone, “Do you have a location for Williamson?”

There was more typing as Spencer could feel his carotid pounding in his throat, “It looks like he lives in student housing, but… he recently inherited an old factory after his biological father passed away two weeks ago.”

Nodding, Hotch looked around the table, “Send us the address, and forward it to Rossi and Lewis too.”

“Done, go get her,” Penelope urged into the phone before hanging up.

He slipped your engagement ring into his pocket before adjusting the strap on his Kevlar, thrumming with nervous energy as Morgan coordinated with SWAT, waiting outside of the old textile factory as the tactical team organized themselves in front of the BAU.

Spencer and JJ took the left side, Rossi and Tara took the right, and Morgan and Hotch went through the main doors.

“No!” Your voice broke out through the steel corridors of the factory, immediately followed by a yelp.

There was an awful noise then, like metal scraping against itself, “Fucking say it!” An unfamiliar male voice broke out in a holler.

Steeling himself, Spencer had to hold himself back from rushing into the room where your voice was coming from, each one of your sobs was like another strike at his resolve. “Good Christian people,” he heard you say, your voice was strained, “I am come hither to die, for according to the law, and by the law I am judged to- to-“ Your voice broke off into a heap of wails.

“What is she saying?” JJ whispered, waiting for SWAT to clear the corridor.

All of the blood had drained from Spencer’s face, “She’s reciting Anne Boleyn’s execution speech, from right before she was beheaded.”

JJ nodded, understanding the gravity of the situation – they needed to get in there, and they needed to do it quickly. SWAT waved them over, and the two of them filtered through the open doorway. The space was dimly illuminated by candles, but the only thing Spencer could focus on was your head, bowed toward the ground as you watched the ground. Above you, Geoffrey was holding a sword, ready to cut your head off.

“Geoffrey Williamson, FBI!” JJ called out, announcing themselves to the UnSub before he could get any further in his convoluted execution, “Put the sword down! Let Y/N go.”

Spencer clocked the UnSub’s grip tightening on the sword as he zeroed in on you, “I can’t! She has to pay for this! She has to finish the speech.”

He opened his mouth to speak, but as you raised your head slightly, he found himself silenced by your gaze. Roll, he mouthed the words to you, hoping Williamson was too focused on JJ to notice what he was trying to tell you.

“And by the law I am judged to die,” you continued the speech, your voice wavering.

Taking a deep breath, Spencer watched as the UnSub raised the sword despite JJ’s instructions to set it on the ground, “Y/N, stop talking!”

Releasing another sob, you finished the execution speech, “And therefore I will speak nothing against it.”

As soon as the last word was out of your mouth, Williamson brought the sword down, and as it swung, two things happened. JJ pulled the trigger on her firearm, killing the UnSub, and you rolled out of the way, the chains that bound your hands and feet clanging on the ground as you did so.

Holstering his weapon, Spencer ran over to you, dropping to his knees in front of you, “It’s done. It’s over,” he tried to reassure you, but you had begun struggling against your restraints as Spencer tried to settle you down, “Stop, it’s me, baby. Baby, it’s me,” he said desperately.

Once you had maneuvered yourself into a sitting position, you looked at Spencer with big, watery eyes before completely breaking down. “I just wanted it to end,” you babbled as your face crumpled.

“I know, honey,” he said, reaching out to pull you close as JJ contacted the rest of the team, asking for a chain cutter to get your restraints off of you as they weren’t able to find the keys on the body. “He’s gone, you’re safe,” he urged, holding you tightly.

You weren’t seriously injured, but there were enough bumps and bruises to make Spencer insist on a trip to the hospital. Until the EMTs could make it to you, he was fine with holding you on the floor of the factory. Keeping you close. Keeping you safe with him.

#criminal minds #spencer reid #spencer reid x reader #spencer reid angst #spencer reid fanfic #spencer reid hurt/comfort #criminal minds fanfic #spencer reid x fem!reader #spencer reid x you #criminal minds hurt/comfort #spencer reid fic #spencer reid fanfiction #criminal minds fanfiction #criminal minds fic #criminal minds angst #spencer reid x y/n #margot's requests

1K notes · View notes

hellsitegenetics · 7 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

#hellsitegenetics #faq #intro post #plants #flowers #snake gourd flower #requests #asks #remember to keep checking back!

2K notes · View notes

peachpitfics · 4 months

Text

Loml

Fandom: Bridgerton

Summary: You have been married six months, and it is fresh hell trying to conceive an heir with somebody you are repulsed by. Luckily, your old friend is willing to help you get through it while your husband is out of town.

Length: 2.6k

Pairing: Benedict Bridgerton x fem!reader

Content Warnings: Infidelity/adultery, themes allude to SA with unwanted husband (not described or mentioned), cunnilingus, face sitting, oral sex (male & female receiving), penetrative sex, vaginal sex, unprotected sex, sex for the sake of breeding, breeding kink?, orgasm.

a/n: This is part ii of Wildest Dreams, requested by anon here! This turned out a little more angsty than I had planned!

Bridgerton master list (tag list)

Six months ago, your father inflicted the cruelest curse upon you when he married you off to his vilest friend, Lord Howard. Six months of marriage, six months of scheduled contact, attempting to make an heir. Agreeing to once per month, having to allow Lord Howard access to your body in order to do so, six attempts were far too many already.

As soon as Lord Howard informed you of his business travel plans, you began thinking about Benedict Bridgerton. Somebody you thought about relentlessly, however, in this case, you were hoping to hold him to a promise he had made you earlier in the year.

Immediately penning a letter addressed to him at Bridgerton House, with details regarding location, date and time. The staff had been quite loyal to you since moving into the grand house. Most of your time was spent in the country, avoiding your new husband – the service staff there thought you were a gift from heaven, far too good for the old codger, as they called him. They looked after you, and you ensured the same for them. They would keep your secret.

Benedict arrived by carriage a week later, the afternoon after your husband’s departure, having written to accept your invitation, but only to discuss what had been promised in the past. Benedict looked the same, but cleaner, his hair shorter. He looked grown up. He stepped from the carriage, baring in easeful smile, just for you.

“Lady Howard” He bowed properly, it felt like a jive.

You did not speak a word, jumping forward and into his arms, throwing yours around his neck. It was the first time you’d felt safe in months. Benedict’s eyes flicked between the housekeeper, the footman and you, desperately trying to understand if this was okay.

“They are my friends; they would never harm me. I know it is strange, but they really do help me keep my secrets” You tried to reassure Benedict, whispering in his ear.

“It is not strange, it is very country, I suppose,” His arms tightened around your back, lifting you off the ground slightly, “I have missed you. I did write” Benedict squeezed.

“I know,” You let him go, holding out a hand to walk him into the house, “I have your letters hidden in my dressing room. I do apologise for not replying” Ben took your hand and followed you into the house, leaving his luggage on the carriage for the staff to care for.

Benedict was amazed by the house, its long concrete walls and vaulted ceilings. It felt similar to a castle, empty and cold. After your evening meal, you took Benedict for a walk around the gardens. Two swings hung from the branch of a very old tree nearby, one of your favourite places to hide from Lord Howard.

“Where has he gone to?” Benedict asked, lighting a cigarette and passing it to you.

“France… I think. I was not paying very much attention when he was speaking. I was too focused on getting you here. I have been waiting for months, building rapport with the staff, friendships even. I just needed him to leave, so we could do this right” You stuttered, watching your feet dangle as you swung back and forth.

Benedict paused, taking the cigarette back and drawing in, “It has not been going well then?” The question was serious, but even he snorted when he got the words out.

“We have been intimate too many times already. I thought this was supposed to be easy. Women get pregnant all the time” You sighed.

“Yes, when they do not mean to of course. Also, you must account for your husbands age” Benedicts eyebrows shot up to his hairline.

“Please, do not call him that” You interrupted.

Benedict exhaled heavily, “That is who he is, y/n. He is your husband. If we do this, we commit infidelity. There are consequences for such acts, are you prepared to accept those consequences?” Benedict asked. You had not ever seen him quite this serious. It scared you, seeing what six months will change in a person.

“I am!” You said adamantly, one stiff nod of assurance. There was no way you could take any more of this. One child, that was all you needed, to make it all stop.

You reached over to Benedict’s swing, his sweet face resting on the rope, thumb caressing his cheek, “Will you be able to live with this? Your child, raised as another mans? Never being their father, or having a role in their lives?” You asked, hoping it was not too cold a question. Benedict pulled slightly away from your touch.

“That is what I wanted to speak to you about…” Benedict whispered, “I know that Lord Howard is your husband and that I am too late, y/n. I will give you a child, if I can. I will give you as many as you damn well want. But I must know that after Lord Howard has passed, you will come to me” Benedicts eyes were soft and glassy in the moonlight, the burning ember of the cigarette fading in his laxed hand.

“Benedict” You shook your head and closed your eyes. How could you make such a promise?

“I do not care if the old bastard lives another 20 years, y/n, I will wait. I will wait in torment for you. Even if I must spend the next decade in hell, learning to bend time, I will. And if we are only allowed a short time together, then so be it because whether it be 5 minutes or 50 years, it will still never be enough time. There is an inexhaustible amount of love for you in my heart. I did not recognize it before, I was selfish and hopeless. The two of you will come home to me, and we will be deliriously happy” Benedict dreamed aloud, starry eyed.

You sat in silence for a moment, looking at each other with tragic longing deep set in your eyes.

Benedict’s eyes cleared, his smile faded, “I know you love me” He breathed boldly.

You jaw clenched shut, your eyes closed over slowly, a single tear running down the far side of your face so Benedict could not see.

“I love you,” He howled toward the moon, “I loved you the moment I saw you. I have adored your passion and cherished your friendship, while cowering in the frozen solitude of my own mind. I have dreamt of you and our life together every day since your marriage date, stirring in agony, every night. Every time I close my eyes, the profound pit of blackness inside consumes me – until I wake again, then my existence is marred by its lack of yours. Your name haunts my tongue, its ineffable song too wistful a sound on my lips. I am left stumbling through life, scattered across the universe, searching for you” His once invincible foolhardiness nowhere to be seen. The peaceful eloquence of his voice so familiar to you, always a poet.

Standing from your swing, hand outstretched to Benedict, you tried to allow your eyes to do the speaking. His sad, desperate eyes, staring up at you in solemn hope, his hand bound for yours. You escorted him inside in silence, the air surrounding dense with disquiet. Leading Benedict into your bedroom, separate from the Master bedroom, you closed the door behind him.

Locking eyes in malicious yearning, your bodies came together, navels pressed, hands roaming across every inch of your torso. Benedict grasped the back of your neck, enchanted look in his eyes as he littered kisses along your jawline and down your throat. You breathed heavily under his lips, breasts heaving against his chest. Reaching around for the bows on your dress, undoing them as quickly as you could, desperate to shed your clothes for him, Benedict palmed at your breasts through your dress. He halted his movements when he noticed your hurry and began stripping himself down also.

“I have been thinking, of one thing in particular, all these months” Benedict panted, leading you over to your bed. You nodded, waiting for him to elaborate. Benedict laid, his back to the bed, your hands in his, guiding you over top of him. You hovered over his nude hips, he smiled cheekily, waving you up higher. You frowned down at him, completely confused by what he was asking. He tugged you upward, your knees resting either side of his head.

“You will have to trust me” He gave a soft, dreamy smile as you gave him a befuddled one back, bare behind resting on his chest. You pursed your lips, Benedicts hands digging into your hips pulling you down onto his face. His breath hot against your skin, his wet tongue sinking betwixt your folds, starting gently at your clit. You jerked in animated surprise, finding yourself lowering back down instinctively. Benedict’s hands kneaded your behind, rolling your hips down onto his tongue. You had done your darndest to replicate the way Benedict made you feel, to no avail, at a complete loss for how you would miss his devastating body.

Your fingers tangled into his hand, drinking in every tangible flick of his tongue against your clit. His lips pressed, sucked and kissed at you, pulling you further into his indulgent dreamland. Benedict’s big, blue eyes staring up at you, grinding down on his face, his premeditated attack on you began, wrapping his flexed arms around your thighs and holding you firmly in place. Blinding pleasure laved over you, your eyes uncontrollably clamping shut so hard you swore you saw every colour imaginable. Screaming Benedict’s name, his amused tongue swirling you to completion, you panted animalistically, unable to move.

“That was incredible. I do not believe I could have prepared myself for how much better that was going to be outside my dreams” Ben moaned into your pussy, lapping at your juices, drinking you in. You rested a moment, watching Benedicts crowning smile, his asinine eyes filled with everything else he wanted to do with you.

Freeing Benedict from beneath you he shuffled up the bed, resting upright against the grand wooden bedhead, his legs out in front of him.

“Shall we try?” Benedict asked delicately.

“Please” You whimpered, crawling to him, taking his cock in your hand.

You laid between his legs a moment, holding him in your hands, moving gently. Leaning forward to kiss his tip, your tongue flicked over his pink flesh, Benedict could not help but moan. Taking him into your mouth, you sunk down in long hot strides, pressing his cock to the back of your throat. His fingers wrapped into your hair, pulling you onto him further. Benedict relished your working on him, libidinous smile engraved on his face, pure bliss.

“I do not think that is how one makes a baby” Benedict chuffed, pulling you up quickly, forcing you to wrap your legs around him. Face to face, you grinned into his splendidly hot kisses, his hand slipping between the two of you to situate himself. You felt his tip nudging against your entrance, hard and waiting, slipping inside of you. You gasped loudly, burying your face into his neck as a biological urge forced you to bounce.

Benedict growled lowly into your ear as you moved into a groove together, slow and tedious in perpetual delight. Benedict placed his hand in the smallest of gaps between you, his thumb adjacent to your clitoris; every movement, sinking to his hilt, he brushed against you softly. You were not aware that it could happen more than once, your heart quickened aggressively, Benedict tongue descending into your mouth as you whimpered louder and louder. Nails embedded into Ben’s shoulders, blood nearly drawn, your eyes holding his gaze, sheer hunger lived in his eyes. Hunger for you. Your pussy began quivering around him, aching, throbbing, trying desperately to take in more of him. Excruciating pleasure erupted from you, grasping his cock hard from within, your legs shook as your wetness spread between the two of you. Benedict did not stop this time, taking his hands to your hips as you ceased moving, manipulating your movements, grunting into your neck. Every time he led you to release, he seemed to get harder, more attracted to you. You did your best to get deep breaths in, to bring yourself back to reality, his cock still pounding into you steadily made it difficult. His teeth edge to edge in painstaking need, his forceful hands and powerful thrust told you he was close.

“Please,” Your voice rang out, his eyes needy and frenzied, “Please, Benedict, put that baby in me!” You continued to beg, his ragged panting and dreary eye contact wavering as you took control of your body again, bouncing heartily onto his cock. Every muscle in his body seemed to tighten at the same time, his hands aggressively pressing you down, as he groaned and grunted fiercely. You squeezed him inside, gently rolling your hips forward, feeling his cock pulsate inside you.

Benedict’s head rested against the bed head, his breath uneven and heart throbbing in his chest. Attempting to get off him, to allow him room to breathe, Benedict stopped you. He blinked himself back to this plane of existence.

“No, it helps if we stay like this” He explained through puffs.

“Really?” You frowned, never having thought about it.

“Yes,” He nodded frantically, “If we stay like this, everything will stay inside” He explained. You hummed in agreement, thinking perhaps that was what you had been doing wrong. Whatever it was that you were doing wrong, you were glad for it. If this made you an adulterer, a traitor, a betrayer, you did not care. Not for this.

Your hands rest on Benedicts chest, fingers splayed in brown chest hair, your eyes lingering over his collar bones and shoulders.

“What are you doing?” He asked, feeling rather observed.

“Taking you in” You purred, taking mental pictures in case you never saw him again. Benedicts hand rose to your face, his thumb rolling over your bottom lip, sliding down your neck to lure you into his most romantic kiss yet. Moments later, Benedict allowed you to slide off him, laying you with your legs up parallel to the headboard. You wondered how many more times you would get to feel like this.

“Shall I leave in the morning?” Benedict asked, a tremble in his voice.

“Absolutely not!” You exclaimed, Benedict lying next to you, a huge grin on his face.

“I joke, my Lady” Benedict laughed as you shoved him gently.

“You will be staying the entire week. I will hold you prisoner if I must” You chortled.

“Excellent, better treatment than home I expect. I will take it” Benedict stretched, every strained muscle flexing in exhilarating sex appeal. “We need every opportunity if we’re to make this baby” He smiled, thrilled at the chance to say such things, hoping one day his babies would come home to him.

“That is not the only reason I want you to stay” You said mellifluously, your soft, thoughtful eyes inspecting his reactions. Benedict frowned placidly, unsuspecting of your joyful surrender.

“You are the love of my life, Benedict Bridgerton,” Tears welled grievously, guileless love calm in your smile, “We will be together. I will be your wife, and I will bring our children home to you”.

Benedict leaned forward, pressing his lips to yours, unhurried and glorious. Tears streamed down his face, amazed and implicit, his sureness of his love for you unwavering.

“How ever long it takes, whatever I must do, we will be together” Benedict smile was humble, but fearless.

--------------------------------------------

Tag list: @cringycat24 // @blckbarbiedoll // @freyagallileaevans // @junkie05 // @rosabeetroot // @flamewriterr // @marvelouslyme96 // @moreover-clover // @dollarstore-lydia-deetz // @newavenger // @lifealot // @rosie-posie08 // @saintmagx //

If you would like to be tagged in Bridgerton fanfiction written by me, please let me know!

934 notes · View notes

ki-yomii · 8 months

Text

like i do | jjk

➥ pairing | jeon jungkook x f!reader

➥ word count | 3.2k

➥ warning(s) | 🔞 smut; dirty talk, pet names, mild praise kink, squirting, standing missionary, finger fucking, thigh riding, established relationship, angst w/ a happy ending, possessive!jk, jealous!jk, mentions of infidelity, trust issues

➥ summary | request - Jk being a jealous husband, angst and smuttttt 🥹💘

➥ notes | for lovely anon. hope you enjoy 💚 un-edited, i'll come back and fix any mistakes later. also poor jimin. i love him but i always seem to make him suffer lol.

💚 masterlist | inbox | AO3 💚

Eavesdropping.

Whether it was a stray conversation in a shop, or lurking around corners to see what others really thought of you, everyone’s done it at some point.

Now, it’s a habit Jungkook tries not to encourage - much preferring upfront interactions and direct conversations - but that isn’t to say he’s never eavesdropped before.

But the problem with listening in on conversations you’re not supposed to be is you run the risk of hearing something you wish you didn’t.

And while it wasn’t intentional by any means - he respects you too much to spy, even if the urge is there - he learns this lesson the hard way.

The first time it happens, he’s in the kitchen refilling his cup of iced coffee. There’s a squeal of surprise followed by a lighthearted giggle, the sound of shuffling limbs and a low grunt.

Everything in him freezes at the sound of your delight, gut churning.

He always works so damn hard to pull the laughter from the depths of your throat. And it stings that Jimin - his friend, his brother’s attempts are effortless.

It’s something so simple, and yet the effect it’s having on him is undeniable as Jungkook white-knuckles the handle of his mug and grits his teeth.

His jaw nearly cracks in two when he hears the softly murmured greeting, “It’s good to see you, baby.”

And Jungkook knows, okay.

He knows there’s nothing romantic between the two of you.

If anything, you’re too alike. Twin flames of the platonic variety. Not only would it never work out, but you both feel nothing but familial towards one another.

For fuck’s sake, Jimin was there when Jungkook proposed. Was the one to encourage it, in fact. Has been nothing but supportive about your relationship even when others disagreed.

However, knowing something doesn’t dampen the spark of jealousy.

Nor does it soothe the sharp flash of hurt threatening to steal the breath from his lungs.

Jimin has always been affectionate with you, and he’s always a touch too flirtatious. It’s a part of who he is, and it’s one Jungkook would never ask him to dim. Jimin spent far too long hiding, pretending, stifling himself for other’s comfort.

And Jungkook loves him as he is, encourages him to be his beautiful, authentic self no matter what. Expect maybe when it comes to his wife… for reasons he’s unwilling to examine.

All schoolyard flirtations aside, what bothers Jungkook most are the pet names. He can put aside his petty jealousy because he knows its unfounded.

What’s harder is dismissing the use of that little four-letter word: baby.

It’s supposed to be his way of telling you how much he loves you. Special, intimate. A stand-in for the four-word phrase he whispers into the silk of your skin, tattoos into your heart with his lips.

The realization he’s sharing a part of you he thought all his own sits bitter on the back of his tongue, an acid burn eating through his throat until he can’t find the words.

When you respond in kind with a soft, tender call a piece of him shrivels.

Standing in the kitchen adrift and lovelorn, Jungkook’s left with an empty longing he can’t name and no where to place it.

You weren’t together for more than six months before he proposed, knowing you were the one for him by the second date.

Maybe he moved too fast, was too receptive?

Growing up, he’d always been eager to move onto the next big thing, ready to jump head first. Some said that would come back to bite him in the ass. Was this the day?

Perhaps you regret saying yes so soon. Jungkook knows he’s not like other people. They need time to settle into their feelings like a house settling old wooden bones.

The last thing he wants is to make you feel trapped, suffocated under the weight of all his clingy, needy problems.

So he smothers the discomfort and walks into the living room. He shoots you a smile and inclines his head towards Jimin.

Thoroughly ignores the pulse of pain when he sees how cozy the two of you look cuddled up on the couch, legs tangled together with Bam at your feet.

That should be me.

You’re the best thing that’s ever happened to him.

He can’t lose you.

It’s there he silently vows to be less intense, less attached. Does his best to keep his hands to himself even though he wants to reach across the space between your bodies, and tug you into the cradle of his chest.

Bam picks his head up, cocking his ear to the side when Jungkook winces as Jimin reaches out to tug a lock of your hair, smirking around another purred baby.

Thankfully no one else but the dog notices his moment of weakness or the tension cutting through his shoulders.

Staring at his reflection, Jungkook tucks a lock of hair behind his ear and fiddles with his tie. The three-piece fits like a glove yet he’s never felt more uncomfortable.

He longs for soft cotton and baggy loungewear but tonight is important.

It’s your first year anniversary.

He’s had this night planned out months in advance; pulled all the strings needed to secure a reservation at one of the best five-stars in Gangnam.

You’ve been looking forward to it all week, and your excitement is infectious.

Only Jungkook’s mood sours as soon as he turns the corner to find you on the couch with company, dolled up and radiant. Jimin’s beside you, one leg crossed over the other and swirling a half-empty wine glass.

He says something too low for Jungkook to hear.

“Jimin!” You titter behind your hand, the flash of the jewels on your nails catching the light. “Sto-op! You nasty little freak.”

“What’re you doing here?”

Jungkook doesn’t mean to snap but the inner turmoil spills over before he can shove it down.

Your eyes lose some of their softness, the happiness fizzling from your expression like champagne bubbles. Mouth pinching in at the corners, you narrow your eyes.

A lump grows in his throat.

“What’s got you so pissy, Kook?” you ask.

Jimin clears his throat, averting his gaze to the side as he mindlessly plays with the stem of the glass.

The frosty look Jungkook shoots him withers under your pointed glare. Shoulders sagging, he runs his fingers through his hair, unable to care about how much he’s fucking up the style.

“Sorry Jimin, I… ahem. Anyway, are you gonna be ready to go soon?”

“Mhm, just let me finish up here,” you trail off, motioning to the last few sips of your own wine. “We’ve still got some time before we have to leave anyway.”

Before Jungkook can respond, Jimin cuts in while twining an arm over your bare shoulders, cheek pressed sweetly to yours, “You can’t rush perfection, Kookie. Isn’t that right, pretty baby?”

It’s no surprise your anniversary ends in disaster; a fight so vicious it has you fleeing with an overnight bag, refusing to look at Jungkook let alone speak to him no matter how much he begs you to stay.

Leaving him alone in an apartment ringing with your absence, terrified this is the beginning of the end and thoroughly convinced he’s the worst fucking husband ever.

It’s been several days of radio silence.

No amount of texting or calling gets you to answer. And it’s starting to get to him, going out of his mind with worry, with guilt. If only he hadn’t said this, that, and the other.

If only you’d stayed.

Now, everywhere he turns, Jungkook’s forced to face the jealousy growning like a weed in his heart. And every day it gets worse; a stone crushing his lungs, a bottomless pit curdling his stomach.

He doesn’t know where you are exactly, but his suspicions are proven correct when he nearly busts down the door to Jimin’s apartment only to have you invite him inside, stony-faced and silent.

The quiet doesn’t last, broken by the awkward clearing of his throat as he avoids your stare.

“What are we even doing?” he asks.

Your eyebrows shoot towards your hairline.

There are bags under your eyes and heavy lines around your mouth. You look like you haven’t slept well. Jungkook’s gut clenches, bile bubbling up the back of his throat.

It’s all my fault.

“I’m not sure what you mean, Kook.”

“Please.” He refuses to acknowledge the plea for what it is. “I can’t - I can’t do this anymore.” His voice breaks, cracks in two, tears stopping up his tongue. “I need to know.”

Your eyes flash with confusion. “Baby?” You step closer, hand outstretched and shoulders relaxing. “What are you talking about?”

His intentions are pure, honest.

But months of simmering anger, of doubting everything about himself (again), of resenting the fact he resents you, resents Jimin at all, bubbles to the surface.

He’s not proud of it, but Jungkook explodes; a match set to gunpowder.

“I’m talking about you and Jimin!”

“Me,” you ask, blinking owlishly, “-- and Jimin?”

Jungkook smiles, sharp and unpleasant. Bitter and disappointed. Grief makes him mean, nasty. “Yeah, you and Jimin. Do you think I’m stupid - were you just gonna keep fucking around behind my back?”

“Woah, pump the breaks! What the hell are--”

“Don’t even try to deny it.”

His eyes glint like shards of black ice, cool and assessing as he stares at you. Numb to the concern in your gaze, the purse of your lips. He’s slipping - he knows he’s slipping. Can feel the grief stricken rage pressing in at the corners of his mind.

The last thing he wants to do is hurt you, and yet he’s helpless to stop the words pouring from his mouth. “Did you like watching me make a fool of myself?”

You sneer, arms crossed over your chest so hard it looks like it hurts, “You’re doing that all on your own, Jungkook. I think you need to leave.”

“No, no, come on. I want to know. Why did you marry me if you don’t even want me, huh?”

Stalking closer, Jungkook corners you against the counter.

The smooth glide of his body is reminiscent of a large jungle cat, purely predatory. The uncomfortable thrill of it reflects through your gaze, the clench of your thighs.

Dark satisfaction curls low in his belly.

He asks, “Did he fuck you better, make you scream his name?”

“I don’t know what you’re talking about but you’re being a fucking pig,” you say, shoving his shoulder towards the door. “Now I really think it’s time for you to leave. Come back when you’re not being stupid.”

Strong fingers clamp down around your wrist, and Jungkook tugs you into his chest. His free arm curls around your waist, pinning you to his front. The heat of your body can’t drive away the sudden cold washing over him.

“Let go-”

“No.” He watches as any retort dies on your tongue, your eyes meeting his head on for the first time. Whatever you see hooks in, refusing to let go. “I’m not letting you go.”

Shivering, you try to tug your arm free, “Jungkook, please. You’re starting to scare me.”

In lieu of a response, Jungkook dips his head, and inhales the scent of your hair. Dragging his nose down the length of your neck as the familiar perfume floods his lungs. Soothes the prowling beast caged in his chest.

A rumble of satisfaction vibrates through him into you, your nipples stiffening against him.

Jungkook sighs, “You always smell so good, baby.”

The tension threaded through your frame releases, your edges softening until you rest against him fully. Shivers race down his spine when your breath tickles his ear.

You call to him softly.

He hums, nuzzling into the side of your head, “Mhm?”

“Can you let me go now? Promise I won’t go anywhere.”

Jungkook pulls back to look at you for several long seconds. Unlatching his fingers, he watches as you flex your wrist. Then reaches up to tenderly curl the digits around your throat, transfixed by the sight.

A hook of arousal sinks into his stomach.

Yanks hard when you gasp at the push of his thick thigh against your pussy, your whine when he flexes the muscle. With a soft cry, you sag into his body while your hands fly up to plant themselves on his biceps.

“K-Kook!”

“Mm, that’s it.”

The bubble of emotions boiling under the surface of his skin is at odds with the satisfaction coiling in his belly, the interested twitch of his cock.

Jungkook rolls his thigh and works you along the length of it. The heat of you burns through the cotton of his lounge pants, so warm and soft and wet.

"Don't--" your protest trails off, smothered by your teeth as your eyes flutter in pleasure. "Hn!"

Shit, he wants to bury himself so deep inside you’ll never forget the stretch. Ruin you so good with his cock you won’t dream of anyone else ever again. He’d make you his and his alone.

Fingers tightening around your neck, Jungkook murmurs, “Let me hear you, baby.”

Unsuccessfully trying to ignore how good the friction is, you shake your head in denial. But there’s no hiding how turned on you’re getting, panties sticky and thighs clamping around his.

You’re absolutely soaked, evidenced by the growing dark patch on his leg as he grinds you into a sloppy mess.

“W-We can’t, Jimin’s h-home.”

Mentioning the other man is a mistake, and you know that.

Jungkook sees the realization light up in your eyes seconds after he tenses, rutting up against you harshly. The bulge of his cock digs into the dip of your hip, throbbing in time with the labored heaves of his chest.

His kneecap catches, the sharp ridge smashing into your swollen clit. Your mouth drops open, and Jungkook slaps a hand over your face before the wail escapes.

He knows he’s being rough, but the tears in your eyes soothe some of the hurt. And honestly, he can’t bring himself to care overmuch, especially when your hips jerk against his.

“Better be quiet. We don’t want Jimin to hear us,” Jungkook snarls, “after all, what would he think if he saw how bad you’re gagging for your husband’s dick?”

Your indignant response is cut off by another muffled whine, his teeth sinking into the corner of your jaw.

A weak spot of yours - Jungkook abuses it to his advantage. Swiping his tongue through the layer of sweat that clings to your skin, the salt bursting across his tongue.

He groans.

“I don’t give a fuck what you or Jimin think.” His breath puffs warm and moist over your ear, voice whiskey rough when Jungkook says, “You married me. You’re mine, baby, and I don’t share.”

Relocating, his hand releases your throat and finds your hips. He slips under the mid-thigh hem of your oversized nightshirt, and snaps the waistband of your panties with a firm tug.

Pulling the fabric free from between your legs, he tucks the ruined fabric into his back pocket as a souvenir.

“K-Kook,” you say, voice warbling.

He hums, eyes glittering dangerously as his fingers brush over the top of your slit. Your clit jumps beneath the pad of his finger, swollen and throbbing.

When you hiss low between your teeth, he smirks, and bullies the little nub with rough circles until your hips shift from side to side.

“Ah, shit, baby. Can you hear how sloppy your pussy is?”

Jungkook dips his fingers between your folds, playing with your gummy walls as he gathers your slick, teasing the rim of your entrance. The filthy squelches echo out into the otherwise silent apartment.

He preens, chest puffing up with pride, and says, “He can’t make you feel the way I do. Can he?”

Without warning, he slides two fingers deep inside to the third knuckle. Chuckles when you burrow your face into his shoulder, your nails dragging raised lines of heat down his arms as your walls give, fluttering around his thick digits as you adjust to the stretch.

“Mm, you always take me so well, baby.”

You clench at the praise, and Jungkook pumps his fingers in reward, curling up to massage at the spongy patch of your g-spot. You whine, head tossed back and thighs shaking around his hand.

Pain shoots through the base of Jungkook’s spine, and biting back a curse, he reaches down to adjust his cock from where its trapped against you, swollen and leaking.

“Yeah, you’re such a good girl.”

“Please,” you whine before mumbling something else.

Jungkook’s not sure what it is, but figures it’s not all that important when your eyes roll back into your head and your hips twitch.

You start to bear down on his fingers, walls tensing and releasing.

“Gonna cum?” Jungkook nips at your bottom lip, panting into your mouth and sharing breath as his eyes bore into yours. “Fuck! Do it. Wanna feel you cum all over my hand.”

God, you look so good like this; eyes teary and brows crinkled, sweat-slick and mouth slack. A sight he never wants to be without. His sweet girl, his baby, his wife.

“Yeah, that’s it.” His fingers curl and pulse, pet and stretch. “Now open those pretty eyes.”

A hand curls around your jaw, tugs at your chin.

“Look at me,” Jungkook breathes.

Please.

He watches, greedy, as your lashes flutter, the lids weighted down by pleasure. Eventually, you manage to crack them open, and he ruts forward in response. His groan vibrates his lips as they smash into yours in a violent kiss.

You pull away with a gasp, slick dripping down your shaky knees. “I can’t - hnggg - fuck, Kook!”

“Tell me who you belong to.”

He’s unforgiving in his demands, a cold fire burning in the depths of his eyes. His cock throbs, his hips trembling with restraint as he stops himself from rutting to completion against you.

His heart hammers against his ribs, and his stomach swoops.

The answer will either make or break him.

Anticipation floods the room with tension; hovering in the air like a word about to be spoken.

“Tell me.”

“I -- you, Kook, I’ve always belonged to you,” you say, clenching down around him. “Please.”

Capturing you with his gaze, Jungkook hooks a thumb into the corner of your mouth. All the hurt, all the doubts, all the rage bleed out of him like water tossed over the embers of a campfire.

Leaving behind the single-minded desire to give you what you want. What you deserve. Because you’re his and the only thing he wants to do is take care of you.

Love you like you deserve to be.

Like only he knows how to.

The taste of your skin is sharp and bright when his tongue flicks against yours, and he hisses into the plush of your mouth, “Cum.”

Keening, your pussy throbs once, twice. Your belly contracts. And then you’re gushing wetly, a warm flood of slick soaking the palm of Jungkook’s hand, dripping down to puddle on the kitchen tile. Your walls ripple, muscles spasming as you shake apart in his arms.

Jungkook holds you through it, soothing the aftershocks as you slump into him - a marionette with its strings cut. You’re cotton soft, cloudy. Head lolling on his shoulder when you look up at his profile with hazy eyes.

“Show off,” you slur when you catch the sight of his satisfied smirk, the puff of his chest as he stares at something behind you. “Can’t believe you made me cum all over Jimin’s kitchen floor.”

The sound of a choked-off, slightly hysterical laugh comes from the entryway, “Oh, I can. Just glad to see you guys finally made up. Now I’m gonna go wash my eyes with bleach.”

#jungkook x reader #jungkook x you #jeon jungkook x reader #jeon jungkook x you #jungkook smut #jungkook fic #bts fic #bts fanfic #jungkook fanfic #bts jungkook #jungkook imagine

2K notes · View notes

bumblesimagines · 20 days

Text

Bundles of Joy, Bundles of Anger

Request: Yes or No

Summary: Upon becoming man-grown, Jace was wed to his mother's cousin, the daughter of Daemon Targaryen. Months later, the war breaks out and surprising news of his child being born reaches him soon after returning to Dragonstone to say his final goodbyes to Luke.

Pronouns: She/Her/Hers

CW/TW: Typical GoT/HOTD warnings, mentions of pregnancy and childbirth, arranged marriage trope, Targcest (Cousins)

so short I do not know why my F!Reader stuff ends up being short

~~~

A million thoughts raced through Jace's head as Vermax descended through the clouds and the ancient castle of Runestone came into view, nestled by the water and essentially isolated by the rural landscape expanding in nearly all directions. His heart raced faster than his mind and his orders for Vermax twisted on his tongue but his dragon nonetheless understood the urgency in his tone and tucked his wings closer toward his body, plunging the both of them toward the ground at a higher speed before expanding them once more and gliding closely over the vibrant grass.

It'd only been two days since Jace received the shocking news flown in by raven revealing his lady-wife, Princess (Y/N), had given birth to his child a month prior. The surprise on his face had no doubt been comical when Maester Gerardys awkwardly read the contents of the letter at the meeting and remained standing in silence as Rhaenyra and everyone else took in the startling news.

There'd been no word from Runestone, not since (Y/N) had sent a letter detailing an illness to explain her absence from attending alongside them while the claim to Driftmark was disputed. At the time, Jace had shrugged it off and dismissed Baela's insistence that he tend to his wife. They hardly enjoyed each other's company so he saw no use in visiting her and causing her further strife, but now as he watched Runestone grow closer and closer, he kicked himself for not heeding Baela's words.

Their presence roused the dragon sleeping near the castle and the shriek from her forced Vermax to slow down. His dragon responded to the call and diverted course toward her, flapping his wings until his speed slowed further. He landed near the she-dragon and lowered himself onto the ground with a quiet chirp. Jace carefully climbed down and landed firmly on his feet, instinctively tugging off his riding gloves and eyeing the bemused she-dragon who seemed half-tempted to burn them both.

"Sagon gīda, Starlight," Jace called, swallowing down the fear that bubbled in him as he began walking toward the path she conveniently rested beside. Starlight huffed a cloud of smoke at him and squinted her emerald eyes at him, her head following him until he reached the gates of Runestone.

"Prince Jacaerys," An older man he recognized as Gerold Royce greeted him when the gates opened, bending at the waist. "Our Princess of Runestone has been expecting your arrival, My Prince. She awaits you in the nursery. Come this way, if you please."

The nursery.

Jace nearly stumbled over his feet at those mere words, luckily catching himself before he made a fool of himself before men who eyed him with disdain. He knew of the Royce's dislike for Daemon Targaryen (especially after the supposed murder of Rhea Royce) but he never expected it to extend to his family and himself. Still, he kept his head held eye and one hand on the hilt of his sword as he followed Gerold into the castle.

"I was not aware of Princess (Y/N)'s... condition."

Gerold glanced back at him. "We know."

A familiar rush of anger spread through him like spilled water. He gritted his teeth and inhaled sharply, his nostrils flaring. "Why was I not informed sooner? I may be young but I am no fool; I know pregnancies may last up to eight or nine moons." He tried restraining his simmering anger. He knew very well how loyal the man was to his blood.

"Our Lady desired a peaceful pregnancy, My Prince. She did not wish to be disturbed or bothered during such delicate times." Gerold explained simply and Jace allowed himself a brief scowl before he wiped it off his face once they came upon a guarded door.

Stepping inside, Jace's eyes were instantly drawn to the crib in the center of the room and then to his wife seated near it. She looked away from the crib at their presence and sighed quietly, sipping the last of her tea before she set it aside and rose. (Y/N) exhaled deeply, her nose crinkling and her hand pressing near her back to massage the flesh. Jace spared Gerold a glance and walked forward toward her, extending an arm to offer his support but she stopped him and waved him off.

"You may leave us, Cousin. Thank you." She told the older man, offering him a brief genuine smile that promptly disappeared when he left.

Jace finally noted her appearance up close. She looked exhausted, as was usual of mothers after labor. The bags under her (E/C) eyes were noticeable through her powdered skin and she'd discarded her usual dresses for a simple thing gown that showed her belly still full from the pregnancy. He knew from his time in the Keep that most women differentiated from each other; some, like Dowager Queen Alicent, were able to lose the weight gained during pregnancy fairly quickly whilst others, like his mother, retained it for some time.

A gurgled coo brought his attention down toward the crib and he finally looked upon the baby. "Oh.." He shakily whispered when he noticed the head full of brown hair with silver streaks through it, strands that curled subtly at the ends just as his once did before he got older. Small, frail, and so beautiful. His child. His. He hummed forcibly when tears abruptly sprang to his eyes. "What- What is their name?"

"His name is Valerion."

"A boy?" Jace breathlessly questioned, his head snapping back toward her with widened eyes. "A- A son?" An heir.

He looked back at the little being happily dozing and his heart twisted into itself, cautious steps bringing him closer to the crib. He reached out tentatively and carefully took him into his arms. Valerion stirred in the golden bundle he'd been wrapped into and parted his eyes to peer up at him, blinking sleepily and sighing before his eyes closed again to doze off. Jace chuckled and leaned down, nuzzling his nose against Valerion's forehead.

"Your grandmother will be pleased." He whispered and drew back, carefully bouncing his arms as he'd once seen his mother do with Joffery. "A perfect little dragon. You shall be given an egg soon enough. Silverwing has recently laid a clutch and one shall be yours, little one. Once we return to Dragonstone-"

"Valerion and I will remain here in Runestone until further notice." (Y/N) cut in swiftly and his brows knitted together. "Runestone is a safe castle, Jacaerys. If the enemy comes, they will be seen before they can come close and dealt with. I am in no state to travel and neither is he at such a young age. He will see Dragonstone and the Keep after the war."

"I cannot stay here, (Y/N). I am needed in Dragonstone to serve alongside my mother, you know this. You will heal in time, and it will be much better if you do so under the care of Maester Gerardys. He will be safe-"

(Y/N) scoffed. "Your mother was nearly slain in her own bedchambers and the Greens are merely a short flight away from the island. I will not risk my child's life, Jacaerys. It is your duty to serve on Dragonstone, it is mine to serve here. Runestone is my castle and my responsibility to protect it, just as it is my responsibility to protect my son." She spoke, tone full-on authoritative and eyes challenging.

Jace stared at her in disbelief and grounded himself enough to delicately place Valerion back in his crib before he faced her. "Was this all part of your plan to alienate me as much as possible from my child? We have not spoken since our wedding night nearly a year ago and you remained silent on your pregnancy. I could have been here to see him enter this world. I should have been here- No, you should have been in Dragonstone."

"You are a fool if you believe you would have been any help. You would have hovered like a bothersome fly and questioned every single thing as if you had any idea what a pregnancy is like. I remained here in Runestone with my family and I delivered a healthy boy with the help of Maester Corrad and the midwife. This child is Royce as much as he is Targaryen. If you were to pass in battle-"

"Is that what you hope?" Jace bristled as he spat words laced with accusation. "Do you wish for me to pass in battle so that you may rid yourself of this marriage? We made vows, oaths, in the name of the Seven or have you forgotten? We have duties to one another, regardless of our desires, and we are bound to each other. This child is mine as much as he is yours. He needs his father. We do not know how long this war will rage on and I will not allow him to see me as a stranger."

(Y/N) released a sigh and lowered herself down onto the cushioned seat, resting her arms over her belly and watching him. "Then, you may visit as you have done today." She said simply and he scoffed again. "You believe because you are Crown Prince that your duties are more important than mine but if I recall only one of us currently rules and it is not you, Jacaerys. I have ruled Runestone since my flowering at the age of eleven whilst you spent your days tormenting Aemond One-Eye, being spoilt and coddled endlessly by your mother, and trailing after the Velaryon girl like a fool."

His face flushed with embarrassment and anger and he took a glance at his son to ease the bubbling emotions threatening to spill over. Jace inhaled deeply and squeezed his eyes, releasing the air and forcing his tense body to relax. He stepped forward and unclasped his sword's holster before bending his knee in front of her. He set the sword aside and reached forward to take her hands into his.

"I understand." He murmured. "I do, I truly do. I understand your concerns and- and I will try to find a compromise that will please us both. I do not wish to fight before our son but I ask of you, as your lord-husband and father of your child, to consider my side of things. I know we have been far from a happy couple and I will admit my feelings for Baela have not left entirely.. but I am willing to change. For you. For him."

476 notes · View notes

basketonthedoorstepofthefbi · 5 months

Note

Hello!!! I have a request if that’s okay with you. 💕

Would you maybe write a Spencer x quiet!reader? Where she doesn’t have the courage to talk to him because she’s too shy?

I don’t really have a plot in mind so that’s up to you!! I’m sorry I couldn’t come up with any ideas but hopefully it lets you write whatever you want. Thank you for taking the time to read this. And I read your other stories, you’re so underrated and amazing I love your wording when you write. 🥹🫶🏻🫶🏻

Hi Mary!! Thank you so much for your kind words c:

I did my best c: I hope you like it!

Round Table (Spencer Reid x shy!gn!reader)

Pairing: Spencer Reid x shy!gn!reader (if not gn please let me know, but I'm fairly certain it is!)

Word Count: 1538

Warnings: mentions of anxiety, but besides that none?

A/N: this was so fun c: i am really enjoying challenging myself with your guys' requests. hope you enjoy!!

------

You were an incredibly anxious person, which, honestly, was okay. You tried not to let your anxiety hinder your life too much, but like any other human being, sometimes it got in the way. It was frustrating, sure, knowing that a situation would be so much easier if you weren’t so anxious about it, but you reminded yourself often that you weren’t perfect, and neither was anyone else.

Some people were afraid of heights, of the ocean, of needles. Some people had trouble going out into crowds or grew overstimulated in public places.

You? You were painfully shy. There was always an adjustment period to being around new people.

Baristas, the bus driver, pharmacy techs, cashiers at the grocery store - you did just fine. But those were one-time interactions, brief discussions that you could compartmentalize.

They came with a script to follow, with cue cards already queued up in your head as they occurred. You could put on an emotional mask for five minutes while the nurse at the clinic gave you a flu shot. You could smile and speak in your special voice labeled Getting Coffee, an octave higher than you usually spoke, in order to acquire your much-needed beverage. There was a clear goal in mind with each of these dialogues. Sure, you didn’t present as the most confident person in the world, but you always made it through conversations like these without stumbling over your words or being too terribly awkward.

You didn’t succeed as much with deeper connections, with ones that took time to cultivate. You were a guarded person to begin with, with only a handful of people you felt truly close to. Vulnerability had always been difficult for you, but you supposed you were in the majority on that front. It took a while to become comfortable around coworkers, extended family, hell, even your therapist. You had to have time to adjust, to settle in.

A lot of people in your life thought you were just socially awkward or even an agoraphobe, but you didn’t mind being around people. It was the intimacy, the connection, the having to give away little pieces of yourself, that made you anxious. It kept you from participating in conversations most of the time, usually only speaking unless spoken to.

You liked your job as a linguistics and handwriting analyst in the FBI for that very reason. You didn’t have to say much to people unless it was related to a case. With a clear goal in mind, a threat to neutralize, you could turn on that mechanical part of your brain that spouted off facts, information, theories. You didn’t have to tell anyone about your weekend, about your hopes and dreams or your favorite foods.

You were consulting on a case for the Behavioral Analysis Unit - a serial killer who stalked his victims months before their murders, sending handwritten letters and using poetry to taunt them. Your supervisor had asked you to collaborate with the BAU, sending you to the sixth floor on your own.

For the last two days, you’d been working closely with Dr. Spencer Reid - Spencer, he insisted you call him. Just a couple of years older than you, but still very young for his role in the FBI. He was friendly, and very smart, and he rambled on about all kinds of things -

Everything, actually. The Chinese food you’d had for lunch on the first day? He explained the origin of fortune cookies. Did you know their first appearance in the US was in San Francisco in the late 1800s?

Pointing out a Dickinson line in one of the UnSub’s letters? Did you know only ten of Emily Dickinson’s poems were actually published when she was alive and the rest were posthumous?

You often just nodded along and smiled, occasionally throwing in an oh, that’s very interesting to appear as an active listener. And you were an active listener. You did genuinely think he was interesting, and you found his info dumps to be incredibly endearing. But your contributions to the conversation were abysmal in comparison.

Beyond discussing patterns in the UnSub’s letters and what it might mean for each victim, you had no other fascinating information to share. You didn’t do well with small talk, and Spencer didn’t ask you any overtly personal questions.

It wasn’t until close to the end of the second day spent in the conference room of the BAU’s office that Spencer asked you a direct question about yourself.

There were three evidence boards set up, all full of scanned copies of the letters, each one pinned up meticulously by you and Spencer the day before. The large round table in the room had letters stacked out all around it, each one bagged in protective plastic.

Spencer was standing in front of the evidence boards with his arms crossed over his chest, studying the photocopies with his head inclined to the side.

He broke the silence you had been slowly settling into the past two days. “Your supervisor said you had a specialization in poetry?”

You nodded, stepping over to the table and carefully lifting one of the letters up. You liked how he spoke as if you two were in the middle of a conversation, when in fact, it had been totally silent for the past half an hour, save for the soft puttering of the air conditioning vent.

“Studied a lot in undergrad,” you squeaked out, clearing your throat as you held the letter up the fluorescent light above you to examine the stationary.

“What university did you attend?” Spencer asked, and you turned your head to find him inclining his head to the side. He actually wanted to know?

“I went to Bennington College to study poetry,” you said softly, suddenly finding it difficult to focus on the letter in your hand. “But I went to graduate school at Georgetown. Master’s in Linguistics.”

“Really? That’s fascinating,” Spencer commented, which caught you by surprise, especially because he didn’t sound the least bit sarcastic. “That combination of degrees is exceedingly rare. Generally people who major in poetry often either go on to complete as far up as a doctorate in the subject or they stop at a Bachelor’s degree. The latter statistically don’t end up working in a field related to poetry, either, so their degree is basically useless.”

You weren’t sure if you were supposed to be offended by that, so instead you just nodded your head politely. “Okay,” you murmured, biting your lip.

“Can I ask you another question?” Spencer asked, and set the letter in your hand down on the table. You smoothed your hands over the fabric of your shirt and nodded. “Do I… do I make you uncomfortable?”

You shook your head. “No,” you said assuredly, and then, a little more hesitantly, “…why would you ask me that?”

Spencer turned to face you. “You’re just very quiet unless we’re discussing the case. Which is fine, of course, but I just… I don’t know. I thought maybe you were annoyed by me or I said something to offend you.”

You felt guilt spread over you and your cheeks turned pink. The last thing you’d wanted was to make anyone feel bad who didn’t deserve it. And the very kind, helpful, and adorable Dr. Spencer Reid was the furthest from deserving to feel bad.

“I just don’t talk a lot,” you tried to explain. Your hand rubbed the spot where the top of your chest met the skin of your neck, an anxious habit you’d had for years. “I mean, I do with people I know, and that’s not to say I dominate the conversation by any means, but I just…” you realized you were rambling. “You didn’t do anything wrong,” you added, your voice just above a whisper.

“Thank you,” Spencer’s lips flickered into a straight-lined smile, one you had seen several times over the past few days, often when unintentional eye contact was made across the table. “For clarifying, I mean, that I didn’t offend you.” He cleared his throat, and leaned against the round table, standing just a few feet from you. Still a very professional and comfortable distance, but closer than he had been before. “So, does that mean that if we got to know each other, you’d talk more?” The corners of his lips spread out and his smile grew.

You tore your eyes away from his to look at the letter in your hand, the protective plastic around it crinkling between your fingers. You weren’t actually looking at the letter, though. You’d just needed somewhere - anywhere - else to look. “That’s generally how it goes,” you murmured, biting your lip.

“So, if I were to, for example, ask you to meet me for dinner sometime, could the getting to know each other happen there?”

Your eyes fluttered over to Spencer’s and you saw him smiling. You could tell by how he looked at you, with his head inclined just slightly to the side, that he was being fully serious. You nodded, unable to control the small smile on your face.

Spencer grinned, and you could tell he couldn’t resist when he spoke again. “So, is that a yes?”

#spencer reid fanfic #criminal minds #spencer reid x reader #spencer reid #spencer reid x y/n #basketonthedoorstepofthefbi #criminal minds spencer reid #spencer reid fanfiction #spencer reid x you #spencer reid x gn reader #spencer reid fluff #spencer reid fic #spencer reid x self insert

725 notes · View notes

qwimblenorrisstan · 1 month

Text

Insufficient Pt. 2 | Azriel x Reader

Summary: Following the disastrous breakup between you and Azriel, Nesta invites you out to a night at Rita’s, where you then discover that you might not be as safe in Night Court as you think.

Word Count: ~ 4.3k

Warnings: Stalkings, nasty public bathrooms, alcohol, drunk people, obsessive behavior, painfully bad description of blackjack, etc

A/N: ok so I kinda switched gears with this one, I’m trying to flesh it out before introducing another man, but lmk if you liked it, or if you have any opinion on where you’d like it to go, hope you enjoy <3

Requests are open!

Previous | Masterlist | Next

Only a week had passed since the disastrous breakup between you and Azriel, and as it turns out, it was harder to get rid of him than you’d originally thought.

Beforehand, he’d always seemed so controlled and stoic, that even being one of the main problems in your relationship was that he couldn’t ever let go of control. Being in charge meant he felt safe and secure, regardless of his feelings.

He had always seemed almost above you at times, above groveling and begging in bed, above communicating his feelings and emotions normally as he just expected you to read his mind or moods despite the way he hid any kernel of emotion from his body language. However, all of that seemed to have changed.

After the breakup, you’d gone back to working in the bakery, working specifically in the back making bread with your family, so you wouldn’t have to see him when he came in, probably trying to hunt you down. The heat the ovens gave off also seemed to repel his shadows, for whatever reason, so they wouldn’t spy on you any more than they already had. Though he had come asking for you before at the counter, your family had always shut him down. You felt bad about it for a second, but thinking back, you also didn’t. He’d chosen his words, and he was only sorry because you were his mate.

You’d moved back into the family home for now, your relatives surrounding you in love and empathy, and plenty of righteous fury regarding Azriel, and even a few “I told you so.”’s from the older generations.

Nesta would come by to visit now and then, having tea with you and updating you on all the latest news and developments, if not just funny stories to bring your spirits up, such as Nyx swallowing an ancient coin that he got from Rhys’ desk, only to poop it out shiny and clean a few days later, or how Cassian got so drunk he jumped from the top of the townhouse into a nearby pool that belonged to a neighbor.

On the bad days, she would offer some quiet company, or even open up to you about similar things that happened to her in the past.

Specifically, her past relationship.

She didn’t give a name, simply the details that he was a poor man’s family, his father abused his mother, and he was no better. She only was going to marry him to let Feyre take better care of Elain, really, even if it ended up with her getting beaten by some pathetic man. And then she told you of the night she rejected him, and tried to break it off, and how she almost barely got away before he could take what wasn’t his.

You both sat in silence after that, your hand in hers.

Eventually, though, the conversation continued. You told her of the flowers that would mysteriously appear on your windowsill each morning. Neither of you knew how Azriel knew what room you occupied in your family’s home, or even how he knew your address or favorite type of flower, Ditch Lily’s, but he knew. Or the letters you received nightly, always carried by some bird of prey to your window, and would leave it there.

She snorted when you told her about the letters.

“He’s being ridiculous, seriously, even Cassian isn’t that bad. He only cares because you’re his mate, not because of who you actually are, and until he gets his shit together I wouldn’t even open them.”

She said, taking a sip of the herbal tea your mother had prepared for both of you. It was a special recipe, one that some of your distant relatives in Autumn Court had created, originally meant to relieve muscle tension and stress from overuse of magic, and even assist in alleviating burnout. You were mildly convinced that there might be some healer blood in you, because of that half of the family.

You could’ve sworn you felt a tiny tug on the bond at the mention of Azriel.

“I know, I’ve just been burning them, but he won’t leave me alone. Every shadow feels like they’re watching me now, and I just…”

You sighed, trailing off as your hand went to rub the bridge of your nose, and she gave a hum of acknowledgment, finishing your sentence for you.

“Don’t feel safe in the one place that you used to only feel safe in?”

You glanced up, eyes widening a bit. That was precisely how you felt.

“Yes, how..?”

She took another sip of her tea, glancing over to the window and looking out of it, eyes almost glazing over as some memory must’ve come to light.

“Beneath the House of Wind is the library, though I’m sure you’ve already heard of it. The priestesses stayed there, and it was always quiet, and something about it made me feel…safe, even when I was in an unfamiliar body in new surroundings, the world in the middle of a war.”

She said, and you nodded, waiting for her to go on. You knew plenty of the library beneath the House of Wind and how massive it was.

“One night, me and Feyre both descended nearly to the bottom, for what I can barely remember, and there were two twin males. Sent by Hybern, I think. They were taken out before they could do any harm, but the damage was still done. It took me quite a while to think of the library as a safe space after that.”

The glaze in her eyes faded away as she took another sip of her tea, looking more relaxed than before. She looked over at you, her eyes meeting yours.

“How did you get it back like that? A safe place, I mean.”

You then asked, and she looked away for a moment to think, a common habit of hers. One you’d noticed by now. Always noticing things, something you must’ve learned from Azriel, and as much as you hated the reminder of him, it was useful regardless.

“Changing environments helped me. During and after the war, we were always traveling a lot, which forced me to appreciate the thought of home more. Then again, home was also linked with Cassian for me.”

She said, thinking aloud before eventually speaking again.

“I’d try moving around a bit. Exercise helped me, especially travel and hiking, or breathing exercises. I could teach you a few if you’d like?”

She offered. You would be a fool to refuse any sort of advice or help from Nesta Archeron, and she’d never led you astray before, so you nodded, and she smiled brightly, clearly happy to show you.

The next few hours were spent in the backyard on whatever flat surface there was, practicing impossibly stretched that seemed like whoever made them wanted to turn you into a pretzel. Nesta managed them just fine but didn’t laugh when you fell, only helped you back up, telling you all about how when she’d first started training with Cassian, it had been just as hard for her too.

She’d even outright refused to do it the first few times.

However, after that, she showed you cool-down exercises and helped you practice breathing techniques.

“Wait, so…I hold it for how long?”

You asked, and she held back a giggle at the sheer confusion in your tone as she answered.

“Twenty seconds, but you can-“

“TWENTY??”

At that, she burst out laughing, and before you knew it you were laughing too, both of you laying back on the grass of the yard and hoping none of the seasonal bugs crawled up onto you. She finally sat up a moment later, wiping tears from her eyes as she stood and helped you up.

“Build up from five, you can start at five seconds and build up, is what I was going to say.”

She said, and you sighed.

“And I thought I was in shape before.”

You said in an amused tone, and she snorted again, only for the both of you to look over where you heard another loud snort and see Cassian standing, leaning against a large tree in the backyard. He was grinning widely as ever, his eyes full of pure glee.

“Having fun without me, ladies?”

He asked, putting a hand over his heart in a dramatic expression as he rolled his eyes, acting fatally wounded.

“Honestly, I’m hurt-“

He wasn’t able to finish his sentence before you barreled into him, giving him a tight hug that he chuckled at and returned, ruffling your hair. Nesta was soon to follow, and hugging him in a much more elegant manner than you.

When you finally separated, you spoke.

“Gods, I’ve missed you. We should let him come to tea time, too, Nesta.”

You said with a grin, and Nesta rolled her eyes playfully, squeezing his bicep. A tiny twinge of jealousy seemed to echo down the bond, as if Azriel had seen you hugging Cassian, and didn’t appreciate it. Another tug on the bond that you shut out, now hyper aware of any shadows.

“You’d be surprised at how much of a gossip he is, it’s never-ending with the Devlon-rumors.”

She said, and his expression shifted to playfully offended as he swatted at Nesta’s hand. You giggled, and Nesta glanced over at you, before gaining a thoughtful expression.

“We could do Rita’s tonight if you could make it?”

She asked, and Cassian gave a little nod as if also agreeing with this. You didn’t have any plans tonight, so why not spend a night out with your friends? It would certainly help you get your mind off of things.

“Sure, what time?”

You asked, head cocked slightly to the side. Nesta shrugged.

“Is 6 good for you?”

She asked, and you nodded in confirmation. She gave you one last smile before Cassian scooped her up to fly away.

“See you tonig-“

Her words were cut off with a little shriek as Cassian launched into the air at maximum speed just to spook her like he always did, and you giggled to yourself, heading back inside the family home. Unbeknownst to you, a shadowy figure lurked behind that tree after Cassian left, watching.

To be fair, the shifts were switched out now and then so everyone had a break, but he usually ended up babysitting. Despite his objections and complaints, he was good at it, sort of a baby-whisperer.

“Who was that pretty lady?”

He asked, a slight touch of color on his cheeks as you smirked with a knowing look.

“That was my friend, Nesta. She’s taken.”

You clarified for him, noticing the way his face fell in disappointment all too clearly before you patted your baby cousin on the head, and walked up to your temporary room. Maybe Nesta’s idea of traveling a bit and exploring different places was good. You had all of immortality ahead of you, after all. Might as well use it well.

You walked to your room, before going to the bathroom attached to it. You were more than lucky to get a room with a bathroom attached, and you knew it, since everyone bickered over who got to shower first and who had been in there too long for the normal bathroom in the hall. Stripping your clothes off, you turned the water on, letting it settle to a warm, but refreshing temperature.

You went through your entire hair routine and washed your body off, shaving and everything. Tonight was an everything shower. You wanted to look your best at Rita’s tonight, and you desperately needed a confidence boost after what Azriel had said to you.

Nearly half an hour later, your hair done all pretty, makeup on, and a pretty red dress gracing your form. You’d even painted your nails yourself, forgoing the usual stylist you went to for it.

By the time 6 had rolled around, you were almost to Rita’s, walking down the bustling streets of Velaris as the cool air blew by, the sun already beginning to set as early as it did in this season.

The moment you walked into the bar, already full of people, it only took a few seconds to spot Nesta and Cassian inside. Cassian was drinking and laughing his ass off with some other males, and doing arm wrestling that he never seemed to lose at, and Nesta was playing poker, and by the looks of it had already won a few games before based on the sly smile she wore.

You walked over and ordered your drink, nothing too strong, and decided that you could take a little time away from Nesta for now. You couldn’t help but feel a little guilty, considering she’d been listening to all of your problems every time she’d come over. It was probably best if you gave her a little alone time for herself.

Walking over to a table to try your hand at what looked like a boring game of blackjack, you were about to sit down when something captured your attention.

A lone shadow lurking beneath your feet.

You swallow, getting a weird feeling about it, but you simply stomped one foot down on it before sitting down, determined not to let something so small ruin this night for you. The cards were dealt, and you received a queen of spades and eight of clubs, and as the game progressed, you took risks, choosing to hit, and somehow miraculously not going over 21 the entire time. You felt the lightest tug on the bond, but ignored it.

It was mildly suspicious, considering how bad you usually were at cards. That was until you spied the same wispy shadow from earlier on the deck of cards, hiding in the normal shadow of it. It was discreetly moving cards, changing them for you to win.

Now incredibly annoyed, you excused yourself from the game and walked to the bathroom. Rita’s bathrooms weren’t extremely clean, but you just needed a place to take a breather.

You pushed the door open, not surprised by the few females in here who were either redoing their makeup or drunk out of their minds and crying. Oddly enough, though, they filed out almost as soon as you entered, some giving you off looks as you entered one of the stalls, sliding the lock closed, and sat on top of the toilet seat, pulling your knees to your chest.

Sure, things were weird tonight, but it was probably just Azriel trying to play mind games with you. He was a Spymaster. His entire job revolves around torturing information out of people and playing mental gymnastics to get what he wants from them. You wouldn’t be surprised if he was now hyper-fixated on you, determined to get you back if only to feel better about himself.

You heard the bathroom door open, barely creaking as the lightest footsteps became apparent to you. Probably another drunk woman, or someone looking to fix their makeup or outfit. Nothing out of the usual, you told yourself, even as your body began stiffening and your heart rate sped up. A lock clicked. The bathroom door.

You couldn’t get a decent whiff of the stranger, whether it be the alcohol or the reek of the bathroom in and of itself. Not daring to open up the stall or peek out, you became still as a statue.

Nearly silent footsteps.

A knob creaked, probably the sink, and water began running at its maximum speed.

Another sink turned on.

Then another.

Until all the sinks were on.

Your heart began beating faster. Why would anyone turn all the sinks on, if not to cover up the noise of something else, or someone else making loud noises?

Louder, bolder footsteps in your stall’s direction.

Glancing down beneath the door, you could see a pair of thick, black leathery boots now standing in front of it. You recognized those. How could you not?

A certain shadowsinger’s shoes. His work shoes.

You didn’t dare move, even as you heard a knock against the stall. It would’ve seemed polite in any other situation, but not here, not now.

“I know you’re in there.”

His quiet voice spoke, still filled with that tension you’d seen in his eyes the day you’d decided to finally break free of him.

He knocked again.

“I’m sorry for what I said, I shouldn’t have said that, if you would please, please, just give me another chance, I’ve been trying to talk with you for days but you were busy, and when I saw you here tonight, I thought that maybe we could talk this out-“

He said, voice filled with pleading and desperation as he rambled on. You’d never heard him express so much emotion before in his voice. It was interrupted by the bathroom door almost being opened, despite it being locked. A bang on the door, and Nesta’s muffled voice was heard through the door.

“Bullshit, I’m getting a worker..”

Azriel must’ve known he had limited time now, because he banged on the stall door louder, a bit more panicked.

“Please, just open the door. I’m sorry, just let me in. We can figure this out.”

He said, now shaking the stall door with the handle, and you didn’t dare move. Didn’t speak, didn’t do anything other than sit and pray to whatever gods you believed in. The Mother. The Cauldron. Anything. Whatever would make him go away. You had known the respectful, kind Azriel. The one that had waited centuries for Mor and not pushed anything, even when she openly went to other males and pushed him away. The one who wouldn’t push any boundary, but this Azriel…you didn’t know him.

The jingling of keys outside the bathroom door was heard, the worker Nesta must’ve called, and a frustrated sigh came from the voice outside your stall.

You could almost see it now, him angrily running his hands through his inky black hair, shadows swirling and writhing in agitation as he tried to think on how to fix this.

“You can’t hide from me forever, you’re just confused right now. I will get you back.”

He spoke finally, before the bathroom door burst open, and his presence was completely gone. You released a shaky breath, not daring to move still, even as the worker cursed and began turning all the sinks off.

“Haven’t seen it that jammed in a long time,”

She muttered, walking out eventually, you unlocked the stall door when you felt alone, only to swing it open and Nesta to pop into your vision. You almost screamed, jolting backward and slamming your head into a wall. She raised her hands in mock innocence.

“Easy, it’s just me. I figured you might be in here when I couldn’t find you, and…..”

She looked you up and down, noticing how shaken and pale you seemed, and frowned. Tilting her head sideways, she asked the obvious.

“What’s wrong with you?”

You looked all around the bathroom, finding no sign of him anywhere, no moving shadows or dark presences.

“He was here, Nesta. He kept begging me to come out and—I don’t know what he would’ve done if you hadn’t shown up.”

You said, tears welling up before falling as you began sobbing. She frowned deeper, now scowling as she pulled you against her chest, worry filling her expression.

“It’s alright, I’ll take you home.”

She said, helping walk you out of the bathroom, and as she passed by Cassian she grabbed the big Illyrian by the ear and dragged him out of the bar, outside with fresh air. Cassian immediately looked concerned, brows furrowed, but one look from Nesta was enough for him to nod grimly as his expression darkened, the two of them no doubt communicating mentally as most mates did.

He scooped the both of you up, and despite the alcohol in his system, managed a decent flight to your house. He gave you a pat on the head before Nesta walked you inside, and as soon as the two of you were in the privacy of your room, she spoke.

“Look, I’ll tell Rhys to keep an eye on him, but it’s not like Azriel will listen to anything Rhys orders him to do regarding…this. Just…be careful.”

She said in a hushed tone, and you nodded weakly.

“I can’t stay here. Not when he’s..watching and following me.”

Nesta gave a little nod, as she understood, but she still looked concerned. She was friends with Azriel, you knew as much, but even this was pushing it.

“I have family in Autumn, I could go find them.”

You suggested, and she sighed.

“You do realize he could just have one of his shadows follow you? Unless you left without telling anyone, then…”

The both of you shared a glance, and in a moment, understood what you needed to do to get away. A stalker problem wasn’t one that you thought you would have, but Azriel was obsessive and possessive, even after you’d thrown out all the flowers he’d left, and burnt all the letters you’d given him. He wouldn’t stop at anything, no matter what boundaries you tried to set.

You dragged the duffel bag out from under your bed, the same one you had used to pack your things the day you’d left and began shoving clothes into it, clothes that would suit a few days of travel in the wilderness. You nearly tore your dress off, shoving dark clothing that covered almost every bit of your skin.

If you headed through the main routes of the Court traveling system, Azriel could easily find you. The mating bond would only make it easier from there.

Nesta began helping, choosing clothes from your closet that she deemed acceptable and neatly arranging everything in the duffel bag.

“Are you going to tell your family?”

She asked quietly, and you sighed.

“My grandmother, she’d understand. She fled Autumn when she was younger, some long story about escaping a lover from the royal family.”

You said as you continued packing, and hurried down the stairs. Everyone was asleep this late, except for your grandmother for her nightly tea session. She was sitting in the living room, sipping away, and her eyes shifted to you. Despite her young form, her eyes were old and carried a wisdom you couldn’t explain.

“Grandma, I can’t explain, but-“

“You need to leave, I understand. Under the stairs, there is food. I expected this. Find your great aunt in Autumn.”

That made you pause for a moment, eyes widening, a little twinkle in her eye, and a small mischievous smirk made its way onto her face as she saw your confusion.

“I am not nearly as oblivious as you think I am, now go. Time is of the essence.”

She said, making a little waving motion, and you hurried off to find the little place under the stairs, opening the tiny area beneath it through the small cabinet door, rations were stashed there just like she’d said. You grabbed them, and hurried back up the stairs, and walking into your room you shoved it into the now-full duffle bag and zipped it up. Nesta gave you a confused look when she saw all the pre-prepared food you somehow had, but you only shrugged and she moved on.

“You’re going to need a way to travel, it’ll be thousands of miles to Autumn.”

She said, and you sighed, looping your arm through the handles of the duffle bag and throwing it over your shoulder as you hurried down the steps again, trying to be quiet for the sake of your sleeping family.

Nesta followed you out of the front door as you shut it, Cassian still standing outside, quietly watching with that same grim look on his face as you hopped your neighbor's fence, running across the mass of property they had in the backyard, straight to the small horse stables they had. You went in and opened the first one you could find, a dark-colored mare with a splotchy white stripe down her face, and some white near her hooves.

Pulling the winter coat off of her the gentlest you could, you scrambled to find a bridle that fit the mare as she stomped nervously, and you eventually found one and slipped it on, the horse not seeming eager to get the bit in its mouth, even though you managed to get it in.

Nesta caught up with you and glanced from you to the horse.

“You are crazy.”

She said though she had a slight smirk as she said it. You sighed, grabbing the reins and leading the mare outside of its stall, and you glanced over to Nesta.

“Give me a leg up?”

You asked with a small attempt at a grin, and she sighed, shaking her head in fond exasperation as she held her hands out for you to put your foot in, and you did, and she counted down from three before hoisting you up over the horse.

The large animal did not seem happy about that, either. But despite its protests, and the fact that you were riding it bareback because taking care of a bridle, saddle, stirrups and more was probably more than you could handle, you managed.

“Tell Rhys to ignore anyone complaining of a missing horse for me, will you?”

You said with that weak little half-grin, and she returned it.

“Sure, I can manage that.”

She said in an amused tone.

A moment of silence passed, before she swallowed, and spoke.

“Be careful. Don’t get yourself killed.”

She said, and you nodded, laughing softly.

“I won’t. Once I’m..safe, I’ll figure out a way to let you know. I promise.”

The inky mark of your oath spread around both of your wrists, reminding you of the promise. You didn’t know how you’d tell her without anyone else, or a specific shadowsinger catching wind of where you were, but you would figure it out.

The wind blew by, and you swallowed again.

“Well…I guess this is goodbye.”

“For now.”

She replied, and you nodded.

“For now.”

And with that, she gave a single nod and began walking back over to Cassian, who offered a dip of his head in goodbye. You gently nudged the horse with your foot, gathering up the reigns, and it jolted forward, taking any excuse to run wild after being cooped up in a stall for so long.

It hopped the fence easily, despite how you almost fell off and began bounding off before you adjusted it Southeast, where you would skirt the boundaries of Night Court, and then head to Autumn.

Into Autumn, where freedom loomed, and into Autumn, where the threat of more than just your self-discovery loomed as well.

Tags:

@tele86

@cleverzonkwombatsludge

@starofanotherworld

@araneea92

@cherryinsalemverse

@sunfoxmartell-blog

@problemfinder

@emptyporsche

@mulansaucey

@meshellexplosionmurder

@rcarbo1

@dannydeivto

@helloevilmuffins

@bagelsharry

@fairydustblossom

@swiftie-4-lifes-stuff

@melmo567

@myromanempiree

@cynthiesjmxazrielslover

@fxckmiup

#acotar fanfiction #writers on tumblr #acotar fandom #acotar x reader #azriel #azriel acotar #azriel x reader #nesta supremacy #nesta archeron #nesta x cassian #nesta acotar #nessian #acotar #fanfic writing #writers #writers block #writer #female writers #cassian acotar

530 notes · View notes

pellucid-constellations · 3 months

Note

hi! If you’re still taking requests I would looooove some Az comforting the reader, maybe she’s having a bad day and is trying to play it off and tell everyone she’s ok but Az sees right through her and she ends up crying and he comforts her or something if you’re up for it. I love love love your writing by the way <3

Pairing: Azriel x Reader

Word count: ~1.3k

Warnings: A tiny bit of angsty thoughts

a/n: I loveeee hurt/comfort and this kind of took on a life of its own. Enjoy!!! Thanks for the request ❤️

____________________________________________

You could feel his eyes on you from across the room—calculating, contemplative, planning. You had been doing your best to ignore him for the better part of the evening, but his presence was hardly discrete as he stood strong and stiff in the corner.

This day had been atrocious.

You had woken up before dawn to begin preparations for the gala currently taking place, been screamed at by multiple vendors unhappy about their placements, got caught in the rain on your way around town, and barely had time to sit down before you were thrust into a chair and made to get ready for the night.

And that was just today.

There had been pressure from all sides to find comradery between the courts after the war, and as an emissary to the night court and the one most familiar with each High Lord, you had been elected to carry out that task. A task that had taken weeks of bad days to come to fruition.

To put it lightly, you were beaten down.

“Perhaps you can speak to the High Lord about that, yes?” the Spring Court emissary drawled, an ending to the 20-minute speech you had hardly been listening to.

You smiled anyway. “Oh yes, of course. Perhaps you could send me a follow-up correspondence in a few weeks to ensure I get your reply readily?”

The emissary scoffed, looking you up and down with a cloistered sneer. “Can’t even keep track of little conversation? Typical. I guess I can send you a reminder, though…”

The vicious man’s words began to bubble out of your mind, a low buzzing replacing the demeaning tone. You jutted your jaw to the side and pursed your lips in an attempt to hold back the burning in your waterline.

This was exhausting and too much and was quickly becoming a thankless job. You had told Rhysand you were up to the feat, but you had not accounted for all of the screaming and complaining and belittling some of the courts seemed to favor.

From the corner of your eye, you saw Azriel kick up from the wall. You threw him a watery, chastising look—knowing by the gleam in his eye that he was set to cause trouble with the man before you—but the Shadowsinger only raised a brow and tugged on the bond deep in your chest.

Azriel had grown weary of your tired excuses and your half-hearted assurances that you were doing okay. It was obvious that every time you lied, he grew more impatient, more concerned.

But you had to do this—for Rhysand, for Feyre, for the court.

You hadn’t been able to fight in the war, so you could throw a simple gala and suck it up.

Your mate stopped his approach, but you saw his jaw clench and his fingers roll up into his palm as the man only continued to drone on.

“Do you think you could do that, then?”

Shit. You had not been listening to a word he said, too concerned with Azriel’s thwarted approach.

“I apologize,” you shook your head with a sheepish smile. “Could do what? It’s just so loud in here.”

“Is this truly the best the night court has to offer?”

That made the battle with your tears even more difficult. You swallowed the lump growing in your throat and tried to pretend you weren’t staving off a massive headache alone with it.

“I know, I’m sorry. There is just much I have to do for the night and my mind is elsewhere—”

“Thank you, Fike. You can send a letter addressed to the night court emissary when the night concludes,” Azriel cut in, interrupting the rough scratch of your voice. “It’s uncouth to speak so much of business at a party. And you are always so boring.”

You heard the remnants of another scoff leave the Spring Court emissary's mouth, but Azriel was already guiding you out of the ballroom and into the hallway with a steady hand on your back. You took deep breaths as you went, your nose burning with the action.

Get yourself together. You’re fine. A small issue in an otherwise—

Azriel hummed and pressed you against the wall of the hallway, quelling your rampant thoughts with the hand on your stomach. His other was pressed above your head, trapping you in an embrace, keeping only him in your eyeline.

“You’re okay,” he comforted, taking exaggerated, deep breaths. “Just us here.”

You blinked and shook your head in quick succession. “No, I know, Az. I’m completely fine. I just needed to get away from Fike. I have to go back in.”

“You are crying, my love.” Azriel brought his hand up from your stomach and brushed away tears you hadn’t felt fall. “You’re overwhelmed. I don’t know why you’ve put yourself under this much stress, but you need to stop for a moment.”

“No. No, I'm okay. I’m not stressed. I don’t know what’s happening to me—why I’m crying. I feel fine.”

Azriel’s expression pinched, grimacing as he watched your chest rise and fall unsteadily. “Y/n—”

“It’s just a gala,” you affirmed, more tears falling with the quick flurry of your words. “Just a gala. I can do this one thing. You all fought in a war and you made me stay home. You could have died. I can host a stupid gala.”

You furiously wiped at the wet tracks on your cheeks, brushing Azriel’s soft touch aside. But he only halted your movements, his fingers wrapping around your wrist.

“Hey—hey. Don’t be so rough. Y/n, this is not a stupid gala. Look at me.” When you refused, Azriel released your wrist and tipped your chin up until you met his eye. He smiled despite the pain in your eyes. “There’s my girl.”

And despite the pain, you huffed out a small laugh.

Azriel would take it. He readied the spiel he’d been prepping since you began this venture. “This is not just a stupid gala and you didn't just stay home during the war.” Azriel pressed a kiss to your forehead, a pause he couldn’t help but take. “You protected everyone in the allied courts. You were our informant. You were winnowing so often you passed out, need I remind you.”

“But I wasn’t—”

“I don’t care if you weren’t fighting. What you did was just as valuable and you know that. Just as this gala is valuable to our peace. You are valuable.”

Your face heated beneath his words, his body pressed to yours in the hallway as the gala continued on.

“I need to be useful,” you admitted, after a pause. “This needed to be perfect.”

“It is perfect, my love. My sweet mate. You need to take a rest. You’re breaking apart and I can’t stand to see you like this. Come here.” Azriel slotted your head in the bend between his shoulder and his neck, sliding his hands down your back until his wings came around as well. “Can I force you into bed? Just for an hour at most. I swear I’ll wake you up and we will come back down.”

You made to move away from him in disbelief, still panicked at the idea of abandoning your work, but Azriel only held you tighter.

“That wasn’t really a question.”

And so Azriel took you to bed.

#azriel x reader #azriel x you #azriel x y/n #azriel fanfic #azriel shadowsinger #azriel acotar #acotar fanfiction #azriel spymaster

501 notes · View notes

sergeantbarnessdoll · 2 months

Note

🤍

sooo here is my request! thank you!

Reader is bucky's ex fiancé (40's) and she is like a supersoldier too (she froze with steve and now she is an avenger)

but bucky does not remember her, so she has to deal with watching him dating some agents while she tries to make him remember that part of their life together (maybe with some letters and pics of them)

some angst - hurt / comfort with happy ending! 😭🤍

just bc i love this blog i would like to be "🕷️ anon" 😂

Remember Me » Bucky Barnes/Winter Soldier

Pairings: Ex Fiancée/Avenger!Bucky Barnes x Ex Fiancée/Avenger!Female Reader

Summary: You and Bucky used to be engaged in the 1940s, but he doesn’t remember you and you have to deal with him going on dates with other agents so you do everything you can to get him to remember you.

Warnings: mix of Angst and Fluff, language, crying, flashbacks, kissing, pet names

A/N: Thank you to the lovely anonymous person who requested this🩵 also you can be my 🕷️ anon🥰

A/N #2: Italic text is flashbacks. I imagined this as Bucky’s post Winter Soldier phase and the reader is a Super Soldier in this.

Written on my phone. My apologies for any mistakes.

Header made by @buckys-wintersoldier

GIF IS NOT MINE! Credit goes to the creators. I found it on Pinterest.

You stood in the doorway of the conference room, patiently waiting for Bucky to stop flirting with an agent so you can get him to sign paperwork from a previous mission. You couldn’t help but feel jealous. You and Bucky were engaged in the 1940s, but it didn’t last long. After a few minutes, Bucky finally noticed you standing in the doorway.

“I’ll see you tonight, doll.” Bucky says to the agent and kissed her cheek.

Hearing Bucky call her doll felt like someone ripped your heart out of chest and crushed it in their bare hands. That’s what he used to call you.

“Can I help you, Agent?” He asks you.

“I need you to sign these papers from your mission last week.” You tell him, handing him the file.

“I’ll get these to you later.” He says.

You nodded and walked out of the conference room. You were about halfway down the hall when you had to lean against the wall and take a moment to yourself. Your back slid down the wall and you sat down on the floor. Your mind began to wander.

“You know I love you, right, doll?” Bucky asks.

“Of course I know that, Bucky.” You say with a smile.

Bucky intertwined his fingers with yours and kissed your lips sweetly.

“Are you ok?” Steve asks, snapping you out of your thoughts.

“Yes.” You lied.

You stood up from the floor and walked past Steve. Your walk was cut short when Steve gently grabbed your arm.

“Tell me what’s wrong.” He pleads softly.

“You already know what’s wrong.” You said. “I have to live with the fact that my ex fiancée doesn’t remember me at all and I have to deal with him dating other agents.” You say.

“Give him time, Y/N. He’ll remember you.” He says softly.

You gave him a soft smile before walking away.

Later that same day, you were in the gym, punching the punching bag as hard as you could. You were trying to get the thought of Bucky out on a date with that agent. You punched the punching bag one last time before leaving the gym.

You got on the elevator to go to your bedroom. As soon as you got off of the elevator, you seen Bucky kissing that agent. You stood there with a shattered heart. You quickly went to your room before he seen you.

You immediately caught a glimpse of the picture of you and Bucky from the day he proposed to you. You picked up the picture from your nightstand and looked at it, reminiscing that day.

“Where are you taking me, Bucky?” You asked, followed by a giggle.

“You’ll find out in a minute, doll.” Bucky says.

Bucky told you he had a surprise for you and blindfolded you for it. Your walking came to a stop and Bucky let go of you.

“Take the blindfold off.” He says.

You took the blindfold off and gasped. Bucky took you to yours and his favorite tree. Your favorite flowers were surrounding the bottom of it and he carved “Will you marry me?” on the tree with a pocket knife.

“Bucky-” You turned around and gasped.

“What do you say doll?” Bucky was down on one knee with a small velvet box with a beautiful diamond ring in it. “Will you marry me?” He asks.

“Yes! Of course I’ll marry you!” You answered with happy tears streaming down your cheeks.

Bucky smiles widely and stood up. He slid the ring on your ring finger and kissed you passionately.

That memory slowly faded away. You let out a shaky breath and your eyes began to water. You took a deep breath before taking a shower and went to bed.

The next morning, as you were getting dressed you seen something shining on your dresser from the corner of your eye. It was Bucky’s Army dog tags. You picked them up and looked at them. A smile grew on your face when an idea popped into your head. You immediately went to the kitchen, already knowing Bucky was in there.

“Morning, Bucky!” You chirped.

“It’s Sergeant Barnes.” Bucky corrects you.

“What?” You asked, blinking a couple times.

“You called me Bucky. Only friends call me that. Agents call me Sergeant Barnes.” He says.

“Oh…” Your voice sounding sad. “I umm…” You found what you were trying to say. “I just wanted to show you something.” You finally say.

“What is it?” He asks.

You held out your hand, showing him his Army dog tags. Bucky snatched them from your hand, making you flinch a little.

“Why the hell do you have these?” He asks harshly.

“I uhh… Steve gave them to me in 1945 when you di- fell off the train.” You tell him. “He thought that I might want them cause you’re my ex fiancée.” You explained.

“I’m not your ex fiancée.” Bucky’s words cut you deep like a knife. “I don’t know who you think I am, but I sure as hell know that I’m not your ex fiancée.” He says before walking away.

You stood in the middle of kitchen with tears streaming down your face. You hoped that showing Bucky his Army dog tags would spark something in his memory of you, but you guessed wrong.

“Why would you give these to Agent Y/L/N after I fell off the train in 1945?” Bucky asks Steve when he walked in the conference room.

“She’s your ex fiancée. I assumed that’s what you wanted. I was just honoring your wishes.” Steve answered.

“She’s not my ex fiancée! I’ve never been engaged in my life!” Bucky raised his voice. “You’re the second person to say that to me today!” He says.

Bucky walked out of the conference room before Steve could say anything else. He stood up from his seat and went to find you. He found you crying at the kitchen table. He sat down next to you and immediately started comforting you.

“I’m fine, Steve.” You lied, your voice cracking.

“No you’re not.” Steve said. “You have every right to be upset.” He says softly.

You turned towards Steve and laid your head on his shoulder, letting your tears free fall. Steve being the good friend he is, comforted you in the only way he knows.

“He basically said that I’m not his friend and I can’t call him Bucky.” You cried against his shoulder. “It’s like I never existed to him.” You say.

“You’re more than his friend.” He says softly.

“I know that, but he doesn’t.” You say, followed by a sniffle.

Later that day, you kept trying to come with ways to get Bucky to remember you. So far you couldn’t come up with anything. You were sitting in the conference room, filling out paperwork when you got lost in your memories of you and Bucky.

“Bucky!” You squealed as Bucky picked you up from behind and spun you around, making burst into a fit of giggles.

Bucky finally put you down on your feet and turned you around so you were facing him. He cupped your cheeks and kissed you passionately.

The memory was interrupted when Bucky dropped a file on the table in front of you. You looked at the file and then looked at Bucky.

“Steve said to sign these and to get them to him by the end of the day.” Bucky says blandly.

“Will do, Sergeant.” You say.

You watched Bucky walk out of the conference room. You stared at the unopened file for a moment before leaving the room without finishing your paperwork. You went straight to your bedroom to get something. You wanted to try to get Bucky to remember you again.

You went in your closet, going to the back of it. You opened a plastic storage container where you kept all of the letters Bucky wrote you while he was in the Army. You picked them up and immediately went to find Bucky. You found him in the lounge room kissing another agent.

“Sergeant?” Bucky acted like he didn’t hear you. “Sergeant Barnes?” You say louder.

Bucky sighed and rolled his eyes before looking at you. The agent he was kissing walked past you, giving you a small smile.

“Is there something I can do for you, Agent?” Bucky asks.

“I wanted to read these papers.” You say.

You hand him the old letters. Bucky took the letters from your hands and read them, furrowing his eyebrows in confusion when he seen his name signed at the bottom of each letter.

“What are these and why is my name on all of these?” He asks.

“Those are the letters you sent me in the 1940s when you were in the Army.” You tell him.

Bucky continued to read the letters. A hopeful smile grew on your face, but didn’t last long. He stood up and shoved the letters in your hands.

“That’s not me.” He says.

“But-” You got interrupted.

“But nothing. We were never engaged. Stop trying to get me to remember things that never happened.” He says.

You nodded as your eyes began to water. You went back to your room and put the letters back. You were about to close the container when you saw a stuffed puppy Bucky won you at Coney Island on yours and his first date. You took it out of the container and sat on your bed, holding it close to you as the memory of that day appeared in your mind.

You stood next to Bucky and watched him knock down all the bottles with a small ball. You smiled and cheered him on.

“What prize would you like, doll?” Bucky asks you.

You looked at the variety of stuffed animals displayed in front of you. You smiled when you seen a stuffed puppy with a red bow on it.

“That one.” You say, pointing at it.

The worker handed it to you. You took it from him and held it close to you.

“Thank you, Bucky.” You say, smiling up at him.

“Anything for my best girl.” He says, kissing you sweetly.

You sadly sighed and laid down with the stuffed puppy in your arms. You didn’t even know you fell asleep, because you woke up to the sound of someone knocking on your bedroom door. You got out of bed and opened the door to see Bucky.

“Can I help you, Sergeant Barnes?” You asked.

“Can I come in?” Bucky asks.

You nodded and stepped aside, allowing him to come in your room. You closed the door behind you and waited for him to say something.

“I just wanted to apologize for the way I’ve been talking to you the past couple days.” He apologizes. “I just don’t understand why you keep saying we were engaged years ago when-” That’s when Bucky seen the picture of you and him on your nightstand. “This is me.” He says, picking up the picture to look at it.

“It’s me and you in 1941.” You tell him. “I have more pictures if you want to see them.” You say.

Bucky nodded. You went in the closet to get the pictures. You opened a photo album, showing him a bunch of pictures of the two of you when you guys were together. He took the photo album from you to get a closer look at them. He looked through the pictures without saying a word. Another hopeful smile grew on your face, hoping that Bucky will remember who you are this time. The smile was short lived when Bucky shoved the photo album in your hands and left your bedroom without saying a word. A sad sigh left your lips and you put away the pictures. You were beginning to think that Bucky was never going to remember you, but you weren’t going to give up that hope.

Bucky was supposed to be getting ready for a date with another agent, but those pictures of you and him together were the only thing on his mind. He sat in the lounge room, trying his best to remember who you are, but nothing rang a bell. His thoughts were interrupted when the agent he’s supposed to go on a date with walked in the room.

“Hi!” The agent chirps. “Are you ready?” She asks.

“Yea, I just-” That’s when his memories of you flowed back in his mind like a broken dam. “Actually no. I can’t do this anymore. I’m sorry.” He says, leaving the room and leaving the agent confused.

Bucky searched around the whole compound for you, but couldn’t find you. He accidentally bumped into Steve without realizing it. Steve walked after him and grabbed his arm, stopping him in his tracks.

“Buck, calm down. What’s wrong?” Steve asks.

“Y/N. Where’s Y/N?” Bucky asks.

“She’s outside.” He tells him. “Why?” He asks.

Bucky didn’t answer Steve’s question. He just ran outside, looking for you. He didn’t have to go far. You were sitting on the bench trying to figure out another way to get Bucky to remember you. He walked over to you and grabbed your arm, pulling you up from the bench and kissed you passionately. You were caught by surprise, but kissed him back. He pulled away from your lips, leaving the two of you breathless.

“I remember.” Bucky tells you. “I remember you.” He says.

“You remember me?” You asked, making sure you heard him right.

“Yes.” He confirms. “Seeing those letters and pictures made me remember everything.” He smiles. “I’m sorry for the way things ended between us. I was just pissed. Please forgive me and give me another chance, doll.” He says apologetically.

Your eyes began to water with happy tears, a couple tears rolled down your cheeks. Hearing Bucky call you doll for the first time in years made you happy.

“Don’t cry, doll.” He wipes your tears away. “I’m sorry.” He apologizes again.

“I can’t help it.” You sniffled. “I just missed you.” You say.

You wrapped your arms around him, hugging him tightly, not wanting to let go. Bucky wrapped his arms around you, holding you close to him.

“How about we picked up where we left off.” Bucky suggests.

“You still want to marry me?” You asked, looking up at him.

“Of course I do.” He smiles widely. “You’re my best girl.” He says.

“I don’t have the engagement ring you gave me anymore. I accidentally lost it.” You say, feeling ashamed.

“It’s ok. I’ll buy you another one. In the meantime…” Bucky took his dog tags off and put them around your neck. “You can wear these as an engagement ring.” He says.

You looked down at his dog tags, smiling widely. You looked up at him and cupped his stubbly cheeks. You stood on your tippy toes and kissed him passionately. Bucky’s hands found their way to your waist and pulled you against his body.

“I love you so much, Bucky.” You say against his lips.

“I love you more, doll.” Bucky says softly.

🩵🩵🩵🩵🩵🩵🩵🩵🩵🩵🩵🩵🩵🩵🩵🩵🩵

-Bucky’s Doll

408 notes · View notes

estrellami-1 · 3 months

Text

Steddie Week 2024

July 5th Prompt: Reunion

Day 1 | Day 2 | Day 3 | Day 4 | Day 6 | Day 7

@steddie-week

“Babe,” Eddie calls from the kitchen. Steve’s in the bathroom, brushing his teeth, so he garbles out an unintelligible one minute! before quickly finishing.

He walks into the kitchen, tugging at the collar of his shirt. “What’s up?”

Eddie’s eyes are dancing with mirth as he helps Steve fix his collar. “You’ll never guess what just came in the mail.”

Steve raises a brow. “You’re acting like my parents are groveling at the door right now.”

Eddie barks out a laugh. “Oh, sweetheart, no. I’d very much be laughing in their faces if that’s what was happening.” He grabs Steve’s glasses from the counter he’d forgotten them on last night, unfolds them, and carefully slides them on Steve’s face. “No migraines,” he murmurs, and Steve’s hit with a rush of love so big he just has to tell Eddie.

“I love you.”

Eddie smiles softly; a small, disbelieving, hopeful thing that’s never changed from the first time Steve said it. “And I, my love,” he murmurs back. “But no, it’s not your parents.” His grin grows into a giggle. “It’s fuckin’ Hawkins High.”

Steve makes a face. “It’s still standing?”

Eddie snorts. “Apparently-fucking-ly.” He grabs two letters; one with Steve’s name, one with Eddie’s. “One letter for each of us. I already opened mine. It’s a reunion.”

Steve furrows his brows, rips into the envelope, pulls the paper out. “Hawkins High School… forty-year reunion… de-” he frowns up at Eddie. “Decennial?”

Eddie hums, nods. “Every ten years. God knows where our other ones went.”

Steve hums. “Guess we can throw these in the trash, huh?”

Eddie shifts. “You don’t want to go?”

Steve stares at him incredulously. “You do? You, Eddie Munson, want to go back to the place where—and these are your words, here—apart from our group of friends, only the- the backwoods of inbreeding resides?”

Eddie cackles. “Oh yeah, I did say that, didn’t I?” He’s delighted. Steve’s finding it hard not to smile in the face of that joy.

“So you want to go back?”

Eddie shrugs. “Think about it,” he requests. “I don’t want to go to see how anyone else is doing. Frankly, I don’t have the time to give two shits about them. But you know I’ll always jump at the chance to show you off.”

Steve raises both eyebrows this time. “You want to show me off? In fucking Hawkins?”

Eddie deflates. “You don’t want to go.”

Steve shakes his head. “No, babe, that’s not what I’m saying. I’m saying that even though it’s legal, even though we’re officially married now, if there’s one place that isn’t gonna be accepting…” he trails off, lets Eddie finish the thought for himself.

“What if I convince Nancy to come?”

“Well, she’ll have to come if we go, won’t she? Cause you know she’ll go anywhere Robin does, and Robin’s gonna follow me, so…”

Eddie snickers. “Okay, yeah, fair enough. But babe, we’ll have Nancy and Robin on our side. The three of you took on Vecna, I think you can take on some overweight, washed-up, balding fifty-something-year-old.” He squeezes at Steve’s biceps, and Steve tries not to preen.

He’s proud of the care he’s shown his body, he’s proud of the way he looks, he’s proud that Eddie likes the way he looks. He can feel his resolve waning, is about to tell Eddie fuck it, let’s go, when his phone rings.

He pats his pockets, looks around for it. “Room,” Eddie supplies, and Steve gratefully peck his cheek before jogging to their room, where it’s laying on his nightstand. Eddie walks in as he answers it, having followed at a more sedate pace. “Hello?”

“Are you going to the reunion?”

“Hey, Robbie,” Steve chuckles, meets Eddie’s eyes. “Yeah, we are.”

“Yes!” She cheers. “You’re the best, we’re getting joint hotel rooms, right?”

He laughs and sits on the edge of the bed. “It’s Hawkins, Robs, I don’t think it has anything quite that fancy.”

Robin groans, loud and long enough that both Steve and Eddie have to stifle their giggles. “But I haven’t seen you in forever!”

“It’s been barely a week, Robbie.”

“That’s what I said!”

He relents. “I know. I miss you too. We’ll see you there?”

“Yeah,” she agrees, and hangs up.

Steve looks at Eddie, amused. “I guess we’d better pack. And you should tell the guys, don’t you have something going on that day?”

“Oh, shit,” Eddie says, and runs to the living room for his phone.

Steve surveys their room and sighs. He calls out to Eddie, “bring me a notepad on your way back, please!”

Eddie does, so he sets to work making a list for everything they need to pack while Eddie types away, postponing his plans.

While they might not get joint hotel rooms, Steve, Eddie, Robin, and Nancy are carpooling back to Hawkins in Robin’s van. She’s driving, Nancy’s in the passenger seat, Steve’s right behind Robin and Eddie’s right behind Nancy. Their luggage is piled precariously in the back, meaning every time Robin turns, the luggage slides from one side of the van to the other. Steve, with his mostly-undiagnosed OCD, flinches every time. And every time, Eddie pats his hand.

Besides the shifting suitcases, it’s a nice ride, even if Steve does grab Eddie’s hand and squeeze, just a hair tightly, whenever they pass the Welcome to Hawkins! sign.

Everyone gets a little quiet, after that. Robin fumbles with the radio, and Eddie perks up. “This song,” he says, practically bouncing in his seat.

Steve snorts. “Iron Maiden,” he tells her.

“The fact that you know that-”

“It gets worse,” he tells her, grinning. “The song is called Wasted Years. I know all the words.”

Robin grins, turns the volume up.

The joke’s really on her, though, because she’s always been good at music, patterns, and she’s singing the chorus with him and Eddie by the time they get to the end of the song, Nancy laughing at them. “So understand,” they sing, Robin glancing in the rearview mirror, Steve looking from her to Eddie and back again. “Don’t waste your time always searching for those wasted years. Face up, make this stand. And realize you’re living in the golden years!”

Steve and Eddie are practically screaming it at each other by the last line. Robin’s given up to join Nancy in laughing at them. Steve joins in as Eddie plays air guitar to the end of the song, collapsing in a laugh when it’s finally over.

“Okay,” Eddie says, grinning. “I think I could take on anything now.”

“Yeah?” Nancy asks, pointing ahead. “You’re ready for the reunion?”

They’d decided, since the last time they took a proper road trip had been too many years ago, they could do it the same day as the reunion.

They’d forgotten how getting old, coupled with the problems every one of them still has from the Upside Down, means they’re all very much sore from sitting in a car for upwards of five hours.

The plan was drive the five-something hours, go to the reunion, crash in the hotel, and drive back home the next day.

Steve hates the plan now and wants to go to the hotel to rest like the old man he’s letting himself be.

However unfortunate it may be, the reunion is today, which means Steve gets to suck it up, say hi to people he probably doesn’t even remember anymore, and then leave.

He hops out of the car and stretches a little, laughing when Eddie attempts the same hop out of the car and almost eats asphalt. “Dumbass,” he mutters. Eddie shoots him a Cheshire grin.

Before long they’re ready to walk inside. Steve takes a breath as he passes through the doors. The hallways are the same, but the lockers are new. It still smells like teenagers and feet, he notices, wrinkling his nose. The things you’ll get nose-blind to, he supposes.

The letters they’d gotten said the reunion was to be held in the gym, so that’s where they head.

Steve didn’t know what he expected, but it wasn’t a few snack tables along the edge of the room and a single Reunion of ‘85 banner. “Goddamn,” Eddie says from beside him, “depressing much?”

Steve snorts in agreement and walks over to the drink table. If he’s going to talk to people, he’s at least going to have questionable-looking punch while he does.

When he turns after getting punch, he nearly runs into someone. He quickly steps back. “Oh, sorry!” He looks up into the shocked face of Tommy Hagan. He blinks. “Tommy?”

“Steve.”

Steve smiles. “How’ve you been?”

Tommy blinks, like he can’t believe Steve’s being nice to him right now, and that’s when Steve remembers they’d parted on not-so-nice terms. Oh well, he would’ve feigned politeness even if he’d remembered. “I’m good, yeah, uh, how- how’re you?”

“I’m good,” Steve agrees. “Really good. Last I remember you and Carol were dancing around each other, yeah? What happened there?”

“We got married,” Tommy nods.

“Congratulations!”

“And then divorced two years later,” Tommy adds, smirking. Steve winces. “How about you? Last I knew, it was you and Wheeler, ‘cept she cheated on you with Byers, yeah?”

“God,” Steve laughs, “that was so long ago. Yeah, that happened. We talked it through and Nance and I are really good friends now. She’s married to someone else, as am I, but we both keep in touch with Jon, thought he’s out in California now.”

Tommy’s brow raises. “Married? Who’s the lucky girl?”

A presence beside him makes Steve turn to see Eddie grinning at him. “My ears are burning.”

“They should be,” he laughs. “Tommy, you remember Eddie?”

“Munson,” Tommy nods, then does a double take. “Wait, you’re married?”

“As of three years ago now,” Eddie says proudly. “But together for…”

“Thirty-seven years,” Steve provides, smiling at his husband before turning back to Tommy. “Did you ever get remarried after Carol?” Tommy shakes his head.

Eddie whispers in Steve’s ear, “You know he totally had the hots for you, right?”

Steve winces at the blast of static from his hearing aid and quickly shuts it off. “Ow,” he mutters, grinning crookedly at Eddie, who looks apologetic. He quickly signs what he’d whispered, and Steve laughs. “Don’t you remember my initial panic?”

Eddie thinks, back to when Steve had asked him what’s gay versus friendly, becoming increasingly confused when most of the things Eddie ticked off in the gay category were things Steve and Tommy had done that Steve had thought firmly resided in the friendly category. “Oh, yeah.”

Steve snorts, shakes his head, pushes him away. “Go talk to someone else. Rescue Robin, she looks like she needs it.”

“Nah,” Eddie says, “she can hold her own,” but goes anyways after a quick peck to Steve’s cheek. Steve turns the hearing aid back on.

“Man,” Tommy says wonderingly, “what happened to you?”

“Concussions,” Steve answers flatly. “Three of ‘em. Then I grew up.” He sighs, looks down at his cup, then up at Tommy. “Listen, man, about what we used to do-”

Tommy winces. “I know. I had that revelation a while ago, actually, but it was definitely shitty of me.”

Steve smiles, shrugs. “You had a crush on me. It’s not an excuse, but it does make a certain kind of sense you’d react that way, especially considering the kind of home life you had.” He smiles self-deprecatingly. “Feel free to stop listening if the therapist side of me comes out. I swear I’m not trying to, like, diagnose you with anything.”

Tommy’s brows raise. “You’re a therapist?”

Steve hums affirmatively. “Started as a school counselor, if you can believe that.”

Tommy fixes him with a wondering grin. “Y’know? I think I can see it.”

“Do my eyes deceive me,” someone says from their side, draping their arms across Steve and Tommy’s shoulders, pulling them into a hug.

Steve comes face-to-face with Carol. He grins. “Hey, Carol.”

“Hey, you,” she says, raking her eyes over him. “Time’s been good to you.”

“You’re one to talk,” Steve says happily, but its true; she doesn’t look a day over forty, instead of the fifty-odd she is now. “How are you?”

“Can’t complain,” she agrees.

They go through the same song-and-dance, but this time when she asks who he’s married to, he sees Eddie juggling water bottles, talking to a couple of people. “Oh, for-” he mutters, then louder, “Eddie, what in the everloving fuck are you doing?”

Eddie drops a bottle, puts the other two on the table behind him, and jogs over to throw his weight onto Steve. “Making friends.”

Steve snorts, elbows him off. “Say hi to Carol, babe.”

Carol clocks it immediately, based on the twitch of her eyebrow, but only says, “I didn’t peg you two as a couple.”

“Well, yeah,” Eddie snorts, “it was Bumfuck, Indiana in the 80’s.”

Carol tilts her head in agreement, then turns to Tommy and says coolly, “Tommy.”

“Carol,” he replies, tips of his ears red.

Eddie looks between them, then turns a raised eyebrow on Steve, who quickly signs, “Married for two years a while ago. I don’t know any details.”

“He clearly is still into her.”

“I refuse to be a part of whatever you’re planning.”

Eddie pouts. “You’re no fun.”

Carol clears her throat. “Sign language?”

Steve snorts. “Turns out brains aren’t supposed to get banged around. You’ve got a real good chance of messing something up that way.”

Eddie pokes his cheek. “‘S not your fault.”

“Never said it was,” Steve placates.

Carol shakes her head. “How many concussions do you have?”

Steve hums. “Three? Four?”

“Three,” Eddie corrects. “Not that we need to get into it right now.” He gives Carol a tight smile, and Steve hip-checks him.

“Down, boy,” he murmurs with a smile. “I’m alright.” He turns to Carol with a wider smile. “Long story short, the concussions caused irreparable hearing loss. I’m almost completely deaf in my left ear, but I get by.”

“Damn,” Carol says lightly, “life, huh?”

Steve snorts. “You can say that again.” He tilts his head. “How are you?” He asks. “Really?”

She gives him a crooked smile. “Let’s walk and talk.” Steve offers her his arm, which she takes with a laugh.

“How am I,” she muses. “Well I thought I found love, but we imploded two years later. Thank god for prenups, I guess, but at the same time, that made it feel like we were doomed from the start.”

Steve hums. “Eddie and I have been legally married for three years,” he tells her. “Together for thirty-seven. We’ve got prenups. Not because we think we won’t work, but because we want the people we care about to not have to worry about any of that.” He’s silent for a few steps. “I used to think love is out of our control. That we don’t get to decide who we fall for. And maybe, to a certain extent, that’s true. But love is also a choice you make every day. Eddie and I are still in love because we choose to be.”

“You look at each other like you’re on your honeymoon.”

Steve giggles. “And to think we didn’t even have a honeymoon!”

Carol laughs, too, then sobers. “You always were more fortunate in love,” she says. “What do you think? Do we have a chance?”

Steve hums. “I think it’s obvious, just by looking at him, that he’s still into you.”

“No shit.”

“So what’s important is how you feel. Marriage is work, I’m not gonna lie and say it’s not. So are you ready, and I mean really ready, to work for it?”

She works her lower lip. “I think so,” she admits. “But I- I’m also not completely sure I’m straight.”

“Okay,” Steve shrugs. “Do you know what he and I used to get up to?” He shrugs at her look. “I’m just saying, neither is he.”

“I mean, I definitely still like guys.”

“Well duh, you’ve taken more dick than I have and I’m married to a man.”

She snorts. “But women…”

“I know,” Steve says sympathetically. “It’s hard, isn’t it.” He pats her hand. “If you’re ready to try, though, you need to talk to him.” He turns her around, gestures toward Tommy, who quickly looks away, cheeks burning. They both laugh softly.

Carol leans up to kiss his cheek. “Thank you, Steve. Let’s keep in touch.”

“Let’s actually keep in touch,” he agrees, handing her his phone. “Where do you live?”

“Columbus for now, but he’s in Dayton.”

Steve hums. “We’re in Detroit.”

“We’ll do phone calls,” Carol decides, laughing.

Steve chuckles, saves her number. “Plan to meet up-”

“Never actually do-”

“Oh, Carol, it’s been so long-”

They both break off into giggles. “You’re fun,” she decides. “I wish we’d kept in touch.”

“To be fair, we competed for title of bitchiest.”

“To be fair, I don’t think we ever grew out of that,” Carol retorted, and Steve snorts, gently shoving her.

“Alright, go get your man, and send mine over here.”

She gently steps on his shoe as she leaves, impish smile in place, and Steve turns only to run into Nancy and Robin. “Hey, guys,” he smiles.

Nancy gives him a look. “Making nice with Carol?”

Steve shrugs, grins at her. “Turns out we were just kids. Who knew, right?”

Just then, Eddie comes up behind him, wrapping his arms around Steve’s waist and resting his chin on Steve’s shoulder. “What’re we talking about?”

Nancy smiles at him, wraps an arm around Robin’s waist. “Being kids.”

“That so?” He presses a kiss to Steve’s cheek, pushes back to look at him. “You look lighter.”

Steve hums. “‘S cause I love you.”

“Charmer,” Eddie mutters, turning bright red. “C’mon, seriously.”

“Seriously,” Steve agrees. “I was talking with Carol about her and Tommy, and I told her that why we work is because we work at it.”

“Very true.”

From behind them, someone cautiously asks, “Eddie Munson?”

They both turn, and suddenly Eddie’s scooping her up in a hug. “Ronnie! What the hell are you doin’ here, huh?”

She laughs and hugs him back just as hard. “Did you ever know a Jackson Starnes?”

Eddie’s brow furrows for a second, then smooths out. “Oh, Jackie! Yeah, he was cool.”

“Mhm. He’s my husband.”

“No shit? I’m happy for you.”

“Thanks,” she laughs, then nods at everyone else. “Who’s the hunk you were hangin’ off of?”

Eddie chuckles. “Ronnie, meet my husband, Steve.”

She turns an eyebrow on him. “You got married?”

“He proposed,” Steve corrects her, grinning.

“To the preppiest of jocks,” Robin adds.

Eddie laughs. “What can I say? It’s love.” He swoons, placing a hand over his chest, almost pulling Ronnie over with the arm still over her shoulder.

She laughs and dumps him off of her. Steve swoops in before he can fall, hoisting him up with a quick kiss.

“I’m Nancy,” she says, extending her hand to Ronnie. “And this is my wife Robin.”

“Oh!” Eddie says, literally jumping back into the conversation. “Robin and Steve are like how we were.”

“Platonic soulmates,” Steve agrees.

“With a capital P,” Robin emphasizes.

“It’s nice to meet you all,” Ronnie says.

“How’s Wayne?” She asks Eddie.

“Dead.” He snickers at her face. “‘S alright, Ronnie. It’s been years.”

“Still. I can be sorry.”

“You can,” he agrees. “It won’t help anything, but you can.” He digs his phone out of his pockets, opens his contacts app. “Here, lemme get your number, yeah?”

“Fuck yeah,” Ronnie says, “let’s hang out, just lemme know when so I can get a sitter.”

Eddie chokes on nothing. “You have a kid?”

Ronnie grins, a shit-eating thing as she hands his phone back. “Three.”

“Goddamn,” he says, “you got pictures?”

Ronnie rolls her eyes, grabs her phone. “What kind of mom would I be if I didn’t? Here, this is Cassie, Alex, and… that’s Elijah.”

“Oh, man, Alex looks just like Jackie, doesn’t he?”

“I carry him for nine months,” Ronnie bitches good-naturedly. “‘Nough about me, though, how’re you? Corroded Coffin ever take off?”

Eddie snorts. “You hear about the psychopath in ‘86?”

“I remember something about it.”

“Yeah. I got caught in the crossfires, wrongfully blamed, and spent…” he looks at Steve. “A year?”

“Almost.”

He turns back to Ronnie. “Almost a year hiding out. Corroded Coffin was officially disbanded after I was allowed out of hiding.”

“Fuck,” Ronnie says, “there goes my entire foot in my mouth, I guess. What’re you doing now, then?”

He chuckles. “A little bit of everything, honestly. A little music, a little writing, a little D&D. Nothing that’s made me a household name, but enough that I’m kept busy and we’re comfortable.”

Ronnie nods. “And how about you?” She asks Steve.

“Oh, nothing as fun as that,” Steve chuckles. “I’m a therapist.”

Ronnie tilts her head. “Any specialties?”

“C-PTSD, mainly.”

“Damn, I know about eight people who could use someone like you.”

Steve snorts. “That’s usually the way it goes, yeah.”

“Well it was great seeing you, Eddie,” Ronnie says. “And meeting all the rest of you. But I’ve got to find my husband and get back home, so we’ll have to continue this later.”

“Of course,” Steve says. “See you later?”

“Absolutely,” Ronnie nods, then turns and walks off.

They decide to leave not too much later. They’re all tired, so the drive to the hotel is filled with only the sound of the radio, turned almost all the way down.

“Y’know,” Eddie murmurs, tracing the ring on Steve’s finger, “she was my first kiss.”

Steve snorts, an explosive thing that he definitely learned from Robin. “She what?”

“Yup,” Eddie nods. “I knew I liked girls, but she’s the only one I got close enough to to actually know. We got stupid one night and decided to kiss and it basically went how it would if you and Robin were to kiss.”

“Ew,” Steve says on reflex. Eddie snorts.

Robin slaps at him from her seat, then yells when he slaps back, “Don’t distract the driver!”

“Bitch,” he tells her, “you slapped first!”

“You said ew about kissing me!”

“Do you want to kiss me?”

“Hell no!”

“That’s why I said it!”

Eddie leans up to murmur to Nancy, “should we break it up?”

“Eh, give it a minute. Once they resort to cursing their lineages we can break it up.”

He chuckles. “Always the wise one, Wheeler.”

“You’d best believe it,” she nods smugly.

“Nancy!” Robin says. “Baby! Defend me!”

“About kissing Steve? Who I’ve kissed before?”

“Oh, no,” Robin says, horrified. “I’m stuck in the car with the two people who are experts on Steve kissing.”

“Why’d you make it sound like a bad thing?” Steve demands.

And… yeah. Eddie’s glad they got separate hotel rooms.

Based on the look Nancy throws his way when they part, she’s glad, too.

406 notes · View notes

behidethetrees · 11 months

Text

Mike schmidt as your boyfriend hcs ꩜

Pairing: mike schmidt x fem! Reader

Contents: slight angst if u squint, Fnaf mention, Reader and mike are sooo cute hehe

.❀。• *₊°。 ❀°。 .❀。• *₊°。 ❀°。

-You and Mike met in 1983 when you were 15. Mike was smart in the things you werent, So you two made a deal that you could copy off of him . One day when you were walking down the halls you saw the meanest boy in school Trying to bully mike and it pissed you off.

-You pulled the boy off of mike and punched him with no hesitation, Mike was so sure there were hearts in his vision. You were brave and fearless, But you were also gentle and caring when you offered help if he was hurt, He wasnt but He had never wished he was more than on that day.

-Thats when you two started becoming close. At first it was small talk or friendly banter but it slowly turned into never being seen anywhere without each other.

- One lucky day in december of senior year he decided to tell you how he felt in the garden you had showed him. Mike was never romantic, He didnt know what to do or say, So he did whatever guys did in the movies he’d seen. He handpicked you some beautiful pink flowers and wrote you a cute but short letter and handed it to you.

-You accepted his feelings and looked at those puppy dog eyes that crinkled as he smiled.

-Mike is very loyal. He has your initial around his neck and he talks about you almost all the time. (Abby tells you all about it) He has even gotten into a few fights for you, He always defends you even if you aren’t there.

-As mike got older, He starting learning the old way of love. He opens all doors for you, The occasional flowers and cute poems he writes for you, the sidewalk rule, He really knows how to treat his lady.

-Mikes Love Language is definitely quality time. Youre the love of his life and he wants to be with you always! There are alot of times where mike doesnt know what to say or show you how much he loves you. But you know he does by the way he follows and takes you everywhere. How he offers to spend time with you when he gets off of that strange nighshift where he works, Even if it means he gets no sleep.

-Mike is a family man. He loves his little sister and you love her too. You and Abby have a bond that was fun and ‘girly’, in mikes words. (Mike wears bracelets you and abby make for him) When Mike opened up to you about his brother and his parents one day, You just put your head on his shoulder, letting him talk and not mentioning how his voice would wobble and crack every once an awhile.

-Mike struggles with his emotions and mental health. When he feels like its getting bad, He tends to distance himself but you reassure him you are there for him no matter what. You hold mike whether hes crying or not and whisper sweet words into his short curly hair.

-Mike is very jealous and protective. He tries to not to show it but its obvious. His arm slinged over your shoulder everywhere, Making sure everyone knew you were his. Even when you talked to people, He subconsciously glared at the people taking your attention away from him. Mike eyes, that could be so welcoming, were cold.

-Mike loves the date nights you plan for the two of you. Whether it was going out or staying in, He loves being in your presence.

-Mikes favorite part of everyday is at night when you two would cuddle while talking about your future together. He wants to spend the rest of his life with you and hes thrilled someone like you wants that with him too.

A/N!!!: happy halloween!! What are u guys going as? Me and my bf are going as mavis and johnny :3

Hope you enjoyed!

Requests

Taglist: @nowitsmissing

#mike schmidt x reader #mike schmidt #mike schmidt fnaf #fnaf movie #fnaf #five nights at freddy's #josh hutcherson #mike schmidt smut #mike schmidt imagine #william afton

2K notes · View notes

rlimagi · 2 months

Text

Only Hers

Pairing: Princess Red x Reader

Requested?: Yes!

Genre: Fluff

Warnings: jealousy?

Being born into the royal life, you’ve always been loved and spoilt rotten especially by your parents and older brother, Ben.

Ever since you were a child, kids would follow you around school, invite you to playdates and birthdays, some would even give you their own piggy bank just for a chance to have your attention.

That never changed even when you started high school at Auradon Prep, a school where other royals or kids of famous figures attended and yet, you were still always the center of their attention.

But today you were not because everyone seemed to avoid you like the plague whenever Red’s by your side and you had no idea why. When you were alone, some people were less wary but still, many of them were afraid to even breathe near you today.

It was driving you a bit crazy because you were sure you hadn’t done anything bad that could cause them to react such a way.

One time you tried to approach a classmate to ask her about your group project and she looked at you in horror before running off.

You weren’t sure why because everyone was extremely friendly with you all year. You would often find love letters in your lockers, you never had to carry your own books because boys and girls would wait outside of your class just to hold them for you to your other classes, one girl even made you a chocolate statue of yourself for your birthday.

None of the people mentioned even dared to look at you in the eyes today. It felt extremely weird since you were used to having everybody’s eyes on you and on Valentine’s Day too, something wasn’t adding up.

But then it all added up when you saw Red scaring away a group of girls who were trying to sneak love letters into your locker. Your eyes followed her actions as she threw their letters away before looking around her surroundings.

You decided that it was your time to shine as she pulled a sparkly pink envelope out of her bag, looking oddly suspicious.

“What have you got there?” You skillfully sneaked behind her and whispered in her ear as she was about to slip it into your locker.

Red became as still as a rock when you whispered in her ears before turning around awkwardly, her cheeks flushed in embarrassment after you caught her looking like a deer caught in headlights.

“Nothing!“ Red blurted out awkwardly as she ripped the pretty envelope behind her back and tried to discreetly throw it into the bin beside her.

“Hmm…” A playful smirk rose on your lips as you eyed her up and down in suspicion before pretending to play along.

“If you say so.” You muttered before leaning against one of the lockers beside Red. You knew that Red was clearly hiding something by how weird and awkward she was, and you will definitely get it out of her.

Thankfully, you took acting lessons when you were younger because you were interested in plays and now you will use your skills to play her.

Without another second wasted, you put on an act. Sighing deeply, you looked at Red with the most innocent expression you could muster up. “Anyways, have you seen how people have been all weird with me today? I mean, today is Valentine’s Day and my locker is usually flooded with gifts but today people have been avoiding me…”

You looked at Red and noticed how she was trying to keep her cool and nodding at everything you say. “Really? What’s up with them?”

“Oh, I don’t know…is there something wrong with me? I mean did you hear any rumors about me?” You acted frustrated and ran your fingers through your hair to sell your act. It’s something you’d only do when you’re stressed out and Red clearly knew that.

“N-No way! I mean no, I haven’t heard anything…it’s probably nothing!” Red stumbled over her words as she waved her hands around.

“I don’t think it’s nothing but I’ll take your word for it.” You shook your head, looking awfully upset before patting Red on the shoulder before walking away from your target.

You knew Red wouldn’t confess at that moment, but you knew she would crack eventually as you continued your act.

The next few days you continued with your act but Red didn’t give up either but you finally had enough and didn’t want it to drag on longer than it should.

After school was over, you went knocking on her door looking like you were about to cry. Of course you weren’t really that sad about people being too afraid to be near you, but you had to be dramatic or else you wouldn’t be able to get to Red.

You jumped straight onto her bed as soon as she let you in. You quickly made yourself comfortable because Red had the softest blankets, an excuse you usually used when you want to sleep over in her room.

Red’s eyebrows furrowed in worry as she laid down right next to you, she had never seen you so upset before since you were usually so chirpy. “Are you okay?”

Your frown grew deeper as you shook your head before reaching for both of her hands, looking at her straight in the eyes. “Red, be honest with me. Am I not pretty anymore? Have I been eating too much lately? Rate me out of a 1 to 10, how annoying am I? Maybe I should go on a d-“

“Wait stop! What are you talking about? Did somebody say something to you?” Red frowned, looking extremely worried but also angry at the thought that someone might be talking about you in that way. You’re a confident girl and had always held yourself up high so it wasn’t like you at all.

Red had always been protective over you but most of the time she acted as if she didn’t care about you. One time you saw her beating up a a guy for looking at you the wrong way but then acted like everything was okay when you asked her about her bruised fists.

“No, not that I know of at least. It’s just that people have been afraid to talk to me since Valentines and I don’t know what I did wrong!” You exclaimed in frustration as tears fell down onto your cheeks. They weren’t real tears of course, you used eye drops right before you went into Red’s room to make it more convincing.

Red’s gaze soften as she leaned over to wipe your tears away. “You didn’t do anything wrong…” Her voice trailed off as she continued to stare at you intensely, she held a guilty look but you could see that she was fighting with herself on whether to confess what she had done or not.

You shook your head before hiding your face in your hands. “No- I must’ve have done something.”

Red’s mind was flooded with guilt as she felt even more uncomfortable the more she continued to watch you cry. And it was all because of her and her jealousy.

The princess of Wonderland had never felt loved before so she never understood what that word meant or what it felt like.

When she first met you, she was skeptical because you were so nice and everything about you seemed so right that it felt wrong to her.

But eventually, her cold heart warmed up and then she grew to love every part of you and everything you did felt so right to her.

She loved being around you, whether you were busy doing something else, talking to someone else, or just doing nothing at all. Being around you made her feel all sorts of things, her heart beat would go faster, there was some sort of fluttery feeling in her stomach, and she could never stop her self from smiling at you.

The feelings were new to her and she didn’t understand why her blood pressure would rise up whenever she sees a guy try to flirt with you. Or when another girl gave you flowers and chocolate, you seemed so happy accepting those. Red hated that she wasn’t the reason of your smile that day.

One thing led to another, she began scaring away your admires whenever they tried to get close. Red made sure you wouldn't find out because she wasn't sure why she had done what she did in the first place. Red wouldn't have an answer if you asked her why.

But then she saw how terribly upset you were and all she wanted to do was confess. Red wanted to be the reason of your smile and yet, she was the cause of your tears that day.

"You didn't do anything...I did.”

You were fighting not to smile when she spoke up. “What happened?” You asked, looking at her in confusion as you watched her bit her lips in discomfort.

“People were avoiding you because I scared them away.” Red sighed, clearly not proud of what she did but she would totally do it again if she had to.

You continued to put up your confused act, taking her hands into yours you looked at Red straight in the eyes. “But why did you scare them away, Red?”

“I didn’t like it when people flirted with you or walk you down the hallway, I didn’t like them being around you at all.” Red grew irritated just by the thought of other people getting too close to you for her likings. You weren’t her property but she couldn’t help but feel possessive.

“Why don’t you like them? Did they do something?” You already knew the answer but you just wanted Red to admit it herself. You knew how proud she could be sometimes so she just needed a little push.

Red was frustrated with herself for not getting straight to the point but she was afraid by how you might react when she did.

“They didn’t do anything…I scared them off because I was jealous-“ Red stood up, her heart was beating so much faster than usual, her palms were sweaty, and she couldn’t look at you in the eye.

“And I also threw away love letters from your admires- It was wrong of me but I couldn’t control myself and I think I was feeling that way because I really like you.” Red confessed, she stopped pacing around to look at your reaction but there was none.

You stayed silence for a few seconds, but it felt like hours to Red. She was waiting you to say something but you didn’t until you eventually broke into laughers when you couldn’t contain yourself any longer.

“Wait, hold on. Why are you laughing, I’m being serious.” Red frowned, her thoughts were all over the place. Maybe it was a bad idea to confess to you after all. Fortunately, you stopped laughing after a while but you were still grinning ear to ear.

“Oh I know, Red. I just find your reaction adorable.” You chuckled before patting on empty place on the bed, gesturing Red to sit next to you.

Red’s cheek reddened at your subtle compliment but she was still as confused as ever. “Why don’t you look surprised?”

A smug smile grew on your face. “Because I‘m not. I caught you stopping a group of girls from touching my locker the other day, and you weren’t being very subtle these past few days.”

“Then, why didn’t you say anything?” Red asked in pure confusion as she sat back down on the bed, next to where you were.

“I wanted you to admit it yourself.” You shrugged, leaning forward before poking her cheek gently.

“Plus, you’re very adorable when you’re jealous.”

“I really want to feed you to the jabberwockies right now.” Red rolled her eyes and slapped your fingers away when you tried to poke her cheek again. “Stop poking my cheek!”

You giggled as you retreated your hand away from her face. Then, you moved to sit right in front of her, trying to get her to make eye contact with you but she was avoiding them at all cost. “You’re very romantic, Red. Is this what you should say to your girlfriend?”

“Girlfriend?” Red finally stopped glaring at the sheets and immediately whipped her head to face yours in shock, a pink tinge spread across her cheeks.

“Do you not want us to be?” You asked in a teasing matter, a smug smirk still laid on your lips as you watched Red blushed even harder as she tried to come up with words to reply.

“Yes! No! I mean, I do…want us to be girlfriends.”

Red watched as your smile grew wider when she finally said those words. The thought of you and her dating had been on her mind since forever, it felt great when it became a reality.

“May I?”

Red’s breath hitched when you leaned close to her face, your noses were nearly touching as you held her chin so gently and asked for permission to kiss her.

Red nodded, her heart continued to beat so fast she felt like it could explode as your lips finally touched hers. She had never kissed anyone, so she didn’t know what it should feel like, but what she did know was that you made her want to capture the moment and relive it forever.

After you both pulled away, Red was finally aware of her surroundings and immediately grabbed the closest pillow before using it to hide her face so you wouldn’t see how red she was.

“I didn’t know you’re the shy type.” You chuckled before taking away the pillow from her hands before moving it away so you could see her pretty face.

“Shut up.” Red rolled her eyes, trying to seem annoyed but the smile on her face told you otherwise. “And you seem experienced, have you kissed anyone else before?”

You immediately froze at her question before laughing awkwardly, trying to avoid her gaze.

“Uh, next question!”

#descendants #descendants: the rise of red #rise of red #wlw #descendants 4 #descendants x reader #red x reader #princess red x reader #princess red #princess red of wonderland #red of wonderland

337 notes · View notes

street-smarts00 · 4 months

Text

Overwhelmed

Spencer Reid x Autistic!Reader

Summary: Reader gets sensory overload while on a case. Spencer knows how it feels and exactly how to help them.

WC: 1.3k

Based on request

Tags: autistic!reader, gender neutral reader but I only mention pronouns like once. Sensory overload, fluff

A/N: I hope you guys like the fic! I'm familiar with sensory issues cause I have ADHD but I am allistic so I tried my best.

While you were at work it became second nature to mask. Biting back the urge to repeat others when your echolalia was on the tip of your tongue. Bottling up your emotions when they started to feel too strong.

Not stimming at work was found to be the biggest challenge. You tried to find little outlets like tapping your fingertips or playing with your jewelry. But if you didn’t have to mask, you'd probably end up swaying in your seat, clicking pens, or shaking out your hands from nerves or excitement.

Today, you were away on a case with the team. You've been busy since practically the crack of dawn and were both physically and mentally exhausted.

Some of the members of your team were following leads while you and Spencer were going through letters and gifts delivered to the victims before their deaths.

You were reading a letter from the unsub while the loud voices from the precinct seeped into the office your team had settled in. The words on the page in front of you were starting to bleed together. You must have read the same sentence at least 5 times; and yet, you had retained none of the information.

The noise only seemed to get louder and more defined. You could hear at least 4 different voices, the incessant clicking of keyboards, the coffee machine, and a constant buzzing of the electricity from the lights overhead.

And on top of the overwhelming noise, the lights in the room only seemed to get brighter. You kept squinting or rubbing your eyes every minute or so. But nothing could help the words on the page from floating away.

“You okay?”

Your focus was pulled back to reality from the voice across the table. You looked up and met Spencer’s gaze.

“Fine,” you said plainly trying to hide the fact that your head felt like it was going to explode.

“Are you sure? You’ve been staring at that letter for five minutes.”

“I said I’m fine,” you quickly replied a bit harsher than before. You didn’t mean to, you would never snap at him.

You put down the paper and ran your hand over your jeans. Desperate to distract yourself from your other senses.

Your eyes get lost in the pile of paper in front you so you don’t notice Spencer getting up and walking across the room. You don’t notice until the cacophony of the station dulls. It now sounds muffled, almost completely gone.

As you continue tracing your hand against your jeans you hear a soft noise come from behind you. You turn around to see Spencer closing the blinds of the window that leads to the bullpen. He then turns off some of the overhead lights, turning the room dim.

With your mind still fuzzy, you couldn’t comprehend what he was doing but you were grateful for it. The dimmed lights and sound with the added privacy of the blinds helped you start to relax. Yet you still clung to the rough texture of the denim of your jeans.

Spencer then pulled up a chair to sit in front of you and face you.

“Hey,” he held up his hand in front of you. “Put your hand out like this”.

You copied him with the hand that wasn’t running up and down your thigh. Your eyes wouldn’t meet his, you glanced between your lap and his hand.

“Take a deep breath and slowly close your fist while you inhale. Then hold your breath for four seconds while you make a fist. Like this.”

Spencer slowly inhaled as he closed his hand. You copied him with a small shake in your breath. He then quietly counted to four for you to hold your breath.

“Now release your hand as you exhale,” he guided. You copied his actions and watched his hand and you exhaled.

The both of you continued the breathing exercise for a moment. Finally, your head seemed to stop spinning; but there was still a lingering discomfort you couldn’t quite place.

You didn’t seem to notice your hand on your thigh had resumed its search for touch in the denim. Spencer did. He saw you using the sensation of your jeans as a way to self-regulate.

“Y/N, do I have your permission to touch you?” He asked softly.

You nodded your head as no words could escape your throat.

Spencer shuffled his chair closer to you and reached for the hand you still held in the air. He lowered your hand and gave it a gentle squeeze. He placed his other hand on his knee, open, waiting for you to reach out when you felt comfortable.

Almost immediately, the hand that had previously resided on your jeans now reached for his. He gave both your hands a gentle squeeze before rubbing his thumb over your knuckles. The corners of his lips turned up into a smile as he watched the last bit of overwhelm leave your body. He could practically see the weight being lifted off your shoulders.

You brought your gaze up to meet his. His eyes were so kind but also filled with worry. His pupils dilated from the low light in the room, at least that's what you figured.

“How’d you …”

You knew it was a dumb question. He was a profiler and a damn good one. But your brain still questioned how he knew exactly what you needed.

“Sensory overload occurs when your senses are taking in more information than your brain can process. When your brain becomes overstimulated from the input it translates to feelings of anxiety or extreme discomfort,” he explained. He was a bit worried about continuing as most people would brush off or ignore his long explanations.

Instead, he was met with your attention, waiting for him to continue. He then realized he never exactly answered your question.

“You kept rubbing your eyes, reading the same passage over and over again, zoning out, fidgeting, running your hands down your jeans, and … you kinda snapped at me.” His voice lowered towards the end of his statement.

Your eyes widened and eyebrows raised, “I’m so sorry,” you worriedly apologize.

“It’s okay,” he reassured softly as he gave your hands another gentle squeeze. “I know you were overwhelmed and probably felt out of control.”

A small smile spread on your face. “Thank you.”

He unconsciously matched your smile. “It’s no problem.”

“No really. You have no idea how much this helped,” you confessed.

He looked down and licked his lips while considering his response. “I get overstimulated from time to time. It happens a lot when the lights are too bright. I know it’s a stressful thing to experience, especially here at work.”

His eyes rose to meet yours. Your eyes always shined with kindness and warmth. He hoped he could provide that warmth and comfort for you.

“I want you to know I’ll always be here for you when you need it.”

Your eyes wrinkled from the smile on your face. Spencer couldn’t help but mirror your expression.

After a moment of silence, you realized you still had your hands in his. His eyes followed yours to your hands and his face became flushed. Your cheeks soon turned a shade of red as you both pulled your hands apart from each other.

You cleared your throat before speaking, “Thanks again.”

“You- you’re welcome,” he stuttered as he made his way back to his seat.

It took a moment to return to your work. Not because of the chaos outside the office or the overhead lights. Instead, your mind kept wandering to Spencer’s kind gesture and your hands in his.

Meanwhile, on the other side of the table, it seemed Spencer’s reading speed was decreasing. His eyes wouldn’t stop from wandering to the person across from him.

#spencer reid x reader #spencer reid headcanon #criminal minds #criminal minds fanfic #spencer reid #spencer reid fanfiction #spencer reid imagine #spencer reid one shot #spencer reid x you #criminal minds fanfiction

411 notes · View notes