#⭒✧ — database » verses

[randomly-generated-posts-machine]

percy jackson gaslighting srinklo is so ooga chaka baby

[carbondated]

sad headcanon time: basically in my canon pretty much everyone else in the datacore ( except Dr Moon bc ofc Moffat and RTD both stated he is in fact a future incarnation of the doctor. ) die during the process which extracts river's consciousness.

It's the reason Post library River will put off crossing her own time line in order to orchestrate her own resurrection, because of the immense guilt she carries thinking that CAL and her team will die because of her.

It's not until much later in her life when she realises the firewall had fallen and that it was not her transfer that killed everyone but a slow moving virus uploaded to the database days before.

Unlike the others, any doppleganger created from her DNA still has the ability to regenerate and limit the effects of the virus. Meaning that even if she tried to rescue the others like she did herself, they could not survive a transfer out of the database.

Comforted by the knowledge that she did not cause their deaths, River does the only thing she can for them, which is to erase them before the virus can consume them. It's a painless process and she allows them each a proper goodbye before she does it, giving them all the choice. CAL was the last to go. River will always love them and she cherishes the time they spent in the datacore together.

[bladedalchemistreplica]

《《~~~~~☆___

BASIC INFORMATION_||

Activity level: Mild-spontaneous

Accepting level: Non-Selective

Event-Current: EMPTY

Future event: EMPTY

Questions: ask box OPEN

Friendly towards: Crossover, OC's, outside of Voltron fandom(s), same characters of muses and other AUs/realities, Multiverse-e.t.c…

M!A: N/A-Open

Blog type:

Side blog_Main- @fadednorth || Branched off @themisplacedtruth-vld ►►► 5/4/24--massive update

================================================

!NOTICE!

Please be aware that if you haven't seen Voltron; legendary defender and is interested in watching it or are watching it currently there may be spoilers

Blog[[ I work longer days on the route, so I won’t do a lot of thread responses, so asks can be sent in for a queue response. Not all will be reserved for those days but it’s a little treat until I do more! This is also for longer responses and artwork/responses with asks! 8/31/23-updated

================================================

((READ PINNED/NEWEST POSTS))

I will be upgrading and migrating to another blog for the AU i have been working upon. more updates to follow soon!

[fakesmade]

Lieutenant Amara Flores: With expertise in history and art, she was originally an authenticator for Starfleet before being assigned to active duty on the USS _ as a starship Historian. Mostly given freedom over the topics she chose to research, she initially was only required to supply the crew with any pertinent data they requested. Over time, however, she found a talent for diplomacy and she was increasingly asked to join as part of the landing crews for missions.

[ngtskynebula]

Ecosia is still Google, unfortunately. It uses the same program :(

I've been looking into the DeGoogle Movement, and seeing how many programs Google bought in the past I'm convinced it's actually impossible to REALLY DeGoogle yourself from them... Ecosia is the best browser I've tried so far, though there's an ocean smth that's apparently related to selling user data or smth? I dunno. Haven't tried it, but I've heard about it. I'd rather my Ecosia diverted from Google and IA, though... 🫥

[wisponed]

did you really think this is the right thing to do ?

SEND ME MEMES !

"are we having a discussion about morality or are you just trying to get in my way?" scratch doesn't look to shadow as she cleans her wispon with an oil rag, going over the same spot across the wisp port for the third time. it's not that shadow intimidates her, more that she thinks his look might force her to reconsider, reflect, recontextualize, think.

scratch is so tired of thinking.

she can't remember the last time her body hasn't felt like a taut wire, tension making her feel like something brittle. hit it once it won't break. twice? maybe it'll survive, fault lines holding together like a kind of belated prayer. three times...?

if she's going to break in front of someone, it certainly won't be shadow.

the ivory lightning wisp swoops over to her, hovering at her elbow, its glare expectant. she's gotten used to calling it blitz, a name it seems to accept if not outright enjoy. blitz isn't hers, not a pet to be toted around or a simple weapon to use, but it is the closest thing she has to a friend she has. scratch may not have a fancy miles electric to translate the language, but she and blitz have been working together long enough to understand one another. the robotnik base is clear. time to head inside.

scratch tucks the rag into the back pocket of her pants, double checking the grappling line on her wispon. when she finally does look up to shadow, yellow eyes meeting red, her gaze is hard. blitz bobs up to float near her shoulder, staring shadow down in tandem. even if blitz doesn't condone scratch's hunger for revenge, she knows she can count on it to back her up in any argument.

"you gonna force me into a socratic, or can i get my night started?"

[inarretable]

general tags

⭒✧ —  out of armor  »  ooc

⭒✧ —  holocrons  »  prompts

⭒✧ —  weapons do not weep  »  study

⭒✧ —  holonews report  »  updates

⭒✧ —  transmission error  »  verse tbt

⭒✧ —  knock out‚ knife point‚ knightqueen  »  crack

⭒✧ —  eyes of vicious crimson  »  countenance

⭒✧ —  of violent devotion »  aesthetic

⭒✧ —  tales of the wretched »  threads

⭒✧ —  comlink  »  inbox

⭒✧ —  the heart beats in silence »  wish list

⭒✧ — holonews special! »  promo

⭒✧ —  database  »  verses

⭒✧ —  transmissions »  queue

⭒✧ —  out the airlock  »  tbd

[ophcnim]

tag dumpeth

♢▐

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[mysteryshoptls]

SSR Ortho Shroud - Platinum Gear Vignette

"Happy 100th Anniversary"

[Land of Dawning – National Museum of Art]

Ortho: So, this is the Land of Dawning's National Museum of Art… It really has such a large and diverse collection of various genres of artwork. This is essentially a database of art.

Ortho: According to the map I installed, this exhibit should hold the painting I'm looking for…

???: An enormous dog with three heads and sharp fangs… A frightening creature, indeed. I would have loved to have seen it personally.

Ortho: Hello, Jade Leech-san. I was just here to check out the Cerberus painting, too.

Jade: Is that so? As a creature that served the Lord of the Underworld, the Cerberus truly did have a powerful aura about it.

Jade: I'm sure with all 6 of those eyes keenly trained on the entrance to the underworld, it would have been a difficult endeavor indeed to attempt an escape.

Ortho: They're really cool, don't you think?

Ortho: But, according to lore, if they got tempted by their favorite sweets, they would end up lowering their vigilance.

Jade: Fufu, I see. So, perhaps it was a more charming creature than it looked… Would you agree?

Ortho: Yep. Also, they had one body, right, so each of the three heads ate a smaller amount of food…

Ortho: And they'd get in fights whenever they wanted to go in different directions… There's so many other cool stories about them, too.

Jade: You're very well-informed. Is this something that all Ignihyde students must know?

Ortho: Mmm, I'm not sure. I probably just know a lot since I really liked the stories in which the Cerberus would show up, and I'd read them all the time.

Ortho: Back when I was a kid, me and my brother would read picture books on the legends of the Lord of the Underworld, see…

Ortho: And even after coming to Sage's Island, whenever I learned of a new tale involving Cerberus, I'd update my database.

Jade: I see, so that's how… Well, I appreciate having been able to hear some unexpected anecdotes.

Ortho: Most would say that they look ferocious, or seem really strong, but the more you get to know them, the more cute you'll find them.

Ortho: Since Cerberus is considered a dog-like monster, I've also been collecting data on regular dog behaviors too.

Ortho: Recently, I've gotten to pet some dogs out for a walk down in Whistle Park. Of course, I ask their owners for permission, first.

Jade: A real dog… That's astounding. As I do not have much experience with them, I'm afraid I'm a tad hesitant to actually touch them, myself.

Ortho: I was a bit hesitant too, at first. I didn't really know how much strength I should put into touching a living creature…

Ortho: And since I'm a technomantic humanoid and smell different than humans, they'd be super wary of me.

Jade: Ah, that makes sense. They do have a powerful sense of smell.

Jade: So then, how is it that you've become able to interact with those dogs, Ortho-kun?

Ortho: I just would strike up a conversation with them on a regular basis and slowly built trust.

Jade: That is astounding. This is the first I've heard that you are well-versed in animal linguistics.

Ortho: I'd always had an app installed that'd let me talk with animals, but…

Ortho: Once I became a student at Night Raven College, I actually developed an animal linguistics translation tool.

Ortho: By talking to the animals first hand, I was able to improve the translations that seems a bit strange…

Ortho: Not only has was I able to improve the translation accuracy, but now I've gotten close with a bunch of dogs that they'll actually come up to me themselves once they catch sight of me!

Jade: So, in addition to achieving your goal of petting dogs, you were able to update your own translation tool… Absolutely fantastic.

Ortho: Heheh! Thanks, Jade Leech-san.

[Land of Dawning – National Museum of Art]

Ortho: This is a painting depicting one of the scenes from the Mermaid Princess's legend, isn't it? That's the Sea King riding that sleigh, right?

Jade: That's right, and what a dignified and gallant figure he is. What a shame he was unaware that the princess would be absent for the concert.

Ortho: He got really mad the moment he learned that the princess was going to be absent for her own debut… or so the story goes.

Ortho: I feel bad for the king, that she slipped out without telling him. But it's pretty cool that he gets to ride that dolphin-led sleigh.

Jade: Did that dolphin-led sleigh catch your eye? Then please, you must visit the Coral Sea.

Jade: They are primarily used for special events, however there are many such sleigh services geared towards surface-dwelling tourists.

Ortho: Cool, what sort of stuff? Let me search up "Coral sea dolphins sleigh" real quick…

Ortho: Here we go, there's a ton of tours, like… "Tour the Majestic Sea on a Dolphin Sleigh" and "Explore Undersea Ruins upon a Dolphin Sleigh"

Ortho: "Dolphin-led sleighs are safe and secure! Feel like a king as you partake in an elegant tour of the sea!" …Wow!

Jade: Safe and secure… I am a tad doubtful of that statement.

Ortho: You mean it's actually dangerous?

Jade: About 2 years ago, there was an incident where tourists from the surface were left stranded in the middle of the ocean.

Ortho: Let me search for any incidents having to do with dolphin sleighs. Ah, I got a hit on a news article from 2 years back.

Ortho: The stranded tourists were able to find their way to land on their own, and were all okay in the end, but…

Ortho: The touring company responsible got a ton of bad reviews after that. Looks like they got flamed pretty badly online.

Jade: Well, now… A corporation built at the bottom of the sea in which fire cannot thrive was "flamed pretty badly," you say… How wonderfully ironic.

Jade: According to the news, the dolphins merely left on a whim. If this all happened because of their mood, then what's to stop this sort of thing from happening again?

Ortho: You're right, Jade-san. This is a completely different story than just trying to fix the bugs in the system.

Ortho: I wonder if there's some sort of pattern to the timing of those dolphin mood swings. I'll have to search up on it later.

Jade: Fufu, you are quite cautious, aren't you?

Ortho: Yep! 'Cause, if I'm going to go check them out, I'd want to go when they're in one of their flippant moods!

Jade: I was not expecting that response. I completely expected you to be wanting a "safe and secure" tour.

Ortho: It might be fine just strolling around the ocean depths, but I feel like it wouldn't be as satisfying being stuck on a set path.

Ortho: If the dolphins act up, they might leave me stranded in the ocean, or take me to unexpected places…

Ortho: Doesn't it get your blood pumping to think about what sort of unpredictable moments might be waiting for you?

Jade: Indeed, I completely understand that sentiment. When everything follows organized harmony, it does get quite boring.

Jade: Then, how about I suggest a more stimulating tour for you? I assure you, this absolutely will not leave you wallowing in boredom.

Ortho: That sounds fun! I can't wait to see what kind of tour you come up for me, Jade-san.

[Land of Dawning – National Museum of Art]

Jade: Ah, this artwork depicts the scene where the Fairest Queen is sending out her most trusted hunter on a significant mission.

Ortho: I heard that when it comes to paintings depicting the Fairest Queen, you'll want to focus on the finer details, like the direction her face is looking, or the angle at which her finger is pointing.

Ortho: Vil Schoenheit-san told me as such when I was selected as a supporter for the museum.

Jade: That's good to know. I'm sure those in Pomefiore would be passionately moved while gazing upon this painting.

Ortho: Hmm, the concept of being moved by just looking at a painting is still a difficult one for me to grasp…

Ortho: But actually, something happened recently that's still stuck in my mind. I wonder if this is what they consider to be "moved" by something?

Jade: What a fascinating start. May I ask what sort of thing happened?

Ortho: The Film Research Club went to Crane Port for some club activities, and on the way back, I ran into this family that was fishing.

Ortho: They were chatting away about what kind of dishes they'd make if they caught anything, but their bucket was still devoid of any fish…

Ortho: Right as the dad said, "I guess we should head home," his kid caught a fish!

Ortho: Everyone looked so happy. But what do you think that family did next?

Jade: Did they not put the fish in the bucket and carry it home?

Ortho: Nope. They just said it would be a pity to eat a creature so small and threw it back into the ocean.

Ortho: But they did that after they had finally fished one up! It didn't really make sense to me, so it was hard to understand what I saw.

Jade: If I recall, there is a certain release size criteria that is implemented here on land in order to conserve water resources.

Ortho: Yep. But according to my measurements, that fish was about 5 cm larger than the release criterion.

Ortho: Based on the way that family was talking, once they had caught a fish that was "big," they should have taken it home with them.

Ortho: Even though it was an adult fish adequate for cooking up, they pitied it because it looked too small…

Ortho: No matter how many times I think it over, I can't really understand that mechanism.

Jade: I thought this would be a story where you were moved by their care for a small creature… But instead, I see you were more taken in by their incomprehensible actions.

Ortho: They spent time and energy into trying to fish up that fish, but in the end… I wonder if that sort of illogical action is what makes a human human.

Jade: Perhaps, perhaps not. For that family, it may be that was the most logical choice.

Ortho: Eh, what do you mean?

Jade: If it were a large fish, then the whole family could divide it up and eat it. However, a single, small fish would not nearly be enough.

Jade: In order for everyone in the family to eat their fill, they would need to cook up more dishes to go with it.

Jade: Then, if there were no fish to begin with, they wouldn't have to go through the trouble of making extra dishes… Perhaps that would be a better way to think of it?

Ortho: I see…! If I were to think from the eyes of the person who has to prepare the meal, that decision makes more sense.

Jade: This is only a possible scenario I've come up with… But I only mean it to illustrate that there are many ways to view something.

Ortho: Heh! See, this is why talking with as many different peoples as I can gives me so much new data… Plus, it's really interesting!

Ortho: Thanks a ton for listening, Jade-san. I hope we can chat about other stuff some other time.

Ortho: Okay, time for me to go check out another exhibit. Oh hey, this painting…

Ortho: It depicts the moment when the Son of the God of Thunder and his trainer is talking about his grand dreams.

Ortho: According to the lore, this guy's strength was way off the charts and was invulnerable, but… I bet I could find it.

Ortho: I know I could find a weakness that could bring even a hero like that down.

Requested by Anonymous.

[severusskywalker]

I’m looking for some more podcasts to listen to.

I’ve recalling liked The Magnus Archives, Welcome to Night Vale, Malevolent, Wolf 359, and a couple others, and I’m looking for more. I like ones with overarching plots, if that makes sense? Any recommendations? Thanks!

Edit: A few more I have enjoyed/finished (including from the list below, as I listen to them!)

Archive 81

Auricle

The Deep Vault

The Scarab Archives

Vigil

The Technomacy Project

What Will Be Here

Re: Dracula

Stellar Firma

Out of Place

I Am In Eskew

Ars Paradoxica

The Antique Shop

And now the ever increasing recommendations, so they are all in one place… please feel free to keep recommending ones too, I love growing recs lists! (Now alphabetized!)

Aftershocks

Alice isn’t Dead

A Voice From Darkness

Camp Here and There

Captain Skyjacks

Case 66

Critical Role

Cryptids

Dames & Dragons/LegendLark

Darkest Night

Death by Dying

Derelict

Desert Skies

Desperado!

Deviser

Dimension 20

Don’t Mind Cruxmont

Dungeons & Daddies

Either

Ethics Town

Find Us Alive

From Caulk and Candles

Ghost Wax

Girl in Space

Greater Boston-the vignettes

Hello from the Hallowoods

Interstitial AP

Just Roll With It

Kakos Industries

Keep it Steady

Last Call at the Bluebell Cafe

Life With Althaar

Limetown

Mabel

Midnight Burger

Midst

Mirrors

Mission to Zyxx

Mockery Manor

Monstrous Agonies

Murray Mysteries

Neighborly

Newts!

Not Quite Dead

Old Gods of Appalachia

Oz 9

Paralyzed

Potterless

Red Valley

Revolution

Riley Hopkins and their Amazing Friends

Rusty Quill Gaming

Sayer

Second Star to the Left

Seren

Somewhere, Ohio

Spines

Spirit Box Radio

Spirits Podcast

Steal the Stars

S-town

Strange Case of Starship Iris

The Adventure Zone

The Amelia Project

The Black Tapes

The Bright Sessions

The Cellar Letters

The Deca Tapes

The Invictus Stream

The Left Right Game

The Liberty Podcast

The Milkman of St Gaff’s

The Mistholme Museum of Mystery, Morbidity, and Mortality

The Newest Olympian

The Night Post

The Pasitheaa Powder

The Penumbra Podcast

The Sheridan Tapes

The Silt Verses

The SPC Foundation Database

The Storage Papers

The White Vault

Time:Bomb

Unwell Podcast

Vast Horizon

We’re Alive

Within the Wires

Woe.begone

Wooden Overcoats

[disrealities]

Vocaloid / doll themed alternative terms! Requested by a mootie who will remain anonymous :3c

alter . . . synths, voices, phrases, lyrics, chords, episodes, vocals, falsettos / tenors / etc, samples, singers, songs, verses, hymns, composers, sonnets, concepts, dolls, toys, figures / figurines, puppets, keychains, teddies, stuffies (?), plushies

system . . . choir, chorus, ensemble, anthem, orchestra, symphony, program, software, spaceport, database, sekai, duet, dollhouse, toyhouse, playhouse, see also: tech theme!

[callmelyc]

Angsty post canon concept:

When Allura dies what if the Altean magic she used on Shiro and Lance weakens and that's how ppl find out Lance also died?

Both Lance and Shiro start with symptoms they can ignore and ones doctors brush aside. They get told it's fatigue, they get told it's after effects from fighting In the war like they had for all that time. Neither realize it all starts after Alluras death.

Then they end up with things unexplainable. Things like extreme full body tremors, sudden extreme chills and are icy cold to the touch no matter the temperature. Their bodies ache in the ways they had in their deaths but neither man admits it out loud too afraid of what that might mean so neither is aware they aren't alone is this bizarre and sudden turn of events.

It's not until Lance collapses and is rushed to the Garrison hospital that they discovered it something more.

His body deteriorating from the inside out seen visibly from their newest high tech scans. Rotting, closing down, slowing or lacking proper function like his body has given up. Like his body is referring backwards to lack of life but no one knows why.

It's almost like its frying itself from the inside out, it's path crawling closer and closer to his heart with every passing day like bolts of electricity pulsing more and more upward.

Shiro is the first to realize what it means once Lance is finally giving the symptoms they'd had to pry out of him. He realizes with dread that his fellow paladin has things that match up too close to his own.

He only realizes bc he's felt similar things, only his resemble his own death and he knows for a fact its thinfs in Excruciating pain, a pain he thought no one but himself would ever understand.

To get lance to admit what happened Shiro goes through the scans himself to prove his point. No one enjoys hearing Lances story, Allura hadn't even known she was capable of what she'd done to him So he's worse off than Shiro is and terrified of the idea of dying again this slowly

both get taken to an off planet hospital, one that could preserve their symptoms until the rest of their team and families could find a way to heal them

But without Alluras alchemy No one knew what to do.

First they try talking to the alteans on new altea but none have any knowledge of the alchemy allura had used for them

Then the team spreads out

Pidge uses her ranking in her field to gain any and all database information she can get her hands on

Hunk uses his connections To the Balmera and other species to attempt to find any information on healing abilities that might help

Keith is the most successful, the man he loves and his brother are dying and he wouldn't accept that one bit

He sends all the Blades willing to look for any possible Leads and anyone who might know anything about healing magic or alchemy

Keith is the one who comes across one of haggars old druids, one well versed in altean alchemy and one bitter at what had become of the craft

She had understood, to a degree, what Allura had done to Save both men

She had tied their life force to her own to ground them back to this plane of existence and now that she's no longer tied to one universe her connection has faded and so has theirs

"You must tie them to another life to keep them but this practice is taboo. If this next life dies they will with it."

Keith doesn't hesitate for a moment "just tell me what to do and I'll do it."

He ends up tying Lances life force to his own, Lance so sickly he didn't get a choice and Keith apologizes the entire way

He combs fingers through lances thinned hair hoping it brought any comfort to the man that had no energy to even stay awake anymore "you can be as angry as you want after this, as long as you survive I don't care anymore..."

Shiros husband does the same for Shiro

They know it's worked when their bodies stop dying and start to finally try to heal.

The damage so extensive they both spend months in newly crafted healing pods that do everything to try to reverse it.

Both come out whole, alive and maybe a little worse for wear than before All this took place.

But no one cares so long as they stay alive.

And, if when Keith tells lance what he'd done to save him, Keith earns a strict slap to the face for his recklessness that's followed by a gentle kiss.

Well, no one says a word.

[carionto]

Human sciens is simply fuck around and find out

So when the humans give a tour of the labs so alliance members see what the crazed apes are up to, suddenly BOOM the halls shake and lights flicker but the tour group is fine while the one giving the tour says something like "Ah thats the sound of progress" all while there's people rushing by with guns and extinguishers yelling about a code Red and subject escape

[22/09/23] Nice, that is a fun trope to work with. I think I'll leave the dinosaur crew be, and have some other questionable research station make a debut with an "accident". [23/09/23] Idea pops in my head after several rejections - Human-alien hybrids (because you can't cross-breed because that's not how biology works, but Humans are still curious, because of course we are) [24/09/23] Actually, no, I don't like that: 1st - fairly common as is; 2nd - doesn't feel right with the Humanity I'm writing out. No, I think a better avenue is, since Earth in this verse is gonna collapse in on itself in under a century, experiments towards terraforming methods, since that's a requirement and thus a literal blank check for any- and everything. Yes. (mad scientist voice) Yeessss, I can see it taking shape! [25/09/23] It took some kind of shape indeed.

_____________________________

Biology is the most diverse and complicated field of research with literally no end in sight. We will eventually discover every law of physics, and, yes, chemistry also has the potential for limitless combinations, only in biology can you find and create circumstances where trillions of different organisms co-exist and co-operate, compete, and can create a stable and self sustaining system. Not to mention mutation and evolution across generations, as well as the myriad of changes and adaptations a single organism can undergo in its singular lifespan. The potential is truly beyond the bounds of imagination.

Since biology is an omnipresent field in every civilization, it is only natural that it didn't take long before a Human led joint Coalition Flora research station was established - the Efflorescent Sneezewort Yarrow.

It is also natural that not long after that the non-Human staff sent this panicked message:

The Humans are insane! First, there is no regulation for anything beyond decontamination, which would be fine, if - IF - they didn't sometimes just bring the test materials out with them anyway for, and I quote: "Let it experience the outside world" or "Introduce it to my other plant buddies." The head researcher, instead of reprimanding this clearly dangerous behavior, just lets it happen. As a matter of fact, he almost exclusively and constantly ingests a plant-based gaseous substance through a device he calls a "bong" and locks himself for days on end within a random lab and, as he put it while looking at the ceiling: "Feel out the connections. We're all part of one whole, and only by becoming one with the roots of the soul can you truly attain the understanding of the spirit, and unlock the true calling of each sapling." As I draft this emergency message, there is a shuttle going through decontamination with two squads, one is an extreme disaster containment unit, the other a full on military special forces unit. With heavy duty weaponry. The worst is what they had to say: "Yeah, sometimes one of these nutcases gets the idea to combine plants with animal genes, and, to be fair, with access to the whole Coalition database and samples, I get it. There's a lot of really weird and cool creatures out there on each planet, makes most people at least think about playing scientist. Anyway, it's gonna be fine, the code said it was just a Mini HoH, so we'll be done in under an hour and you can all go back to doing your thing. I just hope we don't have to burn the thing this time, the prof said it's something like a dandelion and a small rainforest actual almost-lion from one of the real far out planets, but it's got bunny ears and the nose of a German shepherd, sorta. I think that's kinda neat." By the way, HoH stands for, and I am not making this up and the translator did get it right - House of Horrors. They claim it is just an homage to a piece of old Human culture. I don't believe them. I refuse to be a part of this madhouse for any longer than I must. Send a vessel and return me to a normal laboratory setting. I will now incubate myself in a cryo-pod to prevent any more exposure to these "scientists". Thaw me out in clean garbs and with two interns already doing real work on new medicines.

[yabagofmilfs]

I'm sorry but this has simply destroyed me: "OR geno was brought to the nhl as a stud for Sid in 2006 with the thought that Sid would whelp in the next few years but after the concussion he couldn’t bring himself to miss any more time so he and geno have had this complicated relationship where they’ve essentially fallen in love but the structure of their relationship don’t let them acknowledge it on either side and now Sid HAS to get pregnant he’s running out of time and both of them feel resentful of it" GOD if you ever wanted to write that I would simply lap it up... any more thoughts you're happy to share on that verse?

ALTERNATELY may I also suggest for your consideration an AU in which Geno stayed in the KHL, and now post-retirement Sid is putting all his ferocious focus into finding the perfect sire for his pups, and obviously his babydaddy needs to be good at hockey, he's combing the stud database where you can filter players by age, stats on points, etc. (maybe if we get really grimy there's stats on their sperm count etc. because hey pro-athlete breeding is important business)...anyway sid decides the only alpha for him is that rangy Russian he came up against in a few international tournaments and always admired... he pays Malkin's absurd stud fees but oops he didn't expect him to be funny and sweet and more handsome than Sid remembered...

i love every iteration of this concept. this tweet will be tumbling around in my head for the next month, i think.

i've thought a lot about what the combine at the draft would look like for breeders in my of use universe, but what if in addition to the fitness assessments alphas and omegas also had to go through some very invasive and public fertility and compatibility assessments because being drafted is also an agreement to be paired for breeding when the league decides it's time for you to retire.

because sid is a fussy bitch and the league's darling, he never gets paired with anyone because compatibility is too low across the board and they don't want to waste his genes on someone subpar. they talk about sid like he's too much of a frigid bitch or hockeybot to ever be paired with anyone, and all the alphas take their low compatibility scores as a challenge so he's constantly having to fight off being scruffed or bitten on ice.

he's in his last year when geno defects. maybe they don't test russians because the russian government mandates they have to come back and breed in their system after retirement? and because of that russians are basically second class citizens in the league. but sid is panting after him like a baby omega scenting their first alpha. geno is so shy and he doesn't even speak english and can barely look at sid if they're not on the ice together, and sid is having breakthrough heat after breakthrough heat just trying to sweat through it, knowing that even if they are compatible he can't let geno breed him--geno would be sent back to the KHL immediately if anyone ever found out, and sid would be reviled for taking a russian. maybe they wouldn't even let him in the HOF for muddying the gene pool like that.

idk what happens next except that of course geno does breed him because who can resist a sweaty pink sid who plays hockey like a god and smells like a slutty wet dream all the time and keeps looking at you like that. may god and his country forgive him but he is only an alpha. maybe someone tries to bite sid during a game and geno goes nuclear and bites sid himself. idk. this is incoherent but i've only thought of the hot parts and can't be bothered with plot.

[skills-bracket-2]

1. “Call upon all your knowledge. Produce fascinating trivia.

Cool for: Thinkers, Historians, Trivia Freaks

Encyclopedia makes you a know-it-all, turning your mind into a database of facts. It enables you to draw on these facts innately, offering a wealth of background knowledge to all things related and unrelated to your case. Who knows when the history of cigarette brands will provide the breakthrough you need to arrest a murderer – or when knowledge of pre-Revolutionary guns might save a life?”

2. “Reconstruct crime scenes. Make laws of physics work for the Law.

Cool for: Forensics Scientists, Tactical Fighters, Math-Minded People

Visual Calculus verses you not only in the laws of the state, but the laws of nature. It enables you to create virtual crime-scene models in your mind’s eye. You’ll see how a bullet shattered the glass and from that trace its trajectory with mathematical precision. You’ll also count so many footprints – and at a glance discern shoe size and design; as well as the height, weight, and gender of the one who wore them.”