#does the snail have a name

[skygoldart]

Grian cosplay on the way! In the meantime, I’ve made some snails to go with it

[doodledex-project]

Doodledex - #705-A Hisuian Sliggoo

While there's no outward change to the Goomy that lived in Hisui, the same can't be said for their evolution! Thanks to exposure to high concentrations of iron in the water there, Hisuian Sliggoo are Steel/Dragon types and have developed a large, round, metallic shell! (And yeah, this technically makes them snails instead of slugs.)

However, unlike normal snails that only keep their organs in their shell, Hisuian Sliggoo holes its entire body up in there, with only its head and arms sticking out! It seems like this would make it awkward to move around... but when it needs to go fast it will retract all the way into its shell, stand itself up on its side and roll away!

[the-dragon-invasion-is-near]

Just found a december pic of Glee Anselm (one of my og snails) giving a piggyback ride to one of the accidental babies

Gosh they (the babies) were so small

[maretriarch]

i literally need to go the vet and get my blood drawn and get professionally diagnosed with a fursona

[littlegermanboy]

hi everyone, i've been speaking to my friend reem (@danashehab) and she has told me of her difficulties in reaching her fundraising goal to evacuate herself and her family from gaza. her messages break my heart, and i want nothing more than to help her achieve her dream.

before october 7th, reem, her husband, and their five beautiful children, the youngest of which is less than 2 years old, lived in the north of gaza. her husband, fahed, owned a gym which served as their family's source of income.

however, they have since been displaced numerous times after the destruction of their home and fahed's gym. reem's children suffer from the anxiety and terror of growing up in genocide, and reem suffers from the uncertainty of their situation, unsure of what to do or say to give her children hope; this is only made worse by the fact that their campaign has been moving at a snail's pace as of recently.

if you're able, please donate whatever you're able to help reem and her family. reem's endless love for her family and her children are palpable in every message i receive for her, and it is clear that everything she does is for them. as of july 30th, €27,420 / €50,000 has been raised, which is just over half of their goal. if you're unable to donate, please reblog and share to other platforms so reem's family can reach their goal as soon as possible. they deserve to live a life of peace and happiness, safe from the threat of genocide.

[vrystalius]

Sleepy…

How the hashira act when they’re tired?

Pairing: Sanemi, Kyojuro, Gyomei, Giyu x fem!reader

(Reader has stretch marks on her thighs in Gyomei’s part)

Sanemi Shinazugawa

In the mornings…

Sanemi wakes up being grumpy and drained rather than rested from a good night’s sleep. His hair is messy and some stubble formed on his face over the night. Also, he doesn’t believe you when you say he snores in his sleep, even though you woke up from him snoring or grunting in his sleep multiple times. You sometimes even heard him mumble something about Genya and ohagi. Your name fell every now and then but you haven’t told him about that yet. He had a huge grin on his was while seemingly dreaming of you, and you didn’t want to hurt his pride even more.

Sanemi is slow in the mornings and needs you to drag him out of bed. If he has nothing to do but train today, so why can’t he just sleep until he needs to train? He’d hunch over the sink and slowly brush his teeth while having his eyes closer again. You once caught him falling asleep in that stance, snoring quietly. While Sanemi is finishing up in the bathroom at a snail’s pace, you take some time to cook up something nice for you two.

Heavy footsteps would stumble down the stairs and Sanemi would drag his heavy body over to you, leaning onto your back and nuzzling his face in your warm neck. He’d groan and squeeze your waist gently.

“You still feel so warm… ugh, I wanna go back to bed…”

In the evenings…

After showering, Sanemi doesn’t really have energy to do anything else after hunting demons all night. He can’t sleep without you though, so he’ll just lay in bed like a log and wait on you to join him. Sometimes, he’d even call out to you to hurry up and cuddle him already.

Once in bed, Sanemi’ll lay his head on your soft chest and close his eyes. His cheek is slightly squished and mouth slightly agape. He’d want you to play with his hair and run your fingers through his white locks. Sometimes, Sanemi would accidentally start drooling onto your skin or shirt, forgetting to swallow his spit. Your massage is just making him forget anything: his worries, fears, train of thought and to swallow his spit.

Of course, Sanemi would be incredibly embarrassed and deny enjoying your craved touch this much. Sometimes, he’d even roll off you and lay on his stomach, pretending that he’s perfectly fine to sleep on his own. You giggling at his flushed face doesn’t help either.

Sanemi does NOT need you to hold him so he can sleep properly and have nice dreams if you act that way!

“Scoot over, I wanna lay down. I don’t need your damn cuddles anymore. You’re just making fun of me, damnit!!”

Kyojuro Rengoku

In the mornings…

Kyojuro’s hair is incredibly messy everytime he wakes up. You can’t resist but to brush through it a couple of times while your husband slept, enjoying the moment of quiet intimacy.

His voice would be raspy and quieter in the mornings in comparison to throughout the day, his smiles smaller and sleepier, yet just as happy and real as usual. Kyojuro would be sleepy in the mornings but would start regaining his energy after having a nutritious breakfast. Usually, he’d make them himself.

Kyojuro would stand by the stove, dressed in either just his nightwear pants or a loose fitting robe. His movements are sluggish and slow, but he still never burnt himself on accident. Sometimes, you would even lean against his muscular back and complain about the tasks ahead of you while Kyojuro quietly listens and cooks breakfast.

“Mh, would you… *yawn*… mind handing me the eggs from over there?”

In the evenings…

Kyojuro still manages to muster up enough energy to keep his vibrant and loud personality, even right before bed. He’s incredibly tired and needs to recharge the whole night to have another successful day of training and slaying demons. The best way to recharge is by holding you close to his chest, letting your head rest on his soft pecks.

Slowly, Kyojuro would start to slip into a sleepier state. His eyes would be droopy and his smile more lovesick while his hand slowly brush over your features. You’re so perfect, do you know that? Sometimes, he might squeeze you a little too hard on accident. It something similar to cuteness aggression, just much more subconscious and softer.

Kyojuro would fall asleep with your imagine in mind and a sleepy smile on his face, his arms wrapped tightly around you, making sure you’re comfortable in his warm arms.

“Hm? Oh, sorry… did I hold you too tightly? Apologies, my love. I missed you the whole day and… forgive me?”

Gyomei Himejima

In the mornings…

Gyomei usually wakes up quite early to go pray, but you keep him in bed for a little longer. You get woken up by the weight on the bed shifting and mumble his name, gently grabbing his forearm and pulling him back onto the bed. He cannot help but obey your wish and lay back down with you. Gyomei is still tired when you pull his head against your chest, wrapping your arms around his broad shoulders.

Tears start falling down his cheeks and onto your shirt as you run your fingers through his messy, short hair. A small smile rested on his face.

His voice is incredibly deep and his chest vibrates against yours as he murmurs quiet prayers to finish his morning routine. Gyomei doesn’t get sleepy very often, but when he does, it’s only in your arms and by your touch.

“You’re a blessing, my pearl…”

In the evenings…

After his endurance training, slaying demons and attending an hashira meeting, even Gyomei gets tired. He would lay right beside you, resting his head on your stomach. His eyes would be closed and arms wrapped around your waist and plush thighs, rubbing gently up and down, feeling your warm skin and stretch marks.

Gyomei would place gentle kisses on your skin and savour your scent. You are absolutely beautiful to him, he doesn’t even need his eyes to see that. While you massage his scalp with your fingers, it feels like the exhaustion is finally catching up to him. With a final sigh, Gyomei finally slipped into something similar to a comatose. Once asleep, only the sound of the cries of a crow can wake him up.

“My love, may I rest with you a little longer? I still haven’t recovered from my last training session… you have a healing effect on me.”

Giyu Tomioka

In the mornings…

He is comparable to a disoriented, deflated balloon. Not that Giyu is bouncing and being happy during the day, it’s just that he’s even more depressed in the mornings. But, on the bright side, Giyu is able to handle your affections better while sleepy. Normally, he’d stiffen up and shortcircuit. But while he’s being tired, you can cup his cheeks and kiss him all over, he’ll just respond with a small whine or groan.

Giyu might become a cuddlebug when you two are in bed and have nothing to do. He’d bury his face in your neck and savour your warmth while he can. Sometimes, he’d bury his face in your even warmer cleavage, falling right back into sleep.

“Mhhrrm… hmm? What did you say?… mhh… didn’t hear..”

In the evenings…

Believe it or not, he becomes even quieter in the evenings. Giyu will silently stare at you, begging at you to just hold him and cradle him to sleep with his eyes. He’d hover around you with eyebags under his eyes, always standing near you until you offer to cuddle him.

His eyebags, glossy eyes and messy hair look him look like a lost puppy, so it was a matter of time until you offered to cuddle in bed. Your soft skin under his calloused hands never felt any nicer.

Giyu would be out in a matter of minutes and fall asleep in an awkward position. One arm would be wrapped around your waist while the other was angled on his side.

“Agh, my shoulder hurts. Did I fall asleep in a weird way?”

💠

I thought of this last night. I have another similar idea about sleepy hairplay and I’m thinking about either writing that idea for the Upper Moons or the hashira, either way, thank you for reading! As mentioned before, I’ll post some asks on the weekend <3

Anyways, make sure to EAT, SLEEP and DRINK enough!

Take care of yourselves <3

[be-good-to-bugs]

circles r cool :D

[thedeadthree]

i would like to know more about karolinas surefire way of wooing pls allegra 👁

HII AJ BELOVED <3 you dear you! i hope ur doing well and having the loveliest day! you deserve it!!!!! karolina's ideal dynamic between her and her partners in any and all of her verses taunting and being insufferably smug is her love language aksjkmx shows veeery much here <3 and i just think they're lovely! here's the full version for u! <3

WIP TITLE ASK GAME 🖊

“So… Simon. Your mission is... finished. You can go home and do what it is that Simon Riley’s do on a Wednesday night.” 

He drags out a long sigh. She continues. 

“Maybe when this all blows over you and i can have a vacation perhaps… I’m thinking France. You’ll be paying of course.” 

“Do you think I’m made of money Pajari? I’m not the idiots you con.” He deadpans.

“So you’re taking me up on my offer?” Karolina remarks, grinning.

“No.” 

“Fair play fair play. And by the way I never said you were made of money dear, though you would make a handsome dollar. You’re a lieutenant in the 141. Though a more than decent paycheck, but that’s not what i wish to discuss. Captain Price and Laswell are my babysitters, not you. You’re free to go yet here you are… still here with little old me.” 

She taps her index finger to her chin, “Interesting. Don’t you think?” 

Her hands are bound but she’s maneuvered herself to a position in the vehicle to where she can rest her elbows on the window. Her Midnight hair reached to a point or two past the middle of her back, draped in a way that if she wasn’t bound you would think was strategic. Not that he has noticed.

“You must really enjoy my company huh?”

“I don’t. We’re not done. We have your friends and friends of your friends to take care of. And then after them, there’s you.”

Karolina could be focusing on gazing at the pretty scenery on the ride to the location.

She would rather bother him on this peaceful occasion. Lovely.

And she’s testing his patience.

Her infuriating perpetually smug gaze finds his again, “from the way i see it, and in the words of your countrymen, i think you fancy me Simon.”

“No I don’t.”

“Sure.”

And she would be right. Which surprises himself even.

It's infuriating.

[hellsitegenetics]

hello!

i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).

i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.

my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.

bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.

okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt

Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)

[mochinomnoms]

How would ptm jade react if Yuu told him about marine mushrooms?

I only know what wikipedia knows about marine mushrooms...unfortunately for yuu mind reading doesn't give them sudden infinite knowledge!

“You know, with as much as you...like mushrooms and stuff, I'm surprised you haven't mentioned anything about marine fungi.”

You felt a chill run down your spine and Jade's bi-colored eyes on you.

“Pardon?” Does my darling also love fungi? How could I have not known this?

You shifted in your seat, staring down at your notebook as you doodles between the margins. A small button mushroom that you'd absentmindedly drawn minded you of Jade.

And you just happened to be doing research with him for your group project in the library this day.

“Sorry, I just was thinking about it, and it's just surprising to me that you never had, like an aquarium type terrarium or something with them.”

You let out a nervous laugh, after all, it was just you two by yourselves. Riddle and Yev were busy with their dorms due to the Spelldrive Tournament, and your dorm still didn't technically qualify, since all your freshmen were officially in other dorms.

Such a wonderful laugh, I'd like to hear it more...

“Well, to my knowledge, they don't exist.” Jade leaned in, his eyes wide and full of excitement. “By chance, do such mushrooms exist in your world?”

Please tell me more! Tell me lies for all I care, so I may hear your voice...though you wouldn't lie about such things, would you?

You perked up. It was rare that you knew something Jade, or anyone at NRC, had no clue about. It probably wasn't intentional, but the way people would look at you when you had no clue about something make you feel dumb, even though you logically had no way of knowing even the most basic things of this world.

It was kinda nice to be the one to share knowledge with another person.

“Well, I don't know a lot, but they mostly exist in marine environments. I think a few hundred?” You leaned in closer, moving your notebook towards Jade as you started drawing again.

“I can't remember their names very well, but I've always been a more visual person anyways.” You drew a piece of driftwood, a snail, and a rock covered in lichen.

“This one grows in mangroves, usually on the places. But this one grows around the shell of a snail, who eats it. And sometimes lichen will grow with fungi, but I don't know a whole lot about them.”

You paused, pursing your lips in disappointment.

“Sorry, I don't know enough to tell you about them, I know how much you...”

Your words trailed off as you looked back up at Jade, who was resting his check against his palm. He was staring at you with faint smile, and soft, half lidded eyes and pink cheeks.

So beautiful...

Cheeks and chest going hot, you stared back, opening and closing your mouth as you tried to figure out how to respond.

“Uh, Jade, you're, uh, staring...”

Jade stiffened, straightening up and covering his mouth in embarrassment.

“My apologies. I was just....enraptured by your descriptions.” And you. “I don't mind that you aren't familiar, but I would like to heard more from you about marine fungi. Perhaps you can tell me all about your world's plant life? It never occurred to me that your world would evolve differently, but saying that now, it seems obvious.”

He smiled at you again, his teeth showing a bit more as he excitedly leaned in.

“You struggle in musicology, yes? Perhaps in exchange for your knowledge, I can help you with practice?”

Please say yes!

You paused. Various suggestive scenarios that seem more apt for a risqué site or story flashed through Jade's mind in giddy anticipation.

You know better. You know what Jade's hoping for. You shouldn't string him along, you're going to get embarrassed. You're going to get uncomfortable, you're...

Another daydream, one of you two curled over a book, as you leaned into Jade's side while his arm pulled you closer, invaded your mind like a parasite in your brain. He had a tender smile as you laughed at something he said, your free hand reached up to cradle his cheek.

Maybe parasite is a harsh word. When the thoughts Jade had were so sweet and soft, it almost made you want to give in.

Almost.

“It's okay, I'm just a choir member, so there's not much for me to improve on.” You could hear your more logical voice sigh in the back of your mind. “But I'm happy to share...if you help me figure out if the mushrooms growing behind Ramshackle are edible.”

I'm weak…

Jade blinked, processing what you said.

Really? “Really?” Even Jade seemed like he was anticipating your rejection.

“Yeah, why not.” You shrugged, Jade's internal excitement flooding into your subconscious and influencing your own emotions. “Means less money to spend on food, and I'm sure you know plenty of yummy recipes we can use if they do end up good!”

Jade rarely smiled, at least not genuine, bare-teethed smiles. Despite the sharpness of them, you weren't put off by them, or him, at all.

“I would be honored.”

[charliedakotariley]

Self insert here but imagine....

Jason having an artist partner, or a partner that LOVES to hord tiny decorations in their apartment/house.

They go out, sees a tiny mini figure of a bumble bee, buys it, takes it home and dedicates a whole ass shelf to it. Makes it a tiny house, a tiny garden and a general beautiful scenery.

Now imagine Jason, the buffed and huge mountain of a man, scary and violent, known to shaken everybody who meets him, ripped muscles and rough hands- and he's croutching to the level of the shelf, seeing the tiny Bumblebee with wonder and adoration in his eyes like a small kid in a Disneyland and softly asks "Does this cutie have a name?" and "If he could take it into his hands?"

The figure is as big as his pinky nail and he's holding it like it's alive, fragile and soft. He cooes at it, asking it how it's doing and what is it growing in its tiny garden.

After a while when he's putting it back he asks "Do you have more?" and his partner says "They're all over the place, you can try and find them all."

And DUDE- the way his eyes sparkles, a huge smile forming on his face, clapping his hands and doing this skippy jump while he runs around searching for those tiny creatures and their homes.

He finds a snail reading a book inside its shell above the fridge, a moth holding a caterpillar baby in a rocking chair in one of the cabinets, tiny kittens cuddling in a cozy bed behind a curtain, and a family of bats hanging from the ceiling holding wings in a book nook.

And he's tearing up. A tiny creatures having a praceful cozy lives without any trouble, nobody's hurting them, they need no savior, no one who would come late to their rescue, no shed tears and blood-

He gently puts the lastest figure back with a teary eyes, petting its head while turning and going back to your shared bedroom, stopping in a doorframe and looking at his partner who looks up and says something that has him bawling his eyes out...

"And you found the last one, Jaybird. Come here, to me, to our tiny peaceful home."

Thoughts?

I apologize for any mistakes, Grammarly isn't working-

[inf3ct3dd]

ellie headcanons ..!

warnings : literally none, perfectly sfw 😍😍

content: loser!ellie x reader, more ellie-focused than relationship focused (sorryyyy 😞😞)

authors note: i’ve literally never done headcanons omg 😓 this is js my random ramblings 🔥🔥🔥

pt. 2 ! taglist!!!! masterlist!!

- send you an excessive amount of reels. every 5 seconds. cute cats, random facts about space, stuff she thinks is funny, it all goes to you.

- definitely had a “rock collection” when she was little, but she was so ???? excessive with it??? like every time she saw a rock she picked it up. she walked so weird bc her pockets were just FULL OF ROCKS.

- also, was literally the grimiest kid ever. playing in ROLLING IN the mud, going snail hunting when it rained!!! she was the kid that would go in the bushes and mess w rolly pollies all the time for NO REASON.

- is weirdly good at fishing?? joel took her all the time, and shes a self proclaimed “fishing master”

- WAYYY clumsy. always running into a wall, tripping on air, or missing steps on the stairs (smh its cuz of that damn phone 😒😒)

- im so into the whole “adam sandler” fits cuz its so true. esp during the summer, its some stupid t shirt that says “master baiter” and a pair of old basketball shorts.

- speaking of t shirts, she’s def the type to own an absurd amount of dumb t shirts.

- gets all her clothes from like, walmart and goodwill. she does not CARE!!!

- cuts her own hair too 🤞🏽🤞🏽 shes soooo self sufficient 😍😍😍

- bites. she is such a biter.

- speaking of, i feel like she js has to have something in her mouth constantly. gum, random pieces of plastic, bottle caps, pens, anything 😞

- speaking of mouths (wow sierra so many connections!!!) she def had braces , but she hates wearing her retainer so her teeth are like ever-so-slightly fucked up

- is AMAZING at committing to the bit. she will drag it for DAYSSS if you don’t tell her to stop. once did a (awful) british accent for 4 days until you threw something at her and told her to shut the fuck up

- definitely not shy, just kind of…odd. she’ll talk to anyone that talks to her, she just doesn’t really approach people.

- weird obsession with pickles. has a pickle stuffed animal with a mustache and glasses that she bought from goodwill

- hangs up so much stuff on her walls!!!! tickets, old notes, cards, pictures of people, drawings, old tickets, literally anything she thinks looks cool

- obsessed with rollercoasters!!! she took you to the fair for your first date

- also like- very good at fair games. she’s so cocky about it too, you’ll go home with like 20 stuffed animals she won for you and she’ll carry ALL OF THEM with the stupidest smile on her face

- wears all of joels old contractor-workwear clothes during the colder months

- trys so hard to be “mysterious” but she’s never actually doing anything so she just does stuff like not telling you what movie she’s watching or what she’s eating

- also just texts you 24-7!!! like every time she’s doing something she’s like “i made a quesadilla” “i went to the store” “i took a shower” she just looooves keeping you updated

- tries to raise one eyebrow but ends up just squinting one eye. so funny 😞😞

- really good at solving rubix cubes???

- definitely had a fuck ass bob at one point

- GLASSES. that is all. glasses.

- listens to so much dad rock, midwest emo, indie, she LOVES male manipulator music!! but like she isn’t like thatttt shes so niceeee 😞😞

- mostly calls you babe/baby, she’ll call you really dumb pet names as a joke like “pookie” 😭😭

[herpsandbirds]

Hey, what are the best-named snakes? Also, this blog is incredible

Best Named Snakes:

Ok, so using different criteria for different names, here are some of the best off the top of my head...

Clouded Snail Sucker (Sibon nebulatus), family Colubridae, Chiapas, Mexico

photograph by Cristian Torica

Terrestrial Snail Sucker (Tropidodipsas sartorii), family Colubridae, Guatemala

Coral snake mimic (specifically, mimics Micrurus elegans).

photograph by Cristian Torica

Bandy-Bandy (Vermicella annulata), givin’ em the old razzle dazzle, family Elapidae, found throughout eastern and northern Australia

Venomous.

photograph by @nicvlattas

Black-headed Centipede-Eater (Aparallactus capensis) EAT A TASTY CENTIPEDE!!!, family Atractaspididae, South Africa

Venomous.

Photograph by Johan Marais

Sunbeam Snake (Xenopeltis unicolor), family Xenopeltidae, Thailand

photograph by Parinya Herp Pawangkhanant

DOES ANYONE ELSE HAVE ANY GREAT SNAKE NAMES THEY'D LIKE TO ADD?

[snailmail444]

Can I get a headcanon of the bachelors and how they'd be sexy with you when you're down? Like, if they're trying to cheer you up and be a little goofy with it but also tryna HIT. THAT. 🤣🤣🤣

Thanks Snail, ILU.

Bachelors Goofing Their way Into Your Pants

18+ 🌱 MDNI 🌱 NSFW (-ish)

This one was a tough ask Libby but I’ll do nothing if not stand and deliver 🫡 Honestly might be my favorite head cannon list for the bachelors I’ve ever done so THANK YOU for this prompt icon. NSFW? -ish under the cut (lewd?? Idk lol)

Harvey-

💚 Perhaps the goofiest about this

💚 He would not try to come onto you when you’re down unless he KNOWS it’s going to pick you up

💚 So once he’s confident let’s start there

💚 It’s a song and dance

💚 Dissappears, and when he’s back he’s got his med kit

💚 He gets out the stethoscope and all. The whole nine yards.

💚 That’s right folks. We’re paging Dr. Love

💚 Will NOT let you stop this routine. Dr. Love WILL be completing the full assessment. Listening to your heart rate, checking your throat and ears, somehow always having to complete a chest exam

💚 (M or F he will be groping your tits for this one)

💚 The diagnosis is in

💚 There’s Only One Cure for What Ails You

💚 You guessed it! You need a little lovin’ (Dr. Love’s catchphrase)

💚 Important note: Dr. Love is not a licensed medical practitioner

💚 This works a little too well perhaps. He’s so confident for no reason at all LMAO

💚 Lowkey want to write a Dr. Love oneshot now because this is really fun and cute

Elliott-

❤️ If you’re feeling down man will preform the absolute worst ad lib poetry

❤️ Silliest lymrics you’ve ever heard

❤️ Dumb dumb dummmmmb

❤️ Very dirty and stupid bad poems about you

❤️ Specifically about his favorite parts of your body

❤️ Or his favorite things you do during sex

❤️ The worse it is, the better as far as he is concerned

❤️ Raunchy dirty filthy

❤️ But like. In the most grade school mother goose style he can manage

❤️ No flowery language here

❤️ Takes off your clothes to expose the parts of you the he’s referring to

❤️ When you do x thing (then tries to make you do x thing)

❤️ Will be proving his point. Period!!!

Alex-

🤎 Physical touch legend

🤎 Wrestles

🤎 Winner gets whatever they want from the loser

🤎 Has a wrestling name and all

🤎 Does the John Cena theme

🤎 His hands end up in all sorts of places that they don’t need to be

🤎 Most wrestlers aren’t grabbing ass 🤨

🤎 Gets you in some really tight, close pins, but somehow you end up winning anyway

🤎 No I didn’t let you win don’t be ridiculous I respect the sport too much to ever—

🤎 He let you win

🤎 You can take your prize now 😌 Whatever you want 😌

🤎 And if his hard on is pressing against you? Well. Maybe he has some ideas about what your prize should be

Shane-

💙 Gets you through the hard stuff first, so once you’re on the mend he’s goofing to the max

💙 KING FLEXER!

💙 Aw babe come on? How can you be so sad when you have these guns to look at?

💙 Runs through a series of absurd poses to show off his muscly farm boy arms

💙 Lays it on really thick about being a stud

💙 “No matter what at the end of the day you have a trophy husband” (even if he’s not married to you. ESPECIALLY if he’s not married to you)

💙 STRIP! TEASE!!

💙 Showing off everything you’re so lucky to have with a big goofy grin on his face

💙 Throwing his clothes across the room and everything

💙 Making the music sounds with his mouth

💙 You HAVE to whistle or hoot at him or clap or something

💙 He demands applause from his audience if he’s not getting some singles at least

Sam-

🩷 Another song and dancer

🩷 This man was born for the stage I fear

🩷 Genuinely and truly putting on a SHOW about it all

🩷 The drama of it. Uh oh, he’s compromised!

🩷 Will end up ‘stuck’ under the couch or table or anywhere else

🩷 Uh oh! I hope nobody takes advantage of me 👀 When I’m so exposed 👀👀 and vulnerable 👀👀👀

🩷 The worst stage acting you’ve ever seen in your life

🩷 Starts stripping in the middle of the living room because he “didn’t see you there!”

🩷 Pretends to be scandalized when you finally succumb to his advances

🩷 What are you doing?! Huh? What do you MEAN I was coming on to you? I always take off all my clothes in the kitchen, that’s ritual

🩷 insists he’s been objectified and taken advantage of

🩷 That kind of turns him on though let’s be so fucking real

Sebastian-

🖤 Okay so we’re going blunt king here

🖤 Two possible options

🖤 Uses it as a way to hard reset the system mid breakdown

🖤 Full crying, upset, whatever, he’s been holding you and trying to calm you down but it’s not working

🖤 “Wanna have sex?”

🖤 DEADPANNNNNN delivery

🖤 It never fails. Tried and true

🖤 Option two?

🖤 This is ONLY if mans is super comfortable in your dynamic

🖤 A classic

🖤 Whips it out

🖤 Thinking about that one tweet of the boyfriend who was in the mood and just put his dick on her shoulder while she was watching tv

🖤 Like that but buried under sixteen levels of irony

🖤 “I know what’ll help” and then he pulls his dick out

🖤 Probably the least likely to actually hit with these methods

🖤 However, he’s maybe the most likely to help improve your mood substantially

🖤 Through sheer presentation if nothing else. Man can deliver, and knows when to hit with the absurd to make it the most impactful

[nebulanovella]

Caregiver Wade and regressor Logan headcanons

Wade is more soft-spoken when he's in caregiver mode, he's just as (if not more) affectionate and extremely patient

Logan usually regresses to a younger age. He bounces around the range of 8 to 2

Wade barely ever calls Logan by his actual name when he's regressed. He usually calls him a nickname, like peanut, wolvie, honey, sugar, sweety, etc.

He normally only ever uses his real name as a warning

The younger Logan is, the chattier he gets

Whenever Logan is babbling away, Wade will pretend to have conversations with him by responding with "uh-huh, is that so?", "tell me more", "*overly dramatic gasp* no way!"

Logan finds Wade's theatrics hysterical

Dad jokes

Wade is a very attentive caregiver, he'll know what Logan wants even before he does

He always makes sure that Logan is within sight and vice versa as Logan gets upset if he thinks or notices Wade is gone

Logan regresses as a response to his past trauma, and he has a lot of negative triggers

Wade tries to praise Logan at every opportunity, giving him lots of encouragement, just to see his smile (it's small but he loves it nevertheless)

Wade always has Logan's favorite snacks fully stocked and keeps a list of all his likes and dislikes on hand

Logan plays with Wade by having him pick out and hold his blocks when he builds something or by having him help dress up his dolls and brush his stuffed animals

He generally prefers to play with only a few of his toys (blocks, dolls, plushies, play dough) despite having a large collection, courtesy of Wade

Logan loves hugs but is often too shy to seek them out

Wade is all about making fun looking food like celery snails, octopus hotdogs, and bear pancakes

Airplane or train noises are a must whenever Logan doesn't insist on feeding himself

Logan likes reading his books to Wade and every so often they'll have a little 'book club' where they read to each other

Wade hangs every drawing Logan makes on the fridge and when he takes them down he keeps them in a folder in his nightstand that he looks at whenever he needs a boost of happiness

[fanaticsnail]

Snail, mad props, I love all your writting but your Hey Doc series hits me in all the right spots! So fun and cute!

I've been thinking, Doc's in a pirate crew.. Does Doc know how to fight? Because here's a fun scenario that has been on my mind...

Doc is buying/gathering ingredients and gets attacked by thugs or other crew. Doc puts up one HELL of a fight but gets beaten up pretty badly 😩

Upon returning to the ship, Doc tries to hide away and lick the wounds, acting like nothing happen.

So who do you think would come barging in Doc's office yelling "Who the fuck this that to you?" Daddy Killer? Or the Captain himself?

If you feel like writing a little drabble to go with this I would die! 🫶🏻🫣🥹

Love! ❤️

Hello my darling. I hope you enjoy this interpretation of your request. This is how I saw it playing out in my head. Thank you so much for your beautiful contribution to the story!

What do I do, Doc?

Hey Doc Masterlist

Word count: 2,900

Synopsis: Dressing as a civilian on the usual supply run with Wire does not go according to plan. Your past finally catches up to you, and your crew scrambles to come up with a way to treat you from your injury.

Themes: kid pirates x gn!reader, platonic kisses, hurt, injury, graphic pain, impaling (reader receiving), Wire/Heat/Killer/Kid x reader, partial Bubblegum x reader, angst, fluff, delirious Doc, poison. You are "Doc", the doctor of the Kid Pirates. Pet names used: hon, honey, sweetheart, baby for Doc.

Notes: I have been feeling some sort of way for a while, and this request was singing me their siren song. I also wanted this in a fic pretty bad, and I wanted to make it sadder.

“Hey Doc,” the soft growl in Wire’s tone had an edge to it, a warning felt in his dangerous aura, “You gotta stay awake. We're nearly there, hon. Stay with me.”

The grogginess you felt masked the pain from the spear protruding from your thigh. Your life escence pooled from the wound, the stain dripping down your leg and onto Wire’s stomach as he cradled you into his chest. Each slow blink grew heavier and heavier, the frequency between them coming closer as unconsciousness called to you.

“Doc! Hey, Doc!” Wire jolted you in his arms, forcing your eyes open in shock to his ferocity, “Doc, I need you. Stay awake, damn it!” You offer him a fluttery smile, your lashes batting up at him as his expression contorted in fear.

“Keep-... Keep the pressure on it,” you managed to stutter, your teeth chattering through each syllable as you spoke. “Don't take it-... Don't take it out. Leave it in u-until the bleeding stop-...” Eyes rolling back into your skull, you never finished your instructions to the larger commander. He cursed beneath his breath, sprinting towards the Victoria Punk where the remainder of the crew were waiting for you.

This was not your fault, nor was it Wire’s. You both thought yourselves to be safe: both dressed in loose civilian attire away from your usual garb. Compliments were given to both you and your older commander, praise that would make even the most hardened pirate blush.

You were both seeming to be the least conspicuous and recognisable of the amassment of crew. Your reputations and bounties were both high, but away from your regular clothes, your vacant and stripped-back appearance was the perfect disguise.

Unfortunately, this base had someone you thought had long since forgotten your face. A person from a past you attempted to keep hidden, trapped beneath lock and key in the chest kept in your mind's eye. The spear came out of nowhere, impaling you against the floor and successfully rendering you immobile.

While pinned stationary, the only warning you gave was a choked gasp, Wire turned and immediately sprung into action. Trident aimed back in arms, his motions struck true: claiming the life of the attacker immediately. Usually one to extend the pain, Wire’s instinct to protect came before anything else.

“Doc,” his whisper hissed through his teeth, “Honey, what was that? Who was that?” You were struck in shock, looking down to the spear leaving a welt in the ground; a familiar engraving on the wood having your eyes scrunch tightly shut.

“Wire, just-,” you started, halting when Wire dropped to his knees and hovered his hands over the spear.

“-Doc, you know how to fight. What the fuck is this?” he pointed to the spear, the pain of the sting leaving you and dulling the longer you remained stationary. “Explain, now.”

You sigh, lip beginning to tremble as his eyes finally gaze up to join with yours. Noticing the quiver in your lip, the pooling in your eyes, his demeanor immediately changed.

“Oh, honey,” he gasped, rising to a soft crouch and cradling your cheeks in his palms. A small tear managed to spill from your waterline and trickle down your cheek. “Talk me through what to do. Tell me how to help you.” Closing your eyes, you lean into his touch and take a moment to calm yourself within his palms.

“Break the spearhead at the neck,” you informed him, “And keep the fucking thing in until I get back to the sh-...” You fell forward, your forhead brushing with the commander in front of you as your eyelids drooped.

“...Fucking coward,” you huffed out a soft laugh, floating your eyes to the injury. Gazing down at the spear, you nod against Wire's head with a sarcastic smile on your face.

“Poisoned. They used the poisoned one.”

Finally reaching the ship, your mission long since forgotten, Wire used his great height to his advantage in propelling himself along the top deck. Several crew members attempted to stop him, Bubblegum immediately shrieking and running before Wire to open every door towards your office.

The captain and the lingering two commanders trailed behind Wire, Killer halting as he bore his eyes down at the ground. A trail of bright red spattered over the deck, his piercing blue orbs glaring at it as his lips curled back. Clicking his fingers, he gestured to the nearest crewmember and gestured to the closest mop and bucket before trailing behind Heat and Captain Kid.

Once below deck, Wire set you down on your medical bay and immediately began readying gauze to replace the linen satchel you used to make a basic pressure aid. You mentioned about not making a tourniquet, nothing to aggravate the complications of the wound. Heat was immediately through the doors next, the Fire-Breather gazing through hollowed eyes at the injury first before running immediately to your desk.

“What,” a rumbling growl barked, “the fuck,” your captain ducked beneath the threshold of your office door, “happened?” Wire couldn't speak, his own manic state prohibiting him from thinking anything other than cutting away your pants with your scissors and placing the scraps in a damp pile beside you. Nothing was to pull him away from his task, keeping pressure on the wound while he cleaned you up best hr could.

“Wire,” Captain Kid roared, a jolt felt deep within his chest as he fell away from his transfixed attention. Turning to Kid, Wire managed to bark back at the captain.

“We were recognised,” he called over his shoulder, “Someone knew Doc.” He peeled away the final fabric, your doll-like state limply moving with each push and pull from the taller man.

Eyelids fluttering, slipping between consciousness and slumber, you peeled your eyes open enough to gaze at Killer as he entered the room. Offering him a weak smile, you attempted to move your lips to speak. Killer raised his hand to hush you, wordlessly telling you to save your strength for something more intentional than a greeting.

“The fuck recognised Doc?” Kid growled, “Doc's been with us for ages, changed their look and everything from that stuffy shit they wore before.” Kid bullied his way to Wire's side, shoving his hands away from the spear and assuring his one good hand be weighty enough to force the wound shut.

“I know as much about it as you, Cap,” Wire stuttered, his panic tangible in his shaken hands. “One of the first things Doc said about it was they were cowards for using poison.”

“Fuck,” Heat finally added, carding through his lengthy pale hair as he searched through the medical and personal journals in your desk for any information. Finally stumbling across a filagree design on one of the pages, he shook his head and clapped the book shut. “There's nothing in here. I don't know what to do. Doc just writes about weaponry in the journal, but nothing about poison.”

“What do I have to do about the spear? What does it say, Heat?” Wire yelled at the scarred commander, his Glasgow smile grimacing at the tone. Looking back to the desk at the open pages, Heat shakes his head and looks back at Kid.

“Doc needs a surgeon,” he uttered darkly, placing the journal back on the desk beside him, “Closest one is the marine base, next up is Trafalgar. Make a choice.”

The captain never tore his eyes away from your thigh, his deep frown growing in size the longer he lingered on the thought. The marines wouldn't help, they'd likely kill you and anyone else that entered on behalf of you. Trafalgar was days away, and there was no way wyou could make it. He didn't know how to treat this injury himself, that's what he had you for.

Considering there was poison in your leg, likely spreading to your blood at this point, he clamped his eyes shut and finally looked up to your face. Eyes open and glazed, you offered him a soft smile.

“What do I do, Doc?” he drew his metal hand up to caress your cheek, “What do I do?” You dart your eyes between his while slowly blinking in your daze.

“Under my bed,” you whispered, your vocal fry straining as the pain lingered, “Antidote.”

Killer was already out the door as soon as you stated ‘under your bed,’ refusing to daudle as you lay there bleeding out. Kid nodded to you, the cool of the metal palm soothing your scorching flesh. Beads of sweat flooded your skin, your hair sticking to your forehead as you bit back the ache.

“And the fucking spear?” Kid laughed down at you, “What you wanna do about that?” You snickered weakly, trying to best phrase how to proceed next.

Ideally, you would want to: remove the object, clean and sterilize the area, remove any necrotic flesh, provide antiseptic, antiinflamitries and suture it back up. Unfortunately, none of the crew were you; and you were in no position to do it yourself. Before you even had a moment to speak, Heat was at your side, pushing past Wire and glaring up at your captain.

You lazily lolled your eyes to the side of the desk, noticing the page Heat opened and let out a preemptive whimper in preparation. Heat looked down at you, watching your brows raise in a triangular peak in the center of your forehead as you nod to him.

“Antidote,” you hissed out, gulping while closing your eyes tightly shut, “And rum.” Heat nodded, immediately walking to your desk and almost instinctively pulling the leaver to reveal your secret stash of rum. Kid gasped out a laugh, smiling playfully down at you.

“Little shit,” he affectionately chastised you, “Where the fuck was that when I asked for it last week?” You choked through a soft laugh in response while biting back the pain.

“In my fuckin’ desk, hiding from you.” He laughed at you before his lips curled into a soft pout. Leaning forward, he kept the pressure against your wound as he pressed his forehead against your own. Clamping his eyes shut and grinding his teeth, he shared your breath with you in a bid to draw you closer.

“When you live through this, Doc,” Kid hissed before nuzzling his head against yours, “I'll-.”

“-Kill me?” you chirp playfully up at him, prompting him to open his eyes and glare down at you. The pain was in every follicle of your face, even in the radiance of that grin you wore so much.

“No, Sunshine,” he whispered, no humour in his tone aside from his melancholy smile, “No.” He learnt up, pressing his painted lips against your forehead while inhaling a sharp breath through his pointed nose. “I'll give you that raise you've been asking for. I swear to you, Sunshine.”

Pulling away from your face, he gazed down at you with hardened resolve and absolute unwavering compassion. Darting your eyes between his two, you lazily draw back your lips to a lazy smile.

“You know, Cap,” you utter whimsically, “From a distance, your eyes look almost orange.” Reaching up your hand, you gently take his cheek in your palm. Your weak grasp feels foreign on his hands, your usual steely demeanor slipping away, “But up close?” you whisper intimately, his breath catching in his throat, “You've got a band of gold in the middle.”

Kid attempted to keep his composure, staying strong in front of his commanders, and you, as you speak in nonsense. Your eyes held this foreign affection that he had yet to truly witness. Every part of your usual abrasive attitude diminished, your soul raw in your expression as you stared up at your captain.

“D-Doc-...” he gasped, Wire watching the interaction between the two of you and choking on his breath. Heat's eyes never left your face, waiting for the exact moment you give him that nod of approval to inact your unspoken agreement.

Stampeding through the threshold of the door tumbled Killer, each movement intentional and deliberate while weighty and desperate. Shoulders arched and chest puffed, he slid to your side and uncorked a vial of viscous liquid.

“Here you go, baby,” he leaned forward, taking your neck beneath his hands and cradling you up to steady you, “Easy does it now.” The vial ridge was placed at your lip, your eyes not leaving your captain's as you swallowed the contents of the vial. Barely tasting the liquid, the vial was replaced by the lip of a rum bottle to numb the pain and drown the pain you were about to endure.

As soon as the amber liquid hit your chest and trickled down your throat, Heat removed the spear from your thigh with his larger hands. A spurt of liquid pooled in your Captain's palm the moment he did as such, the scream you let up caught in the rum bottle. Killer leaned forward, placing his helmet covered lips against your temple and holding you against him. In your panicked state, you barely registed the next phase to Heat's agreement.

Slapping the captain's wrist away from your thigh, Heat placed his lips over your wound. Engulfing the area completely, Heat ignited his gullet and immediately seared the wound shut with the intensity of his flaming breath.

The sizzle of flesh lingered in the air, the scent of caurterizing skin and burnt hair tainting the burn of liquor in your throat. Your screams were stifled in your mouth as you grit your teeth, the widening of your eyes and glaring at that golden band within your captain's eyes.

He had no choice but to look down at you as Heat scorched your flesh. Heat's lips pressed a heart-shaped mark into your skin, the guilt of marking you with his ability ate at him from the moment he read the passage on cleaning and sealing wounds. Manuevering your thigh with ease, he released the topside of your skin and immediately pressed his lips to the underside of your leg.

Another roar of flickered flame ignited in his chest, this time your back arched and head lulled in Killer’s arms. Your vision went white, the lingering ache of pain and swell of poison leaving you as you fell into unconciousness. Four voices painted the air with their plea, your ears ringing with their unique cadence.

“Doc, I know it hurts. Forgive me, please.”

“I should've protected you, Honey.”

“Baby, hold on. Just hold on a minute longer.”

“...Don't. Don't, Sunshine. Stay with me now.”

Hours slipped into days before you managed to rise from your slumber. That first taste of air expanded your lungs felt fresher, cleaner, than what you felt in years. The weight of your past had managed to catch up with you, the cost being higher than the one you were ready to pay with such hastiness.

As you looked to your bedside, the signature purple jagged locks of your sensitive crewmate lay unravelled beside you. Bubblegum’s face burried itself against the plush duvet, both his hands lay cradling your own as you roused with a sucked gasp.

Where were the commanders? Where was the captain? Why are these bedsheets so comfortable? Questions you would not be plagued with for much longer.

Door sliding open, the towering figure of Wire entered your chambers and slipped to your side. His eyes met with yours just as his breath caught in his throat. His great strides close the distance between you as he kneels by your head. Forehead first brushing with your mattress, he slowly and silently raises his gaze up at you through his eyelashes. Rounded eyes: wide, guilty, and pleading at you.

Before he had a chance to utter his confession and explain his emotion verbally, you silenced him with a look.

“I'm so sorry, Wire,” you whisper beneath your breath in an attempt to not wake Bubblegum. “I hesitated. I should've reacted faster-.”

“No, honey. No,” he whispered, shaking his head and rising to stoop over your bed. “You don't owe me anything you're not willing to give. It's not my place to reveal you, just as it's not yours to interrogate me.” You sigh out, a flood of emotion washing your heart in waves. Each passing wave has Wire lean forward, his lips casting over your forehead and holding you firmly beneath his kiss.

“We love you, Doc,” he whispered softly, “Doesn't matter who you were, only who you are now.” You scrunch your eyes shut as you bite-back your emotion. The wound, the familiar unfriendly face, the sting of poison still flooding through your veins, everything spilled over the rim of your emotions. Each moment replayed in echoes, Wires arms and desperation reminding you of his compassion.

“I'm ready,” you whisper, feeling him peel away his lips from your head. He searches your eyes for meaning, your own orbs darting between his.

“But first,” you added, your smile returning to your lips as you teased him with it, “Send me Heat. He's likely to be feeling like absolute horse shit about the whole thing. I can't bare to have him beat himself up about it.”

“As you wish,” he smiled at you, releasing you from his grip and pulling himself away, “I'll bring you your Fire-Breather, honey.” Giving you one more playful wink, the larger man exited your bedside and sauntered down the hall to do as you asked. Bringing you the man who used his abilities to cleanse you from your ailment as he lay in the mess hall with the captain, finding reprive from their guilt at the bottom of their rum bottles.

Tag list: @mfreedomstuff @daydreamer-in-training @since-im-already-here @gingernut1314 @writingmysanity @sordidmusings @i-am-vita @indydonuts @feral-artistry @the-light-of-star @empirenowmp3 @racfoam @sunflowersatori @nerium-lil @sinning-23 @carrotsunshine @skullfacedlady @a-killer-obsession