#whatever ill never get answers | Explore Tumblr Posts and Blogs

6esiree · 3 months

Text

Accidentally Sending Them Your Nudes

Imagine sending Alastor, Lucifer, Husk, Adam, and Vox your nudes on accident?

Warnings: NSFW, AFAB reader, Swearing, They all make poor choices and take matters into their own hands, literally—they jack off to you. Lucifer’s and Adam’s parts mention videos instead of nudes. There’s some angst in there + I decided to do a quick reaction before the actual details.

Alastor:

Why did technology have to be so complicated? That’s what Alastor wondered as he pulled his phone out of his breast pocket, the wretched thing interrupting his dinner with Rosie with all the vibrating it was doing. Unfortunately, he never figured out how to silence it, and he didn’t plan to do anything about it out of sheer stubbornness.

“Is it alright if I take this?” Alastor asked Rosie, an apologetic smile on his face.

“Oh, no! It’s no problem with me, darling” Rosie said, putting her fork down and waving him off. “Go on, now—it may be somethin’ important!”

Alastor chuckled, getting up from his seat and pushing it back into the table before making his way to a more private area: the restroom. What a wise choice he had made, especially as he opened what you’d sent him, whatever irritation he previously felt vanishing almost instantaneously. Alastor hardly ever spoke to you, so he was definitely taken aback.

“Hope u like them, daddy Xx.”

——————

Knock, knock, knock!—a hushed curse seeped through Alastor’s lips, his forehead plastered against the cold bathroom tile as his fist eagerly stroked his weeping cock. The man couldn’t answer the rapping at the door, not with his belt unbuckled and his pants unfastened, the series of lewd photos you had mistakenly sent driving him to do something so…uncharacteristic of himself. But, fuck, you had such a pretty cunt.

“Is everything alright with you, Alastor?” Rosie’s voice penetrated the thin, wooden barrier, the only thing preserving his dignity. “You’ve been in there for quite a while.”

You had warned Alastor just a minute too late, your missed calls stacking up in his notifications as he stared at a photo of you in a compromising position. What a whorish thing you had done, but how could he have resisted the sight of your glistening, wet cunt spread apart by your dainty fingers, practically begging whomever you had meant that for to breed your hole?

“I believe there was…something in our food that made me fall ill,” Alastor responded weakly, his fist coming to a halt, making his cock throb in disappointment. “Feel free to leave if you’d like—I’m afraid I’ll be stuck here for a little bit longer.”

The silence Alastor was met with was nerve-wracking, sinking his teeth into his bottom lip to stifle his labored breaths while he waited for Rosie to say something—anything. Eventually, she did, a disappointed ‘Oh, alright’ gracing his ears, the sound of her heels clicking down the hallway his cue to continue with his ministrations. Alastor felt so relieved, but also utterly weak over his lack of self-restraint.

“Hey, uh, if you’re listening to this, call me back,” A voicemail suddenly played from his phone, but all he could focus on was the desperation in your voice, his knees buckling as he neared the edge. “Please, Al. I didn’t mean to do that.”

Cum spilled through the gaps between his fingers at the sound of your plea, dripping down and staining the tips of his recently-polished shoes. Alastor did not let up on his cock, however, bracing himself on the wall. A strangled groan escaped his throat as he stroked himself to overstimulation. In his twisted mind, that’s what he deserved for abandoning Rosie to jack off in a public restroom to lewd pictures of you.

Lucifer:

With an annoyed sigh, Lucifer pulled his phone from his back pocket, wondering who could be contacting him late at night. Downing whatever was left of his drink, he spotted your name in his notifications as his lock screen lit up, blinking in confusion. Out of all the residents in his daughter’s hotel, he interacted with you the least.

“Want anotha one?” Husk asked him as he grabbed his empty glass, cleaning it.

“Uhh, hold on for just a sec,” Lucifer said, unlocking his phone to see what you possibly needed from him.

Husk merely grunted in response, turning away from him to tend to somebody else. And oh, was Lucifer grateful for that, a blush creeping up his neck as he was met by the sight of something so…filthy. Underneath several short, boring texts that consisted of pleasantries, you sent him a video and the first interesting thing you’d ever told him.

“Couldn’t stop thinking about u <3.”

——————

God, did Lucifer feel depraved as he pressed the replay button on the video you had mistakenly sent him for the fifth time that night. While the true essence of your breathy moans and your squelching cunt were muffled by the putrid static his phone emanated, they were still audible enough to have Lucifer scrambling to his room, freeing himself from the confines of his pants with a gratified sigh as he lay in bed.

“Fuck, I know you didn’t mean to send this to me,” Lucifer whispered, slowly smearing his precum down the expanse of his cock as he shakily held his phone. “But I just couldn’t help myself—please forgive me.”

But what use was Lucifer’s plea for forgiveness when he was locked away in his room? He bit his lip, guilt enveloping his heart as your texts poured in, obscuring the part where you teasingly circled your clit through the thin lace of your panties. Still, instead of responding to you, Lucifer put his phone on airplane mode, the video already saved in his gallery. How wicked of him.

“Yes, show me that pretty little pussy,” Lucifer panted, his cock excitedly jumping in his hand as you tucked the fabric into the inside of your thigh, revealing your wet cunt. “Good girl—fuuuck.”

He thrusted up into his hand, imagining it was his cock pushing past your folds when you plunged two fingers inside of your hole. Lucifer had never thought about you that way before—well, until now of course. He wouldn’t be able to look at you the same, and that’s exactly what you must have feared, he thought as he picked up the pace, tossing his head back into his pillow.

“Lucifer, are you there?” He suddenly heard your voice penetrate the door, but how could he answer it when he was so close to finishing? “Husk told me you were here—come on, I just need to make sure you didn’t receive—it’s about something important.”

By placing his phone against his ear, Lucifer managed to drown out the sound of your knuckles desperately rapping at the door, your virtual cries of ecstasy sending him over the edge. Oh, how he wished he could have watched your cunt flutter around your fingers, or the way your cum dripped down your ass as you pulled them out. But Lucifer would have to do that after he dealt with the real you…including his newfound shame.

Husk:

Before Husk headed out to the bar, he emphasized that he wanted to be left alone, only taking his phone in case of an emergency. Husk wasn’t an asshole, he just wanted to spend what little free time Alastor spared him to do the things he enjoyed, especially without feeling suffocated. But, of course, someone had to disrupt his peace.

“Gotta be fuckin’ shittin me,” Husk sighed as his phone vibrated on the table, the contents of his drink moving along with it.

“Better be somethin’ important,” He mumbled.

Turning over his phone, Husk lifted a brow as he saw a few texts from you sitting in his notifications. None of them communicated any sort of urgency, but he liked you, so he decided to see what was it that you wanted. Husk blinked, the blush on his face accentuated by the alcohol in his system as he stared at something unexpected.

“Look at what u do to me...”

——————

Slumped against the furthest booth of a dimly-lit bar, Husk palmed himself through his pants. ‘Nobody’s looking at you,’ he told himself, yet his eyes continued to dart to nearby patrons as he held his phone below the table. The sleazy tendencies he thought he had abandoned long ago were awoken by a mere picture of your cunt, and with the whiskey clouding his judgment, Husk couldn’t help but indulge himself.

“Christ, is this what ya been hidin’ underneath those baggy clothes?” Husk groaned, taking in the sight of you sprawled on your bed, legs parted and cunt on full display. “So fuckin’ gorgeous.”

In his drunken haze, Husk couldn’t believe that you’d mistakenly sent him these photos, not even as your texts poured in, his thumb casting all of them aside except for one. The phrase ‘I made a mistake,’ stared back at him, and the longer Husk held the notification as he unzipped his pants, the sleazier he felt. In his defense—no, nothing could justify his actions. Nothing at all.

“No wonder I was damned for eternity,” Husk sighed, releasing the notification and freeing his cock in the cold, musty environment that was this shitty rundown bar he had chosen. “Ah, fuck.”

With his eyes glued to your wet, puffy cunt, the inside of your thighs glistening with your juices, Husk surrendered himself to the sight of you as he slowly pumped his cock. How many times had you made yourself cum? He wondered, scrolling to the next photo—oh, your breasts were in this one, and they were so pretty. Husk let out a grunt, feeling one of his suspenders slip off his shoulder as he picked up the pace.

“You’re probably busy drinking right now, but when you see this, give me a call,” It was another text of yours, a curse seeping past his lips as he read it. “Please, Husk…it’s important.”

Yeah, Husk wouldn’t be calling you back, at least not until he was sober. He feared that if he responded to you right now, he’d admit to jacking off to you, or worse, he’d admit to envying whomever was supposed to have seen you in such a crude display in the first place. Husk’s mouth fell open with a long groan, grateful for the music blaring in the background as cum cascaded down his fist. And despite his guilt, he kept your photos.

Adam:

Even though you worked with Adam five days a week, you kept contact to a minimal with him, especially when he started expressing interest in you. That’s why when you realized you accidentally texted him, you were absolutely horrified. But Adam? Oh, he was delighted to see your name in his notifications as he pulled out his phone.

“Hey, Lute, look after the girls while I take this!” Adam said, stepping away from the training grounds.

“Got it, sir,” Lute simply said, her obedience something Adam admired.

You had taken the day off, so Adam wondered what is it that you needed. Maybe you missed him? Yeah, probably, because you never contacted him outside of work. He opened your texts, his breath hitching in his throat as he realized you had sent him a video, referring to him with a pet name instead of ‘Adam.’

“Hi baby, sorry I kept u waiting for so long.”

——————

In a flurry of feathers, Adam left the training grounds, locking himself away in his office with his phone clutched tightly against his chest. There was no way you had mistakenly sent him a video of your nude body, right? You were Adam’s assistant, and he swore there was some tension simmering between the two of you, this supposed accident being your silly little way of admitting your attraction to him.

“So that’s why you took the day off, huh?” Adam huffed, practically tossing himself onto his swivel chair as he hastily undid his robes. “Sick my fucking ass.”

How many times had you rejected Adam? One, two, three—far too many times for him to think that you were playing hard to get, but his ego was just that big. That and his cock, which pulsated at the sight of your hand slowly dipping underneath the waistband of your panties, the outline of your dainty fingers running through your folds. God, you were such a tease.

“That should be me touching you,” Adam muttered, squeezing the base of his cock, precum dripping down the head. “Fuck, maybe tomorrow…”

You tried to call Adam, but all you did was interrupt the moment you lowered your panties, your contact popping up on his screen an utter inconvenience. Decline—his thumb didn’t even hesitate, putting his phone on Do Not Disturb as he resumed the video. Adam stroked his weeping cock with a renewed fervor when he finally saw your glistening cunt, so, so eager to be filled.

“Oh, you’re really gonna get it, baby,” Adam panted, his brows knitted in concentration as he watched you plunge your fingers into your slick hole. “What a greedy fucking pussy.”

You wanted him, you actually wanted him—that’s what Adam tried to convince himself as he finally came, even after you moaned out somebody else’s name at the end of the video. ‘Fuck, what have I done?’ He sighed, trying to ignore the feeling of rejection that threatened to envelop him during his post-nut clarity. As Adam reached for a tissue to clean himself, he secretly hoped that you had done this strictly for monetary reasons.

Vox:

When it came to Vox’s love life, it was virtually nonexistent, filled with possessive sex and mind-numbing arguments. So what did he do? He sought you out, a private escort who had a reputation for filling the emptiness in sinners hearts. Yeah, you dealt in the carnal stuff too, but that’s not what Vox hired you for.

“Hey, baby, my eyes are up here,” Valentino said, placing his elbows on the table, leaning in as Vox pulled out his phone.

“Yeah, I’m well aware of that, Val,” Vox replied dryly, his interest piqued as he saw several of your texts sitting in his notifications.

While Vox paid you the most out of all your clients, he still couldn’t take up most of your schedule, either. There were two days out of the week that you spent elsewhere, and you just happened to be contacting him during one of them. Vox’s heart jumped at that, but then he saw what you’d sent him, inspiring some hope in him.

“Maybe it’s time for something more Xx.”

——————

Thump!—Vox cursed, spilling his drink all over himself as his knee hit up into the table. What a goddamn inconvenience that was, but not for him, no. He used it as an excuse to escape the long overdue, monthly date Valentino had forced him to attend, anxious to deal with the issue in his pants…including the photos you had mistakenly sent him just a second earlier, paying no attention to the ‘Oops’ underneath them.

“Fuck, doll. You finally came to your senses, huh?” Vox groaned, locking himself away in the furthest stall, his fingers shakily unbuckling his belt. “About time…”

While you were a private escort, the attention you provided Vox was just too good for it to be strictly professional; and he clung onto it like a lifeline, abandoning Valentino for you even when he was in the mood for sex. Goosebumps littered his skin as he recalled your fleeting touches, even though they had never dared to visit the area between his legs.

“Ah, fuck,” Vox sighed as he freed his cock, precum dripping down into the crevices between his fingers as he stared at your wet, puffy cunt. “Can’t believe I’ve been missing this all along.”

Vox imagined that it was your dainty hands wrapped around his cock, your chest pressed against his back instead of the cold steel door of the restroom stall as you slowly pumped him. If Vox simply paid you, he wouldn’t have to use his imagination. However, he wanted you to pleasure him without the promise of money, because then that would mean that you wanted him.

“Hey, baby, I know you saw what I sent you,” A voicemail of yours suddenly played out loud, his heart jumping at the sound of your voice. “You know they weren’t for you, right? It was an accident.”

‘An accident? No, it couldn’t be,’ Vox thought, a groan escaping his throat as he finally came, his cum staining the tile between his feet. While he felt relieved, it was only for a bit, the disappointment quickly settling in his stomach soon after. But it wasn’t until Vox cleaned himself up and replayed your voicemail that he accepted he was just another one of your clients. Valentino was the best he’d get when it came to love.

2K notes · View notes

sundial-bee-scribbles · 2 years

Text

Yeah like what’s the point of even having anon features if they can’t use your website?????? Like on certain blogs I can’t even view them without being blocked????? I don’t understand????

And I can’t talk to people if they don’t have a submission box which is awkward because not many people have a submission box that I can see! -🌟

══════════════════

well the blog thing is most likely that some people have set it to not be visible outside the tumblr dashboard; some people just don’t want their blog viewable to anyone outside of tumblr and there’s a number of reasons why that could be, it’s their own personal decision

the submission/ask box thing can sometimes be a case i know of new users forgetting to turn it on, but sometimes too its deliberately turned off (or limited, like anons being turned off and only other users can ask qs) for, again, a number of different reasons (︶︿︶)

#submission #i forgot to answer this one sorry #the askbox being disabled entirely now if you dont have an acc is so so shitty tho ugh #also cause in general asks are the more popular thing i dont really know too many people who even remember the submission box exists #maybe ive been here too long. idk not that long but even before having an acc i was familiar w/ how the site worked and memes and such #i def get the frustration but there are valid reasons why some people limit who can contact them/view their stuff #that also being said though it is really shitty that modern internetscape basically forces you to make accs you might never use just to #view things or save images or whatever. in some cases i definitely do get why they do that #but like for newspaper sites lets say thats really fcking annoying. can i not know wtf is happening without paying up so much bruh #this is also a random nitpick but i HATE the new tumblr.com/(blogname) compared to the old (blogname).tumblr.com #ik new users might have no idea that you are able to turn that off and get ur own custom domain. but like its so annoying how this is forced #they butchered the link sharing stuff too its fucking hell if i wanna send tumblr links on mobile now. so annoying ugh #if anything age of website managements fcking shit up when it was fine before and legit nobody asked for change. its just like that sometime #sorry for randomly ranting and kinda negative vibes??? ill get to the playlist thing later again sorry its taking a while 😭#ollie the star anon

1 note · View note

hellsitegenetics · 7 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

#hellsitegenetics #faq #intro post #plants #flowers #snake gourd flower #requests #asks #remember to keep checking back!

2K notes · View notes

zarameraki · 3 months

Text

⁺✩₊📨˚✧ 𝐧𝐚𝐧𝐚𝐦𝐢'𝐬 𝐟𝐚𝐯𝐨𝐮𝐫𝐢𝐭𝐞 𝐚𝐬𝐬𝐢𝐬𝐭𝐚𝐧𝐭 𝐢𝐬 𝐫𝐞𝐰𝐚𝐫𝐝𝐞𝐝 ⋆｡💵₊✩°

: ̗̀➛ tropes: fem! reader 𖥔 minors do not interact 𖥔 nsfw 𖥔 he's obsessed to the max 𖥔 ceo x assistant 𖥔 grumpy x sunshine 𖥔 she talks a lot x he listens a lot 𖥔 loved you for so long 𖥔 major fluff 𖥔 sexual content 𖥔 alternate universe 𖥔 nanami's first time 𖥔 you talk him through it 𖥔 close proximity 𖥔

: ̗̀➛ words: 5.6k

: ̗̀➛ notes: hey all! sorry for the inactivity. im got reality to handle as well. i promise ill be more active soon. the creativity juices are running on low fuel atm. thanks for all the love and support you have have given me. if you enjoy my work, please leave a comment, like, and reblog! thank you & ily. enjoy!

Nanami couldn’t focus on the meeting.

He never could when you were in attendance, sitting off to the side, diligently jotting notes. His eyes flicked back and forth from the powerpoint presentation to the strand of hair bothering you despite tucking it behind your ear thirty-seven times.

Yes, he was keeping count.

His dick constrained against his pants when you bit the end of your pen between your teeth, getting a bit of your red lipstick smeared around the tool. He wished he was that pen, with the mark of your lips on his skin instead. He even wished he was your tea mug sometimes.

Jesus, something was terribly wrong with him. You were wrong for him. He was your boss; you were his assistant. Your relationship was strictly professional—has been for three years now. Three torturous years of admiring you from the sidelines. Three torturous years of hearing you yap about going on dates with random men off the internet. Three torturous years of chafing his dick in the bathroom every morning, noon, and night to the thought of you.

Your scent, your breaths, your skin, your hair, your eyes, your mouth—God, he loved your mouth—especially when it moved and produced the loveliest sound he’s ever heard. He wanted nothing more than to print you onto his skin for the rest of his life.

Nanami scowled at the silver-haired intern who kept side-eyeing your cleavage. If only it weren’t for that bastard. Firing him crossed his mind every time he popped up like a weasel, but Nanami needed a solid reason.

“—that’s alright with you, Mr. Nanami?”

Nanami’s attention snapped back to the presenter. What was he speaking about? Budget? Strategies for the future? Increases in revenue? Whatever it was, Nanami had one answer. “Yes.”

“Lovely, we’ll go ahead with the renovations for our research and development department. They’ll be happy to know their resources are being updated!”

Ah. Well, either way, he could care less. Whatever made his employees happy, he wasn’t afraid to spend a pretty penny. That’s why Nanami Kento was universally loved by everyone. Even his enemies—if he had any to begin with—would be his allies. He didn’t often put himself on the pedestal, but he does admit every now and then, he was a jack of all trades.

“That was a satisfying meeting, wasn’t it?” you chirped as you both entered the elevator. Nanami caught sight of the silver-serpent catching up and jabbed the button to close the doors.

Unfortunately, the intern pushed his hand in between and laughed in an annoying sound he called a voice, sending a twitch in Nanami’s eyes.

“Oh, Satoru!” you greeted, standing closer to his side.

“Boss,” Satoru said to Nanami, then turned to you, whispering, “Beautiful,” loud enough for him to hear.

You snorted, waving a hand. “Oh, stop it. I hope the meeting wasn’t too much for you. Lots of changes we’ve made for the fiscal year, huh?”

Nanami stared bored at the closed doors with the two behind him.

“You made it easier,” Satoru replied.

“Were you copying my notes?”

“Come on, sweetheart. This is corporate. Not college. A little cheating hurts nobody.”

Nanami heard your uncomfortable chuckle and clenched his fists tight. The word ‘cheating’ was a trigger for you. Your last relationship ended with your boyfriend of three months sleeping with your friend simply because she had more money and didn’t work for someone. Nanami was sure you’d quit and almost placed an offer to give you a proper role in the company, but you brushed it all off by stating how much you cherished being his assistant. He’d fallen madly, madly in love with you. He knew when he’d make you his wife, you’d be the boss.

“That’s my floor,” Satoru announced. “Let’s do dinner soon, yeah?”

You simply nodded.

“Always a pleasure meeting the man of the hour,” the silver-ass said to Nanami before exiting.

You stepped up to your boss’ side, sighing. “He just doesn’t know when to give up. It’s almost adorable.”

“I believe ‘agitating’ is the word you’re looking for.”

You laughed it off. Nanami didn’t think he was particularly a funny guy until he met you. “Satoru’s harmless.”

“Will you, though?” he asked, clearing his throat. “Go to dinner with him?”

You glanced up at Nanami, and smiled. He stared straight ahead with a tight tick in his jaw. Your smile broadened. “I’d love to,” you replied, finding his body tense, “but not with him.”

Nanami slowly dragged his eyes down to you. Your blinks were slow, weighed down by the thickness of your long lashes. His eyes dipped to your lips, then back to your gaze. “Well, I hope you do with someone. Dinner is an important meal of the day.”

He was an idiot.

“That’s surprising coming from you, Mr. Nanami.”

“How so?”

You shrugged lightly, eyes twinkling. “I’ve never seen you eat dinner, let alone leave the office around that time.”

Nanami adjusted his tie, feeling a bit self-conscious. He hesitated for a moment, then decided to take the plunge. “Well, maybe we should change that.”

Your eyebrow arched slightly, curiosity piqued. “Change what?”

“Since you’re staying late to catch up on work,” he said, his voice steadying, “how about we have dinner here together?”

You paused, surprise flashing across your face before you smiled warmly. “That sounds nice. I could use a break, and it’s been a long day.”

Relief washed over him, and he allowed himself to smile back. “Great. I’ll order something for us. Any preferences?”

You shook your head, still smiling. “I’m fine with anything, Mr. Nanami.”

“Please, call me Kento,” he said softly.

“All right, Kento,” you replied, your tone gentle. “Thank you.”

As he walked out of the elevator, he felt a sense of accomplishment and, perhaps, excitement—an emotion he’d felt strictly in your presence. It wasn’t a grand romantic gesture, but it was a step in the right direction. Tonight, you were his, even if only for a little while. And maybe, just maybe, he'd find the courage to tell you how he really felt.

As the morning passed, he buried himself in his work, but his mind constantly wandered. Every so often, he'd steal a glance in your direction, watching you as you diligently typed away on your computer or answered phone calls. There was something about the way you moved, the way you smiled even when you were focused, that captivated him completely.

Around mid-morning, Nanami's concentration was broken when a male worker from another department walked over to your desk. He was carrying a file, but instead of simply dropping it off, he started chatting with you. The man was smiling, clearly enjoying the conversation. Nanami's grip on his pen tightened as he watched the interaction unfold.

The male worker leaned casually against your desk, making you laugh at something he said. Nanami's heart pounded in his chest. He hated how easy it was for others to make you smile like that. He felt a pang of jealousy, a possessive urge to step in and assert that you were his . . . though you didn't know it yet.

As the conversation continued, you glanced up and caught Nanami staring. Your eyes met, and you smiled softly at him. He quickly looked away, feeling a rush of embarrassment and anger at himself for being so obvious. His face felt hot, and he cursed under his breath, trying to refocus on his work.

The rest of the day passed in a similar fashion. Nanami found it hard to concentrate, his mind continually drifting back to you. He tried to remind himself that he needed to be professional, but it was a losing battle. Every time he heard your laugh or saw your smile, his heart ached with a mixture of longing and possessiveness.

The evening had grown quiet, with the soft hum of office equipment and the distant sounds of the city outside. When the delivery boy finally arrived, Nanami stood up and walked over to meet him.

“Oh, I’ve got it!” you said, standing from your seat and taking out your credit card.

Nanami tapped his card without a second thought; he’d always be willing to pay for anything when it came to you.

“Sir, this was going to be my treat.”

“Next time,” he replied.

You smiled, tucking a strand of your hair behind your ear. “Next time, it is.”

He led the way to his office, opening the door for you. You set the food out on the table, and for a moment, there was an awkward silence as you both settled onto the sofa.

Nanami cleared his throat. “I hope you like what I ordered. I wasn’t sure what you preferred, so I got a bit of everything.”

You smiled warmly, appreciating his thoughtfulness. “This looks great. Thank you.”

You began eating, the silence stretching between you both. Nanami felt frustrated at himself. You’ve worked for him for three years and he still couldn’t harness the ability of speaking to you casually. He wanted to make conversation, to make this moment more comfortable, but the words seemed to stick in his throat. He glanced at you, watching as you took a bite and then met his gaze.

“This is really good,” you said, breaking the silence. “I didn’t realise how hungry I was.”

He smiled, feeling a bit more at ease. “I’m glad you like it.”

You continued eating, the silence now less awkward and more companionable. Nanami stole glances at you, noting the way you enjoyed the food, the way your eyes sparkled even in the dim office light.

When the last bites were eaten and the containers cleared away, you leaned back in your chair, looking content. “Thank you for this. It was really nice.”

He smiled softly, his heart full. “Anytime. I’m glad we could do this.”

“About damn time,” you muttered.

Nanami blinked.

You sucked in a sharp breath, realizing what slipped your mouth. “Mr. Nanami— I— I only meant that—” You surrendered with a sigh, running your fingers through your hair. “Damn it.”

Licking his lips, Nanami shook his leg anxiously, wondering what exactly you’d meant. Were you wanting to have dinner with him for a while now? A platonic dinner? Or was it, and he could be entirely wrong, more? Were you perhaps . . . also rowing the same boat as him?

“I should’ve extended an invitation a while ago,” Nanami whispered.

Your eyes locked with his.

“Three years ago, to be exact,” he continued, awaiting your reaction. “In an intimate sense. Or professional, if that’s what you��d prefer. I’m happy either way. Unless this has made you uncomfortable—”

“Kento.”

He stopped to catch his breath. “Yes?”

You reached out and rested your hand on his knee, your eyes moving from his body to his face. “Next time, like you mentioned, can I treat you to dinner at my place?” The caress of your thumb set him aflame—a tiny gesture, yet powerful. “Unless it makes you uncomfor—”

Nanami cupped the back of your head and pulled you into a feverish kiss. He moaned at the first touch, savoring the sweet taste of you, the smoothness of your lips, and the sweep of your tongue against his. He didn’t dare break the kiss, tugging you out of your chair and onto his firm lap. His mouth was everywhere—your jaw, your neck, your collarbones—as he deftly unbuttoned your blouse. He was a madman, lost in the moment.

“I’ll do it,” you chuckled as he fumbled with the clasp of your bra. “I didn’t peg you for an inexperienced man.”

“I’ve been saving myself for—”

“The right woman?” you snorted.

“For you,” he stated firmly, cupping your cheek. “The last three years have been agonising. Whenever you’re near, I can’t focus. Whenever you laugh, I can’t breathe. Whenever some other bastard tries to flirt with you, my sanity chips away until all I want to do is take you away. Mark you as mine.” His possessiveness sent a shiver down your spine, making your back arch. “That’s exactly what I’ll do tonight. Is that okay with you?”

You bit your bottom lip and nodded. “More than.”

“You always know the right thing to say.” He smiled against your lips, slipping off your bra in the process. Through the kiss, you guided his hand to your breast. Just because he was inexperienced didn’t mean you were. Nanami should know by now that you had a little zest in you. “Like this, darling?”

You sighed as he pinched your nipples, his eyes marvelling at the sight of your breasts. “Yeah. You can put your mouth on them, too.”

His lips latched onto your left nipple swiftly. Your fingers buried themselves in the back of his hair as your hips ground against his erection while he nibbled and sucked on your breasts. He left them sore and bruised, kissing his way up to your collarbones, neck, and finally, your desperate lips.

Nanami picked you up with one arm, using the other to swipe whatever papers were on the table onto the floor.

“There are important contracts in there, Mr. Nanami,” you said as he laid you back onto the mahogany surface. “Don’t expect me to clean it up in the morning.”

“You’re the most important thing right now and always,” he replied, loosening his tie and tossing it over his shoulder. “And you will call me by my first name in private.”

You raised an eyebrow, relishing the sight of him slowly exposing his torso, button by button. “Yes, Kento.”

He sucked in a sharp breath, shrugging off his dress shirt and draping himself over you, his fingers gently closing around your neck as he kissed you deeply. “It must be exhausting walking in a tight skirt all day,” he whispered against your lips, finding the zipper of your pencil skirt and lowering it slowly. “If you want, I can change the dress code for my favourite assistant.”

“I’m your only assistant,” you said, letting him remove your skirt. “And I like my tight skirts, thank you very much.”

“I don’t like how the men stare at your back.”

“Sue me for having a perfect ass.”

He shrugged. “You have my lawyer’s contact number.”

A laugh bubbled out of you, which he immediately stole with another kiss. You locked your arms around his neck. “If wearing tight clothes gets me incentives like this, I’ll do it every day.”

He narrowed his brown eyes. “I can’t control your wardrobe choices.” His fingers trailed down your left breast, making your breath hitch as he grazed your sensitive nipples, then continued down to your stomach and under your panties. “But I have full control over your body tonight, yes?”

You pecked his lips. “Absolutely.”

Nanami wasn’t quite rubbing your clit—it felt rather ticklish. “You’re making a face. Am I doing something wrong, darling?”

“Not exactly.” You found his hand between your legs and lifted it higher, pressing his fingers directly onto your clit. It was embarrassing how wet you already were. “Rub here.”

He rubbed there, and you took in a shuddering breath, nodding to encourage him to keep fucking me with those skilled fingers, Nanami Kento—fingers you had admired far too often, especially when he performed pen tricks with them.

“How many . . . erm, how do I word this?” He looked conflicted as he murmured words to himself.

“What? I won’t judge.”

Nanami looked adorable when flushed. “How many fingers would you like . . . inside of you?”

You pressed your lips together, holding back laughter at his reddened face. This was the first time you'd be taking a man's virginity, and you wanted to make sure it was as good for him as it would be for you. “I can take three.”

“Wow,” he breathes out, clearing his throat.

“I’ve taken a fist before.”

His eyes widened in shock. “I’m sorry?”

You laughed, cupping his face. “I’m just joking. I only wanted to see your reaction.” He was still flabbergasted as you kissed him. “But it is possible. I wouldn’t suggest it right now.”

“Right now,” he repeats. Yes, right now. Eventually, you’d want his whole damn fist inside of you. “I’ll start with two.”

“Middle and ring finger. Never index. It’s a rookie mistake.”

“Of course.” Nanami relieved your clit and slid down your centre. “God, you’re soaking my hand, darling.” His words sent a ripple through you. Then his fingers slowly slid inside your tight heat, making him grunt.

“How is it?” you whispered, massaging the back of his head while the other rested on the side of his neck.

“Warm,” he said. “And . . . clamping?”

This was entertainment for you.

“Warm and clamping is one way to describe it. You can start moving your fingers in and out of me. Curl them, tap them, whatever you want.” Your tongue licked his upper lip, surprising him. “And if you want to blow my orgasm through the roof, circle your thumb on my clit. Don’t hold back.”

And he didn’t.

Nanami drove his fingers inside your pussy, unknowingly hitting your g-spot, and flinching when you cried out his name. The pad of his thumb rubbed your clit, or if he complained about a cramp, he’d used the mound of his palm, cupping your entire vagina.

“I’m close—” You let out strained breaths, gripping his hair or shoulders.

“Close to what?”

“You’re going to make me say it?”

Nanami appeared genuinely puzzled. “Close to your orgasm?” Oh, my god. He was genuinely puzzled. Why wouldn’t he be? You couldn't expect him to know about even the most obvious sex-related things. Part of you was excited to show him your vibrator and have him guess what it was.

“Yes, Kento. I’m close to my orgasm.”

He grinned with pride. Your heart melted, and you grabbed his face, kissing him as if your life hung in the balance. Amid his fervent moans, you came gushing down, drenching his hand with your release.

Pulling his hand out, he stared at your orgasm. “That’s quite a lot.”

“Oh, my god, stop.” You covered your face, suddenly embarrassed by how much you’d come.

“I’m sorry, darling. I meant it in a positive way. I’m very flattered. And thankful that you taught me how to please you this way.”

You caught him about to lick his fingers, causing you to shout in protest and pull his wrist back sharply. “No!”

“What? What is it?”

“You can't just— You're all about cleanliness and stuff. I don't want you breaking your own rules for that.”

Nanami smiled. “I’d break all my rules for you.” He went to go lick again, but you quickly pulled his hand towards your chest and wiped it on there. His face contorted to frustration. “What the fuck?”

Your brows shot up. This was the first time you’d heard him curse. It was so hot. You wanted him to say it again. “It’s dirty.”

“It’s a part of you.” He made a tch sound and retrieved his tie from the floor. “Give me your hands.” Taking your wrists, he bound them with the material behind your waist.

“Kinky,” you said.

Nanami stayed silent, his expression now one of disappointment, his brows furrowed deeply. The confusion that once marked his demeanor had given way to a completely different persona. “If you won’t allow me to taste you from your hands”—he pushed your ankles up on the desk and sank between your legs—“I’ll drink straight from the source.”

“Kento, wait—”

Too late.

You broke into a chorus of moans as his tongue licked and lapped at your pussy. His mouth engulfed your clit and sucked on it hard, the tip of his tongue now swirling the little bud. His fingers spread your folds, as he cleaned every last drop of your juices, even probing your little hole that they seeped from.

By the end of it, you were drenched in sweat, tears brimming in your eyes, your wrists throbbing from the restraints. Your body swayed side to side, legs trying to close him away, but he remained persistent in eating you out like a madman. “Ken . . . I can’t—”

“Have you learned your lesson?”

“Yes, goddamn it. Yes. I’m sorry.” You would let this man lick your whole body from now on. “Just kiss me already. Please.”

He kissed your clit and travelled up to your stomach, each nipple, and to your mouth as he undid the tie so you could cling to him. His mouth met your wet eyes. “I’m sorry, darling. I got carried away a bit.”

“No, don’t be. I loved it.” You planted a kiss on his cheek, making him smile bashfully, just like he had ten minutes earlier. “But I’d prefer someone else to touch me now.”

His gaze grew intense. “Who?”

You blinked. “Your friend.”

He scoffed, running his fingers through his hair. “My— My friend?”

“Uh, yeah?”

“Have you spoken to him before?”

You eyed his prominent bulge. “I’d like to. Touch him, kiss him, have him inside of me.”

Nanami stared at you with disbelief. “No.”

“No?”

He gritted his jaw, fists at his side. You were completely frazzled by his response. Why was it that he got to explore your inside with his fingers and tongue and wouldn’t allow you to touch him?

“That’s not fair. I thought you wanted me,” you mumbled.

“And yet you want my friend,” he replied sharply. “Haibara will be disappointed to know that I don’t share.”

Huh?

“Haibara?!” you shrieked at the highest decibel, jolting him. “Hai— Oh, my god. Oh, my god. Kento, you id— That’s not what I meant when I was referring to your friend.” How is this man running a multi-million dollar corporation? “I was talking about your penis. Dick. Cock. Whatever you prefer.”

Nanami stood in stunned silence. His anger melted away, replaced by a sudden realization, his eyes darting upward. “Oh.”

You’d had enough. If he prolonged your orgasm any further, you were going to get a female version of blue-balls. “Come here, you doofus.” You pulled down by his collars and kissed him, undoing his belt, button, and zipper for him. “Can I touch your dick, Mr. Nanami?”

He nodded vigorously.

You rolled your eyes, smiling, and slid your hands into his boxers, grabbing him. “Oh, God. I knew it. You’re so big.”

“You knew it? Has it been on your mind?”

“Ever since my interview. No one asked you to manspread. It drove me crazy. Made me stumble on my words.” You stroked him slowly, dissolving him in a sea of grunts and groans. “Be honest, did I get this job because you were attracted to me, or because I’m genuinely good at what I do?”

Nanami pondered for a moment before responding, “Both?”

“Of course you chose the safest answer.”

“Well, you’ve managed my schedule flawlessly for three years. You handle all my emails, make the best coffee, and surprise me with treats. Yes, you’re undeniably beautiful, but it’s your heart that I’ve fallen in love with.”

Your hand froze. “Love?”

He nodded, a blush colouring his cheeks as he looked away. “Love.”

You cupped his face with both hands. “You love me?”

Another nod. “Since your interview.”

He had loved you for three years now. It seemed surreal. You liked him, certainly, but did you love him too? That was the question. Your mind had always assumed he would never see you romantically, so you held back from letting your feelings grow.

“You don’t have to say it back,” Nanami reassured you. “I’ve loved you enough for both of us for far too long. I can wait until you’re ready.” He kissed your forehead gently. “But please, don’t make me wait forever. I don’t want us to stay strictly professional. I want to take you out, make you my girlfriend as soon as possible. Eventually, make . . .” He paused, unsure where to place his hands, before settling on your shoulders. “Make you my wife.”

Oh, you were about to give him the best blow job ever.

“Okay,” you whispered, stepping down from the table and taking his hands. “Let’s go on a date tomorrow, the day after, and every day after that. I want to be your girlfriend by next week— I’ll add it to your personal calendar. And I want dinner and wine at your place afterwards. Speaking of your place, I want to move in with you by the end of next month, or we can live in my shitty apartment— I don’t mind. You have to make me your wife next year instead of making me wait three more years. And I want two kids somewhere down the line. Oh, and a cat.” You grinned widely at his stunned expression. “Can you give me all that, Kento?”

He breathed out heavily, nodding slowly. "Yes," he affirmed. His lips found yours. "Yes. I can. I will. I'll give you whatever you need." He kissed you without restraint, laughter filling his office like a contagious joy.

“Okay, okay.” You gently pushed him back by his shoulders and settled him into his seat. “Prepared to have your mind blown, Mr. Nanami.” Kneeling down, you kissed his thigh, tracing a path up to his hip bone.

His breaths came out laboured, short, as he watched your intentions with a hawk eye.

You took him out of his boxers and prepared your poor throat. It was long and girthy, your fingers barely curving around it. Your tongue ran over his tip, collecting the salty, pre-cum leaking from there.

Nanami hissed, gripping the armrests of his chair as he spread his legs wider. “Will this be painful?”

You looked up from under your lashes. “I'll do my best not to use my teeth by mistake.”

“I meant for you, darling.”

“One way to find out.” Your lips curved over the head of his cock, lowering yourself until his length was tickling the back of your throat. Nanami was in shambles already. You pulled back and licked him from his base to the summit. “You’re so warm, too. So hard.” Your hands sailed up his thighs, kissing his rigid length. “All for me.”

“For you, darling.” He brushed your hair back from your face.

Chuckling, you took him into your mouth again and sent a prayer you didn’t wake up with a sore throat. You could easily picture Nanami purchasing cough drops for you, brewing tea, and insisting you take a day off. The idea of him looking after you sent shivers down your spine.

Nanami gripped the sides of your head, his own tilted back as he breathed heavily through those flawless lips. Occasionally, he'd bravely look down and catch your gaze, then quickly avert his eyes to the ceiling. It was adorable how he struggled to maintain eye contact with you. You had assumed he avoided it because he wasn't interested in talking to you or listening to you yapping. It all makes sense now.

He's simply shy. And you're determined to coax him out of his shell, or even better, cozy up inside it where it's safe.

“The sounds you’re making,” he breathes out. The sounds you’re making, Kento. “It feels like you’re taking me deeper.”

Because you were. You expanded your jaw, even hearing a little joint tick, and pushed him past the limit of your throat. You’d given blow-jobs before, but the guys were either too small, or too aggressive, leaving your scalp numb without any aftercare.

Nanami was different. He left your hair and held your face, thumbs caressing your cheekbones as he struggled against his restraints. You could feel him twitch in your mouth, feel the veins pulse on your tongue, his sacs hot at your touch.

But you wanted Nanami to come inside you.

At the last minute, you drew him out of your mouth, the strings of your saliva and his pre-cum bridging from your lips and his tip. Nanami groaned at the sight, his dick twitch involuntarily, standing long and proud.

“I want you inside of me now,” you whispered, wiping your mouth with the back of your hand and sitting on his lap. He pulled your lips in for a kiss as you adjusted his tip at your entrance, sitting down on it in one go. A cry ripped from your aching throat; a loud growl from his. “Fuck, Kento. Your cock’s filling me up.”

“Such a dirty mouth,” he muttered, hand on your nape while the other guided your rolling hips. “Does it hurt?”

You chuckled, head shaking. Your forehead rested over his palms on the side of his neck as you bounced on his lap, your movements growing faster. He was stretching you out, the tip poking your womb, practically splitting you in half.

Nanami, on the other hand, was on cloud nine. You were warm and sticky, your walls cushioned and clamping around him, sucking him deeper by the second. He’d dreamt of this every night, jerking himself off to the thought of you, recalling the sound of your laugh, or your floral scent.

Right now, his name slipped off your tongue and you smelled like him. Sweaty, breathless, moaning. This is exactly how he wanted you. Needed you. You were his assistant. His woman. His lover. If any other man dared to touch you, or flirt with you, he’d fire them. He wished he could kill them instead.

You had awakened his territorial, possessive side, consuming him completely. If his parents refused to accept you as his equal, he would abandon everything and find happiness elsewhere with you. But first, he was determined to fight for you with all his might. Damn it, he loved you.

“I’m tired,” you whispered, wincing as you tried to mill your hips forward again. “Oh, no. I’m cramping up.”

Nanami hated that he didn’t know what to do. He wished he was experienced. He wished he didn’t have to rely on you even if it was a turn-on when you dominated him with your words and actions. “Stop and take a breather.”

You obeyed, resting your forehead on his shoulder.

He grabbed the globes of your ass and stood up, walking over to the couch and laying you down there. “Is this better?”

“Yes.” You stretched up your arms then wrapped it around his neck, giving him a long, loud smack of a kiss. “Proceed.”

Nanami chuckled, caressing your cheek. He thrusted inside of you, pulling himself to the tip, then back inside. It seemed to have you making those needy sounds, so must’ve been on the right track.

“You’re so handsome,” you whispered, locking eyes with his deep brown gaze as he intensified his movements, growing faster and more forceful. “Yes, yes, yes. Oh, god. Ken—” You were cut off by his kiss, by his hand clutching your breast, pinching your nipple.

“I love you,” Nanami murmured, kissing your throat and burying his face in the crook of your neck. You cupped the back of his hand, wailing moans as he pounded into you, flesh slapping against flesh. “I love you, darling. I love you so much.”

“Kento.” You were feeling achingly sore, your legs losing sensation. He was rutting into you like a madman, and no, you did not want him to slow down whatsoever. “Kento!”

He drew his face back. “Yes?”

“I love you, too,” you cried out as you climaxed, your back arching off the couch’s surface.

Nanami crashed seconds later.

You were both a breathless, sticking, sweaty mess. Nothing but the sounds of your rapid hearts and shallow breaths could be heard.

Nanami slid out of you after a minute of silence. He was glowing, golden hair damp with sweat and sticking in different directions from your hand that was running through it. He parted your legs and watched both your mingled release leaking out of you. “I did that.”

You burst out laughing. “Thank you for letting me take your virginity.”

He scowled at you, the kind where a smile creeped on his lips. “Let’s get you cleaned up.”

“No, lay with me for a sec.”

Nanami listened attentively and settled beside you on the couch, pulling you into his embrace. You showered kisses over his face, jaw, and the corners of his smiling mouth. “You said ‘I love you,’ by the way.”

“I did.” Another peck landed on his lips.

He swallowed, his eyes sparkling as they met yours. “Are you sure?”

“One-hundred-infinite percent.” You fixed his hair away from his forehead, running your index finger down the slope of his nose and to his lips. “Say it back.”

“I love you.”

“I love you, too.”

Nanami sighed contentedly, his hand cradling the back of your head as he planted a kiss on your forehead. You giggled and nestled your cheek against his chest, wrapping your arms around his waist. “I know you said to wait until next week to make you my girlfriend, but is it alright if I make you mine now?”

“I am already yours.” You drew hearts on his torso, feeling shy all of a sudden. You’d never been in a proper relationship before. But neither had Nanami. Which meant you’d both navigate your relationship together as novices.

“Officially?” He continued. “Or I can wait—”

“Yes,” you said, craning your head up. “I’d love to officially be your girlfriend, Kento Nanami.” You savoured the relieved breath he took. How could you ever reject a soul like his? He was your favourite person. “But I’m still your assistant.”

“And now I’m yours.”

You laugh and rest your nose in the curve of his neck, closing your eyes. He hugged you close, lips lazily kissing the top of your head. “Get as much rest as you can, Boss Man. Round two is in five minutes.”

1K notes · View notes

avatarchic · 6 months

Text

TWENTY-SIX MONTHS

— starring. baby daddy!todoroki shoto x fem!reader

— tags. miscommunication trope, angst, pregnancy and giving birth, friends with benefits, vague relationships, running away, slight single parent!au

— warnings. ages are unmentioned, but shoto is in his late 20s/early 30s, smut, soft sex, cunnilingus, praise, p in v, use of petnames (baby, pretty girl), reader gets called a good girl once, shoto is highkey a munch

— word count. 8.2k

— requested? no

— notes. this one ruined me tbh LOL i have a nasty habit of slipping btw present and past tense so the tenses in this one might be all over the place :')))

Whatever you and Todoroki Shoto had together, you knew it wasn’t romantic.

You were his outlet. His source of relaxation when being a hero became too much to bear on his shoulders alone. You were fantastical. You were illusionary. With you, he was no longer Pro Hero Shoto, Number Three Hero. With you, he was just Shoto. And for your moments away from the world hidden beneath wrinkled sheets and closed curtains, that was enough for him. When morning came, and those curtains had to be drawn, he would become Pro Hero Shoto again, and you would wake up to an empty bed.

For you, he was everything.

For you, he was your hero before he became a Pro. He saved you from succumbing to the stress of standing out to survive as a support class student. He saved you from your insecurities and false ambitions, and he saved you from living a life you didn’t truly want. Todoroki Shoto was your best friend before he became the man shrouded in shadow — the man you hid away in secrecy to bed whenever he wanted.

He told you he would be gone for a while. A mission in upper Kyoto that took him away from your arms while you stayed safe in Tokyo. He assured you that he would be fine and return to you as soon as possible. If you were a fool, you might’ve taken those to heart and swooned under the pretense of love. But you knew better.

Before Todoroki Shoto came Pro Hero Shoto. You would be a fool to think he would pick the first before the other. You would be a fool to think that you, a citizen with no name, could ever stand by his side. In your eyes, Shoto put his work before himself. Admirable, strong, ever-the-reliable Pro Hero Shoto. The nights he spent with you as just Shoto made you wonder who else got to see his true self.

The second month of his absence came, and you were sick. An illness had overtaken you, leaving you bedridden for days on end. At first, it had just been nausea. You put it off as motion sickness — you often had to take the train to and from anywhere. Perhaps your stomach had simply met its limit and was taking it out on you with lashes of sickness and vomiting.

After a week of being washed away in your bile, you realized that you had yet to bleed that month. Rather, you realized you hadn’t had your monthly bleeding for a while. You weren’t stupid. You knew what it all meant, and you knew the consequences of your actions had finally caught up to you. You hid away from the world, only leaving to purchase tests from the store.

The answers mocked you. PREGNANT. TWO MONTHS+.

You considered getting rid of it. To keep it your dirty little secret. Shoto would never have to know — no one would ever have to know. But as you stared at your reflection in the mirror, your hand resting atop your stomach, you felt at peace for once. As if you finally had a reason to keep going.

Five months had passed since he was gone, and you felt it now more than ever. You never explained to any of your friends or neighbours who was responsible for the swelling of your tummy, nor about the packages of furniture fit for a nursery that showed up on your doorstep. They never asked. No one knew your trysts with Shoto, and you planned to keep it that way.

For his sake.

You wished. You desperately wished that he could stay by your side, that he could support you through this time of anxiety and worry. You daydreamed of welcoming him home, your little bundle of joy wrapped in your arms as you kissed Shoto on the cheek — a reward for working hard as he always did. You thought about spending more than just nights of pleasure with the two-toned man, about wearing his ring and raising your beloved child together.

As a family.

Thirteen months had passed since you last saw Todoroki Shoto.

Thirteen long, gruelling, and lonely months were spent mourning his absence, even though he was still alive somewhere. It felt like the clouds that followed you for weeks parted only when your son was born. He looked like you. He had your nose and your eyes. He had the same rounded cheeks you still adorn, even well into adulthood. His voice was like bells on a clear sunny day, and when he lay in your arms, you declared that you would love him for all you were worth.

Even if the tuft of red and white on his head brought you immense heartache.

A selfish part of you wished that nothing of your son, whom you’ve named Yami, would resemble his father. That way, you could truly hide his origins — your past that you refused to uncover. But the bigger part of you was overjoyed. The moment you laid eyes on his hair, matted down with blood and amniotic fluid, you sobbed uncontrollably. The nurses and midwife recognized the two-toned hair immediately and watched you with pitiful eyes as you clutched Yami to your chest.

You moved away the second you were discharged from the hospital, baby carrier in tow. You wished your neighbours well and thanked them for being so kind to you in the years you lived among them. You were gone within that same week.

You lived peacefully in your new home, tucked away in the countryside of southern Japan. You opted to stay away from TVs and the internet, worried that seeing his face might make you regret the rash decision to pick up and leave. Yami was growing quickly, already large for a four-month-old. His hair grew out, more red than white.

You didn’t know if Shoto had made it back from his mission. If he did, you weren’t sure how long he had been back or whether he had sustained any injuries. You didn’t know if he went to your apartment to search for his fantasy. You didn’t know if he thought of you at all.

You didn’t know if he was alive.

The longer you spent away from the man, the more your heart yearned for him. Whenever Yami would quiet down for his nap, you stared out the window at the acres of empty farmland. In the vastness of space, you could only think of him. The man who had taken your heart from the tender age of fifteen. The man who possessed your life in his hands, though your essence seemed invisible to those blue and grey eyes.

The fool in you wondered if he ever had feelings for you — if he ever burned for you the way you did for him.

You felt like a dessert. Scorched inside and empty. Golden sands represented him—burning to the touch and yet all-encompassing. Even without him by your side, he was always there. He surrounded you, dragging you in, and you let him.

Yami’s babbling would always break you out of your reverie, the pangs of guilt and sorrow gnawing away at your still-beating heart. The routine remained the same, day after day. After he woke up from his nap with an incoherent cry for his mother, you would settle him onto your lap and cry. You sobbed into his soft tufts of hair, apologizing for taking him away from his father, for hiding him away from the world just because you were a coward.

Yami was your darkness. He was your uncovered secret.

Two years and two months had passed since you last saw Todoroki Shoto.

Yami was seventeen months old and starting to look more and more like his father. He took his first steps earlier than any parenting book had told you he would, and it wasn’t long after when he said his first word. It seemed the world was against you, and the universe was punishing you for keeping Yami away. You broke down for the first time in a while when that first word hit your ears.

“Da… Dada…”

You weren’t alone in your silent, unspoken wishes to be at Shoto’s side. Poor Yami, who had never met his father, spoke Shoto into existence with that one word.

“My baby,” you sobbed, hugging Yami tightly to you as he babbled, repeating those two syllables over and over. “My poor baby. I’m sorry. I’m so sorry. Mommy’s so sorry, my baby…” You rocked back and forth, crying endlessly. Yami’s hands grasped at your clothes, hair, and face. His little round features twisted into a grimacing cry as he watched tears pour from your tired eyes for a reason he didn’t yet understand.

The day he spoke his first word was when you showed him a picture of his father for the first time. Recognition flashed behind rounded eyes, recognition for a man he’d never met.

While you were grocery shopping — Yami balanced on your hip, a paper bag full of produce in the other arm — you heard Shoto’s name.

“Didn’t you hear? Pro Hero Shoto is here! In town!”

“Isn’t that weird? Why would such a hotshot be here, of all places? We aren’t even on most maps…”

“Who cares?! Do ya think I can get an autograph?”

You break out into a run without paying attention to the rest of the conversation. You hold Yami to your chest, supporting his head as you run with all your might. The paper bag of fruit and vegetables lay forgotten behind you, surely to be crushed by any passing vehicles. You run until you can’t run anymore, chest heaving in exhaustion. Using your object manipulation quirk, you open the front door to your house without taking your hands off Yami.

You whisper sweetings into his ear, telling him everything would be okay. Maybe you were telling yourself.

Not long after you returned home, the door rattled with a gentle knock. The very door you locked moments ago. You hold your breath, not wanting to see anyone. You didn’t want to see him.

Your name was spoken in that soft voice you missed so much. Before you could stop him, Yami started sobbing, his high-pitched cries alerting the person outside that you were there. You shush Yami desperately, rocking him back and forth in an attempt to calm him down. You kiss his forehead, silently begging him to stop crying.

Your name was called out again, this time panicked and louder. Yami’s cries increase in volume, and you feel your eyes water all the same.

The door hinges begin to frost over, and it’s knocked down in seconds. The loud noise scares your son, causing him to sob uncontrollably as he grasps painfully at your hair. You hide him behind you as you face the intruder head-on. Without blinking an eye, you use your quirk to lift the door off the ground, pushing it against the intruder, hoping to push him out completely.

The door is pushed away easily. After all, you are no match for Pro Hero Shoto.

He has gotten larger in the twenty-six months since you last saw him. His shoulders grew broader, his hero uniform barely hiding the dense but lean muscle that hid beneath it. His hair was longer, falling into his eyes as if he didn’t have time to take care of it. The man in front of you looks different from the man you knew, but it is undoubtedly him.

He breathes out your name, steam rolling off his left side and icicles glistening atop his skin on his right. He steps over the forgotten door, into your house, and into your safe haven, large and commanding of your attention. You try to make yourself bigger, to hide Yami from his eyes, and perhaps to hide your shame as you stare at the father of your child.

“I looked for you everywhere,” he gravels, his voice deep and crackling with emotion. “I came home, and you were gone. Do you have any idea how fucking scary that was?! No one knew where you were, and your apartment was empty. I didn’t know if you were safe, I didn’t know if you were alone…” Shoto steps closer to you, anger seeping into his expression. “For fuck’s sake, I didn’t know if you were alive!”

Your heart hammers in your chest as he grows closer, his fists clenching angrily by his side. His eyes search you desperately, searching for any sign of injury or abuse. They trace over your wrists and ankles, perhaps looking for signs that you were held here not on your own will, that you didn’t leave him just because you wanted to.

You pick your brain for the right words to say. You have thought about this day for years, and now that he’s in front of you, you don’t know what to think. Your mind is a mess of shame and joy, your heart struggling in a fight against itself. Analyzing him, your eyes rake over his body. There were a few more scars you don’t remember, some fine lines on his face that weren’t there before, but it was him.

As your brain wraps around the fact that Shoto was really there after over two years, Shoto collapses to his knees in front of you. He all but crawls over to you as he shoves his face into your thighs. Hot, stinging tears hit your skin as he cries into your lap, his hands reaching to hold you. Large, calloused fingers grasped at your thighs, pulling you closer to him.

“I was so scared,” he admits, his body shaking as he cries silently. “I thought… I thought a villain had taken you.”

Your hands hover behind you, keeping Yami hidden. His cries have thankfully subsided the second Shoto entered the room, but you weren’t sure for how long that would last. You can feel him grabbing at your shirt, trying to peek around you. Resisting the urge to wipe away Shoto’s tears, you grip onto your son tightly.

“How did you know I was here?” You lick your dry lips, wincing at how raspy your voice is. The first words spoken to this man in over two years are painted over with wariness and caution, very unlike the words of encouragement and longing you had given him your last night together. “No one knew I was here. Not even my family, so how did you…” You trail off, unsure if you want to know the answer to this question.

Shoto pulls away from your lap, looking up at you with bloodshot eyes and tear-stained cheeks. “I searched for you every day. I never stopped once I realized you were gone. I was in communication with every hero in this fucking country, hoping that one day one of them would spot you.” He hastily wipes his cheeks, his trembling hands remaining at your side.

“Why did you go?” he asks in a whisper. His voice, low and cracking, is broken as he speaks. “Why did you leave me? Did I do something? Was I…” Shoto swallows thickly as his insecurities taint his mind. “Was I not good to you? Did I make you leave?”

His endless questions send you for a loop. In front of you was not Pro Hero Shoto, but just Shoto. Your Shoto, the one you long for in your dreams. The one who paints your every happy memory and the one whose name you whisper into the dead of night.

And yet, as you feel Yami’s tiny hands grab your arm, you can’t answer any of his questions.

“Dada…!”

The both of you freeze, and the world stands still for a moment. Shoto’s trembling gaze slowly left yours, meeting the eyes of the toddler behind you. The first thing Shoto notices is his hair — bright red with streaks of white bleeding through. He feels his heart stop and start again, his hold on you finally slipping as his body goes somewhat limp. He falls back onto his heels, fully kneeling before you now.

Snapping out of it, you turn around and take Yami into your arms, facing away from Shoto as you shush the poor baby, calming him down quietly. Shoto can only watch as you handle him with a gentle care he isn’t privy to.

Without sparing another glance at Shoto, you start to walk away. He calls out your name hastily, and you can hear him clamber to his feet. Swallowing harshly, you look at him over your shoulder. Shoto looks out of place in your cozy living room, too large for the space. And yet, he appears small. His shoulders are hunched in as he reaches out to you with a face that begs you not to leave.

“He… needs to be put down for his nap,” you whisper, kissing Yami’s temple. “We… can talk after.”

Before you can regret your words, you head into his nursery, painted a soft yellow. You coo at your son, gently resting him in the large crib that took up most of the room’s space. You hum a lullaby to him as you stroke his hair, looking down at him with nothing but love.

Even long after he fell asleep, you don’t move. You stay there for a while, watching Yami so closely you don’t notice the presence at the door.

Shoto’s voice comes in a whisper. “He… He is mine, isn’t he?”

You can only nod, shame filling your soul as tears slip from your watery eyes. “His name is Yami,” you speak, your voice cracking.

Shoto flinches but waits patiently as he watches you come to a stand. He doesn’t rush you as you place Yami’s favourite stuffed animals by his side, leaning down and kissing his forehead before approaching Shoto.

“Let’s talk in my room,” you whisper, glancing at Yami before shutting the door behind you.

The two of you enter your room, the stifling air suffocating you as you shuffle over to your bed. Shaky hands reach for your pillows as you keep your back to the Todoroki, fluffing them to keep yourself busy. Your throat feels grating as you swallow down harshly. The room feels both hot and freezing, which you assume is his doing.

He doesn’t say anything either as he stares at the back of your head. Your hair looks different from the last time he saw you, and the clothes over your body aren’t articles he can remember you own. He thinks back to that night when quiet goodbyes were whispered between sweaty sheets. He wonders what went wrong.

His eyes wander, his frightful gaze tearing away from you only to look around your room. There are remnants of you everywhere. Family pictures hang from the walls, and old posters he vaguely remembers from your apartment are pasted against grey paint. It was you, but different. It wasn’t as colourful as your old room, and your trinkets are either out of sight or gone altogether.

When his eyes rest on you once more, a million questions run through his mind. Why did you leave him without a word? Images of your child, the very one who bore a striking resemblance to himself, flash in the forefront of his mind.

“How have you been?” you croak out after too many beats of silence. Hugging a pillow to your chest, you turn ever so slightly, only glancing at him from the corner of your eye as if it were painful to even look at him. Perhaps it is.

Shoto can only stare at you in disbelief, his brows curling upward as his heartache shines through. “How have I been?” he repeats breathily, his low voice raising half an octave. His mouth opens, but the words die on his tongue. Only after an excruciatingly long moment does he find the words again. “I’ve been miserable. You were gone.”

You wince at the strain in his voice, gripping the pillow even tighter. Your knuckles whiten under your tight hold. “I’m sorry,” you whisper pathetically, swallowing the lump in your throat painfully.

“Why?” he asks again, his voice cracking as he takes a tentative step toward you. “Why did you disappear?” Shoto reaches for you, stopping just short of grabbing you by the shoulders. He can’t tell if he wants to shake you until you see sense or hug you and never let go.

“I had to,” you urge, finally meeting his eyes. Your breath hitches, and you regret turning to him, but now you can’t look away. Those mismatched eyes that used to bore into yours with unreadable emotion as he draped his body over yours were tired, dull, and pained.

Shoto is the first to break eye contact, staring at your floorboards as he attempts to string together his thoughts. “Was it me?”

With furrowed brows, you shake your head no. “Shoto—”

“If I knew,” he rushes out, interrupting you. His gaze drops to your stomach, and he imagines what you might’ve looked like, swollen with his child. “If I knew, I would’ve come back sooner. Fuck the mission, you needed me and I…” He cuts himself off, bringing his hands up to your shoulders. His grip is tight enough to force you to look at him straight on, yet gentle. You think you can feel them trembling over your clothes, but you aren’t sure if you’re imagining it or not. “I’m so sorry,” he almost cries. The pillow in your hands falls to the carpeted floor, but neither of you cares to pay attention to it.

“Shoto, no,” you whisper, cupping his cheeks as you press your lips together. You thumb away his unshed tears. “That’s not why I left.”

“Then why?” he breathes.

You purse your lips, biting at the inside of your cheek as you reflect on those lonely nights spent under cold blankets. “You’re a hero,” you speak slowly. “I never had a place in your life, Shoto, not really. I’m a nobody. If… If I stayed, I would have been holding you back. You deserved more than that.”

Shoto narrows his eyes at you. “I deserve you,” he blurts, his tongue stained with vexation at the mere implication of your words. You watch as his lower lip wobbles momentarily before he steels his expression. “It isn’t your place to decide whether or not you should be in my life. That’s something for me to decide, but you took that away from me.”

“Took what away, Shoto?” you exclaim, raising your voice for the first time that day. “The sex? The comradery? You could have easily found that in someone else.” It hurts to admit, but you know it’s true. During those days together, you were a mere placeholder for someone better than you. Someone who could relate to him more than a nobody civilian could ever hope to.

After all, Pro Hero Shoto could have anyone he wanted.

Any anger left in his body dissipates as his body tenses. His face scrunches into something painful, mouth ajar and eyes wide as his grip on your shoulders tightens slightly. “What?” he whispers, the word dripping from his tongue like ice water. “What are you talking about?” The room feels like it’s dropped a few degrees, and if the frost that clings to his skin is any indication, it might have.

Averting your gaze, you try to wedge yourself out of his tight hold, but he doesn’t let you, taking another step forward. You’re practically chest-to-chest as he shakes your shoulders gently. “What are you talking about?” he repeats with an urgent tongue. “Someone else? What are you talking about?”

You heave a sigh. “Don’t play dumb, Shoto. You’re… you. You could easily find someone to replace me.”

“Is that what you think?” he breathes harshly, steam rolling off his skin, melting the frost. “That you’re just some replaceable body in my bed? Do you really think that lowly of me?” His expression twists as he reaches up to cup your jaw. His touch is burning, and yet you find yourself leaning into his palm.

“Isn’t it the truth?” you murmur, your voice catching. “I’m not anyone special, Shoto.”

“You’re my girlfriend,” he spits out, angry at the notion that you were a nobody. “You’re special to me. Isn’t that all that matters? I couldn’t care less about the fact that you’re not a hero. That never mattered to me, so don’t give me that bullshit.”

Your eyes snap open as you stare at Shoto in shock. You feel your body freeze over, and suddenly, your lungs are empty. “... What did you call me?” you croak.

Shoto stares deeply into your eyes, his own darting back and forth as he tries to read you. “My girlfriend.” His voice wavers as he tries to understand why you look so confused.

“We weren’t dating,” you cry incredulously. “What are you talking about?” You watch Shoto as realization washes over his distraught expression and something within you cracks. “Shoto, what are you talking about?” you ask again with a frantic pull to your voice. Shoto’s hands slip from your shoulders.

“Weren’t we?” he whispers quietly, any strength sapping from his body as he limply stands before you.

With your heart beating faster than ever, your breath leaves chapped lips in uneven puffs of strangled air. “We never talked about being anything more than just…” You trail off, the past couple of years draping over your shoulders, weighing you down heavily.

“You thought I was with you for the sex?” Shoto doesn’t know how to feel or how to act. His face twists as several emotions run through him before his mind settles on heartache. His multicoloured eyes try to meet yours, but you’ve already looked away. He moves his body, craning his neck to take a good look at you. He wants to see you. He wants you to see him. He utters your name in a broken whisper. “It was never just sex for me, baby,” he declares, his voice cracking in sorrow. “You had to have known that.”

He moves closer, cradling your face as he gently forces you to look at him. When he sees the indecisive glaze that’s taken over your eyes, he feels his heart break just a little more. “Please tell me you knew. That you know it was more than that.”

You blink away tears, your chest rising and falling quickly as you meet his intensive gaze. “You’d only come to me at night,” you mutter, caught between wanting to lean into his touch and wanting to pull his hands off of you. “You never stayed. You were always gone in the morning, Shoto. What was I supposed to believe?”

Shoto fights back a wince as he mulls over your words. He sighs, absentmindedly rubbing your cheeks with his thumbs. “I was so busy with hero work,” he murmurs in horror-filled realization, frowning at himself. He shakes his head, his shaggy hair falling into his eyes. “That’s not an excuse. I should have tried harder to be around. But it was never just sex for me.”

His throat bobs as he swallows thickly, his forehead coming down to rest against yours. His eyes flutter closed, wet eyelashes sticking together as he lets out a trembling breath. “Please believe me, baby,” he pleads quietly. “I’ll be better. I’ll show you I love you. I’ll make sure you know this time, so please…”

Those three words pull the air from your lungs, but when he opens his eyes, you’re left truly breathless. Love, sorrow, and regret swirl in his blue and grey hues. You don’t remember the last time you’ve looked at Shoto like this. “Please come back to me.”

“Shoto—”

“I’ll stop being a hero,” he interrupts you, a deep frown tugging at his lips. “If that’s what it takes.”

You make a face, your brows knitting together tightly. “Don’t be stupid, Shoto,” you hush. “Being a hero is your life. I’d never ask you to throw that away for me.”

“You’re my life,” he presses. One of Shoto’s hands moves to cup the back of your head, carding through your hair. “Our child will be my life. You matter more to me than anything else.”

Sighing, you close your eyes as you lean into his touch. “I’d be even more upset if you gave up,” you murmur. “I understand that being a hero leaves you with little free time. So—”

“No,” Shoto cries out. “Don’t make excuses for me. I should’ve tried harder. I should have realized things between us weren’t clear.” He pauses for a moment, his brow bone tensing as he bites at his lip. “Do you love me?”

With a softened gaze, you knock on his forehead with a weak fist. “You’ve always been it for me, Sho.”

Shoto smiles at the nickname, a slight tick of the corner of his mouth. If you hadn’t been so close and hadn’t known his expressions as well as you did, you might’ve missed it. He leans closer, his nose brushing against your cheek as he kisses your tear-stained skin sweetly. “I love you,” he hushes, tugging you closer. His fingertips trail up your spine until they’re entwined in your hair. “I love you.”

A shiver runs down your spine at the sensation as you curl into him. Your hands trail up his broad chest as you wrap your arms around his neck. Inhaling deeply, you stare at him in hesitation. “Is this real?” you murmur, your mind swirling with the vivid dreams you’ve procured over the years. “You’re really here, right? And you really…”

“I love you,” he says again. He says it one, two, three more times, whispering into the side of your neck and he nudges himself into the empty space. His lips, which are cold against your blistering heat, brush against your earlobe as he all but whimpers your name. “This is real. I’m here, baby.”

You can’t help but believe him, your eyes closing as he presses kiss after kiss on your skin, moving down your neck until he’s reached your collarbones. He nips at the spot, his tongue jutting out to soothe the darkening mark he’s left behind. “Sho,” you scold weakly, your nails scraping against his scalp gently as you brush his hair out of his face.

Shoto grins boyishly at you, his hands resting on your hips as he guides you backwards, stepping over the forgotten pillow you dropped. “Let me show you,” he breathes out, looking down at you with wide eyes until he has you sat on the edge of your unmade bed. “Let me show you how much I love you.”

Then, he pauses, a brief flash of bashfulness flickering behind his embering gaze. “Please?”

You’re reaching out for him before you can answer, tugging him down to your height. You don’t reply with words, pressing desperate lips against his as you pull him over you until he’s pinned over your trembling body. Strong forearms rest beside your head, his skillful tongue swiping along the seam of your mouth. You almost moan at his taste—a taste you never forgot.

Shoto slants himself against you, your bodies resembling a mess of limbs. He flips you over with ease, strong hands gripping your hips to seat you atop his shaking lap. The shivers that run down the expanse of his body don’t go unnoticed, and you peck his lips once, then twice, before pulling away. He’s staring up at you breathlessly, lust-blown eyes dark but widened as he takes in the sight of you.

“Are you okay?” you whisper, stroking along the edge of his scar. Shoto leans into your palm, his eyes briefly fluttering closed, relishing in your warmth that he was deprived of for so long.

“I’m okay,” he murmurs back, brushing his lips against your palm. “I’ve just missed you so much.”

Your heart aches at his soft-spoken admission, and you kiss him again to tell him I missed you, too. This kiss is sweeter than the last, softer in its closed-mouth motions. His hand reaches up to palm your jawline, his other remaining on your hip. He sighs into you, breaking the kiss to leave fleeting pecks over your cheeks. “My pretty girl,” he whispers into your skin.

His hand trails up and down your side, as he gently pushes you against his growing erection. You let out a whimper at just how hard he already is, the tent pushing against your clothed cunt teasingly. Grinding your hips down, you relish in the gasp Shoto lets out. Busying his hands with the hem of your loose tee, he pushes himself off of the bed to chase your lips.

Shoto kisses you with a fervour you damned yourself for running away from. He kisses you like he needs your taste on his tongue to live, like you’re a lifeline, and he’s teetering on the edge. Gentle teeth scrape against your bottom lip, just barely grazing your swollen skin. Pulling away to rid you of your top, Shoto bites his lips at the sight of your bare chest. He lays back, propping his head up on your pillows. Tracing a hand down his strong pecs, you tilt your head back at the sight of his complete enamour.

Red cheeks hollow as he takes in a shuddering breath, looking up at you with nothing but love and adoration. “You’re perfect,” he breathes out, his hands tracing your sides so slowly. His thumbs, calloused from years of hero work, barely graze the underside of your breasts before his hands trail back down to your thighs.

“Take these off f’me,” Shoto urges, tugging gently on the fabric of your shorts. Those dark eyes never leave your face, as though he’s committing it to memory.

You don’t hesitate to obey his request, shifting off of his lap just enough to tug off the last of your clothing, fingers dipping beneath the band of your panties to take them off as well. Shivering, you sit back down on his lap, biting down on your bottom lip as you lean back. Shoto makes it clear how much he appreciates the view you’ve given him, his lustful gaze caressing your entire self. His eyes land on the apex of your thighs, and his bitten lips part in admiration.

A wide hand rests on your tummy, just below your belly button, as he gently pushes your hips back and forth. His other hand finds its way to your ass, gripping and rubbing the skin there in tandem with your movements.

You let out shallow breaths at the feeling of his rough jeans against your bare clit. You’re sure you’re sopping wet already, soaking the front of his pants with your slick, but you can’t find it in yourself to care when he’s looking at you like he’d cry if you stopped grinding down on him.

His eyes stay glued to where your hips meet, and he whispers your name lovingly. “C’mere,” he rasps out as he sits up with haste, wrapping those big arms around your midsection and pulling you even closer to him. Shoto kisses the tops of your breasts, moving up and up until his lips meet yours again in a searing kiss.

“Missed you s’much,” he gravels out against your lips, reaching up to cup your left tit. You whimper out when his thumb brushes against the hardened bud, his tongue following shortly after. His lips curl around your nipple as he kneads into you. Breaths leave your throat in shortened huffs as he bites down gently.

Pushing you gently, you find yourself on your back again with Shoto hovering over you. He lets go of your nipple with a pop, lips shiny with saliva as he kisses down your stomach. Arching into his affections, all you can do is lay there and bask in his gentle touches and sweet kisses.

“Sho,” you whimper out when he mouths your skin lower and lower. Strong hands push your hips up until your dripping cunt is in front of his face, and your legs are dangling over his shoulders. Your back arches deeply, his fingers digging into your sides to keep your bottom half suspended in the air. It’s almost embarrassing how wet you’ve gotten—you can’t recall the last time you’ve felt this aroused. “Please…”

Shoto smiles at you softly, looking at you through his lashes as he brushes his lips against your clit, making you jolt. “Patience, baby,” he chuckled. “I haven’t tasted your sweet pussy in too long. Let me take my time with you, yeah?”

When he asks so nicely, how can you refuse?

He leaves open-mouthed kisses where your inner thigh meets your pelvis, kissing and licking just around where you need him most. Pathetic moans slip through your wobbling lips as you press them together, trying not to be too loud. Your body is goo in his hands, and he knows this well. He easily keeps your back arched up off the bed, his beefy arms not straining at all.

When his lips finally close on your weeping cunny, you cry out louder than intended. “Shh,” he whispers, sitting back just far enough to leave you whimpering for more. “Don’t wanna wake the baby, do you?” Those teasing eyes meet yours again, and his teasing expression softens ever so slightly at your already fucked out look. “Be good and quiet f’me, love.”

“Okay,” you stammer out, screwing your eyes shut when he kitten licks at your slit.

Shoto kisses your inner thigh with a grin. “Good girl.”

Without missing a beat, he attaches his lips to your pussy once more, his skilled tongue licking and prodding exactly where he knows it makes your legs shake in pleasure. He eats you out with such expertise as if it hasn’t been over two years. You wouldn’t be surprised if he had a map of your body memorized.

Long, thick fingers push at your entrance, just barely pushing in before pulling out. “More, please,” you beg under your breath, arching into his mouth. “Please, Sho. I can take it.”

Shoto hums as he sucks on your clit gently, drawing circles over the bundle of nerves immediately after. “I know you can, baby. This pussy was made just for me,” he sighs into you, the loud slurping noises coming from the point of contact making you curl in on yourself. “You were made just for me, baby.”

He finally pushes two fingers in, curling up just how you like it. He groans as his tongue moves with ardour, his eyes rolling back behind closed lids as he savours your taste. “Fuck,” he mumbles. “Missed this s’much.”

Shoto’s fingers push in and out, in and out, your slick gushing around them as the filthy sound of your clenching cunt fills the room. His lips are glued to your clit, drunk on your wetness as he fingers you deeply.

“I’m close,” you warn him, gripping the sheets tightly. Your body jerks, your thighs shaking and closing around his head as you feel the string in your tummy grow taught. “Sho—”

“I know,” he growls, kissing your clit again as he looks back up at you. He watches your face twist and scrunch in pure pleasure, moaning at the sight. Pushing a third finger in, his eyes slip closed at the feeling of you clenching tightly around him. “Come for me, baby. Need to feel you come.”

His voice drips with honey, coating your body in its warmth as your back bends. “Fuck,” you cry, slapping a hand over your mouth as your thighs tremble hard. “I—”

Before you can say anything else, you’re cumming around his fingers harder than you ever have in the time away from him. Fat tears line your lashline as he fingers you through your orgasm, lazily licking figure eights around your clit as he continues to push his fingers into you gently. He doesn’t stop, making you come again and again until you’re weakly pushing his head away.

His tongue laps your pussy clean, the lower half of his face covered in your slick when he finally sits back. You watch with lidded eyes as he wraps his lips around his fingers, his tongue jutting out to lick them until they’re no longer soaked with your essence. Moaning, you reach up for him, grasping weakly at his clothed chest. “Need you,” you plea, pushing at his clothes in a sad attempt to take them off.

Shoto only chuckles, leaning over to kiss you. He tastes of mint and musk, the taste of your come on his tongue making your eyes cross. He holds you tight, pressing you against his chest, and his hands run up and down the length of your spine. His head tilts, his mouth ajar as he licks into your wet cavern.

Leaning back, you kiss and lick at his face, cleaning him of your juices. He only sighs blissfully at your ministrations, stroking your hair out of your face as he presses his lips against your temple. “I love you,” he murmurs. “God, do I love you.”

You leave one more kiss along his jaw, settling back onto the mattress as you look up at him. His hair is messy, tousled from the many breathless kisses you’ve exchanged in the last hour. His rouge-tinted cheeks make him look younger than he is, yet you can see fine lines at the corners of his eyes and between his brows.

“I love you, Sho,” you declare softly, tucking his long bangs behind his ears. He gazes at you with more affection than you think you’ve ever seen him express, and it takes everything in you not to combust on the spot. You trail one hand down his chest, dropping down to his tented pants. Palming his clothed hardness, you glance at him pleadingly, smiling at the moan he emits the second your hand grazes his hard-on. “I need you now, please.”

Shoto nods, kissing the crown of your head before leaning back. You watch with careful eyes as he undresses, his hands moving with less grace than he’s known for. As he fumbles off his shirt, you unbuckle his belt, throwing it haphazardly across the room. You barely register the thud it makes as you tug down his pants. His hard cock slaps against his abdomen, coated with precum.

Fully nude, you sit back to admire Shoto in his entirety. There are many scars you don’t remember littered over his muscled body, and your fingers trace them gently. “I almost forgot how pretty you are,” you say, sitting up to kiss his collarbone.

“Pretty?” he repeats, laughing softly as he grips at your waist.

You hum. “Very pretty, Sho.”

Unable to wait any longer, he manoeuvres you back onto the pillows, adjusting you as he places one beneath your hips. “Gotta have you now, baby,” he groans into you, reaching down to fuck into his fist. You watch with wide eyes as he rubs himself for a moment more, pushing your thighs up against your chest.

Pushing his angry cockhead against your slit, he thrusts shallowly against your soaked pussy. A low moan rumbles out of his throat when his head catches on the hood of your clit. He uses a thumb to guide his length to your entrance, a whimper of your name tumbling from those bite-swollen lips once he finally pushes into you.

Your jaw drops as a wanton noise claws out of your throat. Shoto is sure to move slowly, only moving in an inch of his dick at a time before pulling out. You had forgotten how thick Shoto’s cock is, the stretch of your swollen pussy around his length burning through your body. “S-Sho…”

He groans at your voice, dropping his head to your shoulder as he fucks into you slowly. “I know, baby,” he lets out breathlessly. “I know. You’re doing so well f’me.”

His hips finally press against you after some time, his dick pushing against your pulsing gummy walls. He stills, letting you get used to the intrusion as he kisses you again and again. Propping himself on his elbows, he shakily brushes your hair out of your face, kissing your forehead. “You okay, baby?”

Nodding fervently, you wrap your arms around his neck, pushing his chest flush against yours. “Yeah.” Your voice comes out weakly, barely above a whisper. “You can move—” correcting yourself, you look up at him with pleading eyes. “—please move.”

Without another word, he pulls out slowly, only to thrust back into your hole nice and deep. A loud groan leaves his lips as he settles into a quick tempo, his hips slapping against the back of your thighs as he starts to really fuck into you.

Barely keeping your eyes open, you watch his expression twist with gratification, his brows tilting upwards as his lips part. With lidded eyes, he watches you, too. “You’re—fuck—so pretty,” he whimpers, pressing his forehead against yours as his thrusts become faster. “Missed you. Missed you s’much.”

Sitting up, he grabs at your waist as he fucks you zealously. His thumb flicks at your clit, rubbing tight circles that leave your legs shaking. His cockhead rubs at that spongey spot in your cunt with every thrust, making your eyes roll back. “Sho,” you cry out, the thought of keeping your voice down long gone in your pleasure. “Sho, Sho—!”

His mouth opens as he lets out a stunted shout riddled with lust and overstimulation. “You’re so fucking tight,” he grins down at you, his stomach flexing with each movement of his hips. “Fuck, baby. Can feel you clenching around me s’tight. Are you close?” His words come out harshly, exertion tugging them from his throat sluggishly.

His thumb never stops over your clit, moving in tandem with his hips as he slams into you. Unable to form coherent words, you can only cry out in vague confirmation, grabbing at his forearms. You can feel your slick dripping down the slope of your ass, soaking into your pillow and the sheets beneath you.

Shoto’s smile falters as he feels his own orgasm near, his rhythm becoming desperate as his eyes screwed shut. His head drops, his mouth opening slightly as he chases his high. When your cunt grips tightly around him, he’s sure he’s going to lose it. Harsh breaths heave out of him, his flushed skin causing his hair to stick to his forehead.

“Come for me again, baby,” he begs, barely able to pry his lids open to look down at you. “Please, come, please, please… Gotta feel you…!”

Whether it’s from his words, the whimpering tone that tugs at his voice, or the way his cock throbs inside you as he nears his own high, you feel your orgasm crash over you in waves. “Shoto,” you sob, your body jerking violently as you come hard. He lets out a high-pitched groan as he releases inside you, his thick seed filling you up in seconds. His hips tremble and twitch as he keeps shallowly thrusting, pushing both you and himself into overstimulation.

“I love you,” he mewls, pressing his lips against yours in a hungry kiss as he wraps his arms tightly around your middle. Without pulling out, he slumps over you, knocking the air out of your lungs.

Laughing quietly, you weakly push at his shoulder. “You’re heavy,” you complain, still breathless from the countless orgasms he’s pulled you through. “Get off, Sho.”

“No,” he murmurs into the nape of your neck, cuddling into you tightly. “Don’t wanna let go.”

You roll your eyes. “You can hug me without crushing my ribs.”

Huffing, he rolls off of you, taking you with him as he lands on his back. You both groan lowly at the movement, his dick twitching inside you once you settle onto his lap again. “You’re insatiable,” you comment, feeling him thrust weakly up into your wetness.

Shoto only grins up at you, showing off that rare smile you missed so dearly. “You can’t blame me,” he tells you, wrapping his arms around you. “I have so many years of love to show you.” He kisses your shoulder. “I meant it. Before, I mean. You are everything to me, and I know our baby will be too.”

Your eyes wet again, fresh tears bubbling at the corners before dribbling down your cheeks. “Shoto…”

Looking up at you, he stares with an indescribable look in his mismatched eyes. “I wanna be in your life. I want to be in his life, too, if you’ll let me.” Leaning up, he kisses you sweetly. “So, please, come back to me.”

You only manage to nod tearfully before the shrill cry of your baby echoes throughout the house. Shoto eases you off his messy cock, watching as his release dribbles out of you. He lets out a breath, kissing you sweetly before moving you off of him gently. No words are exchanged as Shoto throws his clothes back on, wrinkled and unkempt. He pauses to wipe you clean, using your shirt, after throwing you an apologetic glance.

A smile reaches your eyes as you watch Shoto bound out of the room to get your child.

2K notes · View notes