#Give Me A Sign?

[cigarretteluvr]

white card-stock, black ink

my heart poured into paper

double stamped and sealed in gold

just to make sure it got to you

did it get to you?

[hansoeii]

crowley

[urmykindofwoman]

im thankful im okay its great we are good at least im not at least its not i just have to be thankful this happening now means good things are why is this why whatever it’s literally not that big of a deal it’s literally at least i have food and water im thankful for everything it could be worse but i just i just its whatever i don’t i just wish

[itseghost]

the rude blacksmith has enchanted me. also feeling so normal about this game that i did pixel art for the first time ever to try and draw my farmer in the game style

[videogamelover99]

Alex Hirsch going "I'd be interested in exploring Bill confronting all of his lies" during the Seattle book signing and him going "This is my child. Please be kind to him. He doesn't deserve it though." during the San Diego book signing...

It makes me incredibly happy that he's just as obsessed with this problem triangle as we are.

[happyfirstpri]

Nothing more homo than having parallel or mirroring nicknames with your rival since childhood

Charles Leclerc and Max Verstappen. Also known as:

the phoenix and the dragon

the sun of maranello and the rain of milton keynes

il predestinato (the predestined) and the inevitable

eterni rivali (eternal rivals)

Eterni rivali is so sexy, like imagine signing off letters with that?

“Il tuo Eterno Rivale,

[insert name]”

HOT. SEXY. I’D KISS YOU ON THE LIPS.

[thepermanentrainpress]

UNDER THE RADAR: FEBRUARY 2023

1) Francis Arevalo - “I Can’t Wait”

A searing passion and power defines Arevalo’s new single. Reworked and refined, it was written about “facing one’s own mortality after a difficult mental health struggle,” and circles around notions of commitment, purpose and community. His cultural, lived experiences and advocacy for mental health and BIPOC artists are reflected in his work; he has agency over decisions made in the present, and chooses to forge ahead while being a rally cry for those around him. It’s a groovy hip hop track with cascading live instruments (drums, guitar, bass, keys, turntables) and fervent delivery—I’m not surprised to read that he has a slam poetry background.   

I am not a big rap/hip hop listener, but I was drawn towards the uplifting wordplay (“we could be brave with the hurt / you’re here / there is reason for birth”) that is not just about oneself, but both blood and chosen family. Manifesting dreams requires clarity, visualization, gratitude and mindfulness, traits that aren’t lacking in this artist. Expect his debut album 0427 Act I: HEATCHECK! this April. 

Written by: Chloe Hoy

2) Ayla Tesler-Mabé - “Give Me A Sign?”

This track has a very funky and upbeat sound. It's a powerful mix of R&B, rock, and even jazz, creating a soulful style. There's a lot of pep and energy in both the music and vocals here. Ayla expresses herself with a tone of voice and emotion mature beyond her years. The lyrics tell a tale of a relationship that isn't all it should be - the singer really wants things to be all they could be, if the other party could just "give me a sign." This is a song with a timeless vibe finely engineered for a very enjoyable listen. 

This is her debut single as a solo artist and it shows a lot of spirit and promise. It's a great introduction that will leave one hooked. If this is just a first taste of her upcoming EP, I'm very excited to see what else is to come.

Written by: Cazzy Lewchuk

3) Stay Lunar - “i like it when you’re around”

I just love Stay Lunar—they create all-around winners. A song celebrating friendship and the comfort and love received during times of need, it still has a bright glow. Heavier on the guitars and drums, it comes off as more of a peppier indie rock cut as opposed to their pop-centered, synth-laden past. It can be hard to express our feelings to those around us, much less be honest with ourselves; the ebb and flow is heard in the tone, narrating long-term adversity (“i know it's over but we're living in it / some things they take a while to leave”) and the striking contrast between solitude and company.

It’s so easy to be enveloped in their music. The Bristol band is set to release an EP later this year.

Written by: Chloe Hoy

4) Trina Kae - "Paris in the Fall”

Enamored in a new place of possibility at every corner, the Okanagan’s Trina Kae has fond memories of backpacking around the world post-college. Set in Paris, the song captures wonder and discovery in beauty only found through travel—and maybe some accompanying spirits ("Remember when you were dreaming beside the Seine / Lost again in a cabernet lens”). Her breathy voice cuts deep as it’s almost woeful in tone, nostalgic in the “glow of being immersed in the moment.” I like the alt pop layering; not flashy but achieves the airy and wistful mood it intends with sharp beats entering midway through.

In addition, the use of lyrics in French strengthens the story and reflection. “Paris in the Fall” is appropriately dramatic, but with the magic and intoxicating feeling of an unfamiliar and culturally rich city. Kae’s debut album Narrative is out now.

Written by: Chloe Hoy

5) Flint - “Days & Nights”

Embodying a carefree spirit and a license to party, Tony Rosenberg and Peter Jenner encourage you to leave your troubles at the door. The Brisbane rockers have a controlled punch to their rock n’ roll. It’s anthemic while giving off an air of intrigue, a fast bass line and lyrics that are sang as self-assured statements. The pair has a fun musical style – a matured tone but a refusal to settle (“rearranged my focus and handed in my notice”). “Days & Nights” is a reminder that older and wiser are not always synonymous in life, and good times will triumph if we prioritize them.

Days & Nights by Flint.

Written by: Chloe Hoy

6) Glow Motive - “Show Me You're Here” 

This song does the not-easy task of being soft with a low tempo, but also groovy and complexly crafted. The complicated arrangement is appropriate for the subject matter - a meditation on grief and trying to find their presence in dealing with the loss of a family member. It is layered and clearly recorded with love and sincerity. One can really hear the difficult, sometimes contradictory feelings in the singers’ vocals as they strive to communicate with the departed. Not a second is wasted as the pitch and harmonies evolve, the music bridges, and the time signature switches. It's a wave of emotion that will move the listener, creating a pleasant yet poignant sound.

This is the first single released by Glow Motive, a collaboration between emerging artists Anjalica Solomon and Oceaan Pendharkar. This collective has highlighted and enhanced their identities within the brown, queer local musician community. I'm sure this is just the beginning of beautiful art as represented by them, with a bright future ahead.

Show Me You're Here by Glow Motive

Written by: Cazzy Lewchuk

[caspervi]

Super quick doodle

[poorly-drawn-mdzs]

Don't Wormy About Me.

[First] Prev <–-> Next

[lazylittledragon]

do any other artists feel like. yeah you're a 'good artist' because you draw things that look nice, but like. TECHNICALLY? you're really not great

i really hate that i can recognise that yes, my art is good, but is it VARIED? is it dynamic?? is my anatomy good? is it full of texture and colour theory? do i know how to do This? can i do That? no, not really. and that's quite painful actually

[hellsitegenetics]

hello!

i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).

i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.

my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.

bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.

okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt

Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)

[glittergroovy]

[bruciemilf]

I wonder how many times Clark and the batkids + Alfred revived Bruce with the Lazarus Pit and just never told him abt it

[pucksandpower]

… and so it continues.

The way that Williams Racing has nearly completely lost the lovable underdog reputation they have carefully cultivated over the last few seasons in record time needs to be studied.

[kohhomaru]

Did you lock the door on him…?

[daily-odile]

drew a scene from @dunkalfredo's modern/scifi au... it's so good