#and i crave giving it

[kikker-oma]

If you could change one (1) thing in the LoZ-franshise and it would become canon, what would you change?

Ooohhh I've seen some of these milling around!!

For me I would change this:

LET THEM HUG DANGIT☹️

Like, im a romantic at heart, so I always would prefer to think Zelink is cannon, but even if they explicitly were confirmed as just friends or even if they ended up being family - LET THEM HUG AT THE END😭🥺

I love hugging my friends and family!! I adore showing physical affection! I've hugged coworkers and held hands with members at work to comfort them when theyre upset (if they initiated. Im not that dense to be touching strangers without consent lol. Ill ask people if i dont know them well enough to know what theyre ok with).

All of this to say: I don't feel good and I want hugs, so thats my answer lol. (Though believable lore/timeline connecting the games would be fantastic haha))

[egophiliac]

ENG PLAYERS I BESEECH YOU

I have been informed that you guys are getting part 4 of episode 7 tomorrow, which means we are FINALLY going to get the official romanization of Revaan's name, somebody please tell me because I need to know what it is.

like, yes, it's probably just Revan/Levan, but look, I'm sitting here with my finger over the button of all these Laverne and Shirley jokes and just waiting for the opportunity to deploy them --

[toshidou]

can't stop thinking of domestic ghost learning how to crochet after he sees you practicing, large scarred, battle worn hands working away with a crochet hook and wool; not missing the way your eyes go fond as he joins you on the couch to crochet by your side. trying to suppress your giggle at the soft sounds of his frustrated grunts when he tries (and fails) to tie the slip knot for the 5th time in a row before he turns to you with a blank expression, arms extended in your direction.

what starts as slowly mastering little granny squares quickly evolves into working on whole projects; clothes, hats, face masks, stuffed animals. your house slowly fills up with both yours and his creations. although it's something you mostly do together, it wouldn't be uncommon for you to come downstairs as the sun rises only to find Simon hunched over a ball of wool, clearly awoken from a night of terrors and craving comfort from the repetition that crocheting provides.

he'd inevitably have to leave for deployment, but not without laying out a new cardigan he'd made just for you (a way he can keep you warm despite the thousands of miles that might separate you) or a little crocheted plush of himself, fitted with its very own little mask; even giving you the option of dressing it in either combat gear or his go to black hoodie and jeans. it leaves you teary every time, clutching his new creation to your chest and nuzzling the soft wool into your cheek, always knowing that his hands were made for more than just war and death.

and if the day comes you finally bring a child into the world, you better believe he's making them an entire wardrobe that matches the clothes he's already made for the two of you; holding the completed tiny garments up whilst you try your absolute hardest to not burst into tears at how small they look, knowing they're so lucky to have a dad who's going to love them so, so much.

[nerdy-hyperfixations]

He just wants to be missed

[hellsitegenetics]

hello!

i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).

i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.

my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.

bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.

okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt

Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)

[sandboxer]

playing AAI ahead of the rerelease and I just felt the need to shout about this wonderful detail about Franziska’s (left) and Edgeworth’s (right) phones

obviously this game is a product of its time, but even for 2009 Edgeworth’s phone is a bit dated. it’s plain and utilitarian, and it is clearly meant for little more than phone calls. texting on that thing would be a chore (edit: likely impossible). Franziska’s, however, is more modern, suited to her aesthetic tastes, and even flips open sideways to reveal a full keyboard. I think this is mostly a bit of inconsequential world-building, but if nothing else, I think it gives credence to one fun thought: Edgeworth only makes phone calls, while Franziska prefers texting.

[screenshotsonpinterest]

Thinking about how Starkid’s raised nearly half a million dollars for Cinderella’s Castle simply by being transparent about where their money goes, being nice to their fan base, hiring unproblematic, talented people, and creating good, original art

[analogboii]

the duality of seonghwa is absolutely bonkers like??? tf you mean this man

is the same as this man

like UGGHHHHH SEONGHWA THE MAN THAT YOU AAAAREEEEEE 🛐🛐🛐🛐

[kedreeva]

Can't leave grocery bags on the ground because she will do her level best to empty them onto the floor. This is her sweet potato bag, which is serving as enrichment and distraction. She can't easily destroy the sweet potato, but she gets distracted trying. I had put it out for her to fuss with instead of being underfoot while I made flatbread, and after a minute Sark came out and took it away from her thinking she was getting into trouble. I had to explain it was on purpose this time. She's pretty good at differentiating "for bug" and "not for you" when told, and sticking to the things that are for Bug.

[edorazzi]

Page 7 of my Miraculous Mentor AU comic A Matter of Trust! In which a familiar box appears and Felix's life is about to change all over again...! ✨💍

Index | Prev | Next (coming soon!)

Weekly updates each Sunday! You can also read ahead early on Patreon, and/or buy me a Ko-fi if you'd like to support my work! 💖

[corxoran]

💗

[screwpinecaprice]

Sorted my folders and I actually added a dialogue to this?

[pinkyjulien]

x

[gojoest]

pregnancy freak satoru not letting you lift a finger let alone carry stuff, be it your purse even, bc you are with his child now and you are to sit back and let him take care of everything. the way he is so overprotective is very endearing really but gets a bit out of hand at some point when he offers to hand feed you during mealtimes so you don’t have to bother with the utensils. you want to teach him a lesson, hoping he’d read the room and stop treating you like you’re on your deathbed—you refuse to hold his cock, saying it’s too heavy. but instead you give him a boner and an ego boost. now he holds it for you whenever you suck him off….

[tanglepelt]

Dc x dp idea 33

There is a battle going on. Between the justice/young justice/teen titans (any of them work) and some threat from the infinite realms.

The team is loosing, none of there weapons are working and magic isn’t working either.

A glowing green portal and Danny is dragged through by cujo. Danny yells at cujo to heel. Just for cujo to stop in the middle of the battle.

Danny looks around and sees what happening. He confronts the ones from the infinite realm demanding to know what was done to cause a fight. Demanding to know if they had threatened the realm. Had they broken any law against the realm.

The answer was no. They taunt him tho that he doesn’t stand a chance against them. He is just a lone child a mere baby by there standards.

Danny looks at them and scoffs at them. Just starts walking towards them.

Obviously the dc team tries to get him to stop. Danny looks back at them eyes glowing green a ice wall forming between them.

Danny turns back to those from his realm and transforms. Crown appearing above his head. He speaks of how he defeated vortex, undergrowth and nocturne. He has learned from pandora, frostbite and clockwork. United the realms. He lead the group that sealed away pariah. Danny just tells them to run.

And they do.

Danny transforms back. Ice wall down when he goes to apologize for them cujo knocks him down. Cujo is just full on him licking him.

[the-cozy-chibbutts-cottage]

I am open for waist up commissions! They're $150 and I'd just need a character reference to go off of. You can message me to claim or comment! Thank u for the support ❤❤