#FAQs.

[bonesandthebees]

one of the most infuriating things about becoming an adult is when you realize that it actually is 10x easier to solve problems by making a phone call vs literally any other communication method

[nymphoutofwater]

And why? Cultural norms? Personal schedule? “Cause I’m always late to everything”?

Bonus points: Region and/or ethnicity?

[phonemantra-blog]

The off-road SUV market is heating up with the upcoming Mahindra Thar 5-door. This article explores 5 reasons why waiting for this practical and potentially feature-rich variant might be the smarter choice for adventure seekers and families. The Booming Off-Road SUV Market: Mahindra Thar Leads the Charge The past few years have witnessed a surge in demand for off-road-capable SUVs. The arrival of the second-generation Mahindra Thar (initially available only in a 3-door version) ignited this trend. Maruti Jimny's subsequent launch with its 5-door practicality further expanded options. For those seeking a more utilitarian option, the Force Gurkha (also a 3-door) remains a contender. However, the upcoming Mahindra Thar 5-door promises to shake things up with its combination of off-road prowess and family-friendly functionality. The Mahindra Thar 5-door 5 Reasons Why the Mahindra Thar 5-door Might Be Worth the Wait Here are five compelling reasons why waiting for the Mahindra Thar 5-door might be the wisest decision for off-road enthusiasts and families alike: Enhanced Design and Functionality: Building on a Strong Foundation: The Thar 5-door takes the successful formula of the 3-door model and extends its wheelbase to accommodate two additional doors. This transformation enhances practicality and improves passenger comfort, making it a more family-friendly option. Evolutionary Design: While the overall look will likely retain the signature Thar aesthetic, spy shots hint at subtle design tweaks. These may include circular LED headlights, a refreshed grille, and the potential introduction of a fixed metal top (currently unavailable on the 3-door Thar). A More Premium Cabin Experience: Familiar Layout with Modern Touches: The Thar 5-door dashboard is expected to retain the core layout of the 3-door model. However, advancements are likely in the form of larger and more modern displays (touchscreen infotainment system and instrument cluster). A redesigned climate control panel is also anticipated. Improved Material Quality and Theme: While specific details remain under wraps, the 5-door Thar might boast an upgraded cabin environment with potentially higher-quality materials and a fresh color theme, elevating the overall driving experience. A Feature-Packed Offering: Technological Advancements: The Thar 5-door is expected to be equipped with a feature-rich cabin. This may include a sizeable 10.25-inch touchscreen infotainment unit, a matching 10.25-inch fully digital driver's display, dual-zone climate control with dedicated rear vents, a sunroof for enhanced passenger comfort, and a rear center armrest for added convenience. Enhanced Safety Features: Safety is paramount, and the Thar 5-door is likely to prioritize this aspect with features like six airbags, a 360-degree camera for improved situational awareness, and a reversing camera with front parking sensors to assist with maneuvering in tight spaces. Familiar Yet Potentially Upgraded Powertrains: Proven Engines: Mahindra is expected to retain the tried-and-tested engine options from the 3-door Thar - a 2.0-liter turbo-petrol engine and a 2.2-liter diesel engine. However, there's a possibility of these engines receiving power upgrades to compensate for the increased weight of the 5-door variant. Transmission Options and Drivetrain Variations: Both engines are likely to be offered with the option of a 6-speed manual transmission and a modern automatic transmission, catering to different driving preferences. The Thar 5-door is also expected to retain the option of both rear-wheel-drive (RWD) and 4-wheel-drive (4WD) configurations, ensuring off-road capability for those seeking adventure. Unveiling and Launch Timeline: Market-Ready Debut: Anticipation is building for the official unveiling of the Thar 5-door. Market sources suggest a reveal in market-ready form is scheduled for August 15, 2024, with a subsequent launch expected shortly thereafter. Competitive Price Point: Price remains a key factor for many buyers. Industry estimates suggest a starting price of Rs 15 lakh (ex-showroom) for the Thar 5-door, making it a potentially strong contender against the Maruti Jimny and Force Gurkha 5-door in terms of both practicality and affordability. FAQs Q: When will the Mahindra Thar 5-door be launched? A: The Thar 5-door is expected to be unveiled in market-ready form on August 15, 2024, with a launch shortly thereafter. Q: What is the expected starting price of the Mahindra Thar 5-door? A: Industry estimates suggest a starting price of Rs 15 lakh (ex-showroom). Q: How will the Mahindra Thar 5-door compare to the Maruti Jimny and Force Gurkha? A: The Thar 5-door will offer a larger and potentially more feature-rich cabin compared to the Jimny. While the Gurkha prioritizes pure off-road capability, the Thar 5-door might strike a better balance between functionality and comfort. Q: Is the Mahindra Thar 5-door a good choice for families? A: With its additional doors and increased space, the Thar 5-door is expected to be a more family-friendly option compared to the 3-door Thar. However, the final decision depends on your specific needs and preferences.

[orpiknight]

Neil Gaiman Tumblr FAQ: Good Omens

Tumblr questions that Neil Gaiman has already answered. A collection of Asks from Neil's blog (@neil-gaiman).

Good Omens FAQ Links: Main / Season 1 Doc Season 2 Doc Index of All Other FAQ Parts

This FAQ covers questions for the full content of both the book and TV series. There are spoilers. Please check this before messaging me: OrpiKnight's FAQ FAQ

*This post has been edited since the original.

[hrokkall]

"Sad Cat Poem" by Spencer Madsen

[that-house]

Potion Vendor FAQs:

What’s your name? I am the Honorable Alchemist Zykocea the Radiant, but that’s mostly just a PR thing. My friends call me Zoe.

Do you sell love potions? No.

Do you sell potions of invisibility? No.

Do you sell fire resistance potions? No.

Why do I have a suitcase? Fuck if I know. Cool outfit though. Very goth.

Do you sell a potion to treat brain hemorrhaging? No.

So what CAN your potions do? I sell health potions.

Are you sure these are health potions? They do something to your health.

Is this just ditch water with some pink glitter? No.

Really? I’ll have you know I added some fruit juice too.

Why is this starting to sound like a conversation? Oh just you wait. We’re just getting started.

Is your business model legal? Fuck no. I poisoned the food safety inspector before they could snitch.

Did you just admit to murder? Just fucking try to convict me. I’ll poison the judge too.

So can you make poison potions? No.

Then where do you get the poison? I secrete it from my skin.

Are you shitting me? Yep, I’m shitting you. I have a guy. A poison guy. He DOES secrete it from his skin though.

How does that work? …Fuck if I know. Maybe a wizard did it. Damn, now I’m kinda curious.

You never asked? The idea of asking literally never crossed my mind.

Wanna ask him? Let’s do it. I don’t have anything better to do, and a road trip beats sitting around running my fraudulent potion business.

Road trip? He lives in Seattle.

Your poison guy lives in Seattle? All poison guys live in Seattle.

For real? All the poison guys I know live in Seattle.

And how many poison guys do you know? Just the one.

Why are you like this? Years of living on my potions. It changed me.

Do you know what his address is? Nope. He just mails me my poison in unmarked boxes.

You just get your poison in the mail? We already poisoned everyone who could do anything about it.

So how are we going to find him? We’ll figure that out eventually I’m sure.

Can I drive? God no. You can pick music, but I maintain veto rights. Make sure you pick something with a lot of questions if you want to sing along.

Where’s your car? The garage connects to my house, so you’re getting a little tour. Here’s the kitchen: only one of the stove burners works and I’m pretty sure the microwave is haunted.

Why do you think that? Because of the ghost that tries to kill me whenever I run it.

What’s in that room? That’s my bedroom. It’s pretty much just a mattress on the floor and every single Warrior cats book.

You were a Warriors kid? Yeah, and then I never found the time to put the books away. There’s so many fucking books. I use them in place of furniture because I can’t afford chairs.

Your fraudulent potion business doesn’t make much money? After buying all that poison I just about break even.

Can I see your potion brewing room? It’s right through here. Ignore the mess, running a fraudulent potion business takes a lot of prop work, but I’ve got all the glass tubes and colorful liquids you could ever want. This pink stuff is melted watermelon italian ice. Glitter vat is in the basement, and the famous ditch is in the backyard.

Is this your car? My beloved ‘72 Corolla. She’s beautiful, and don’t you dare imply otherwise.

Was she always this shade of muddy brown? …Yes.

Are you sure I can’t drive? Get in the fucking passenger seat and pick the music.

Let’s see, a song with questions in it, how about The Beach? That Wolf Alice song, yeah. That should work.

When will we three meet again, in thunder, lightning, in rain? Still sink our drinks like every weekend but I’m sick of circling the drain.

When will we meet eye to eye? We clink the glass but we look at the floor.

Are we still friends if all I feel is afraid? You’re not a bitch but just a bit when you’re bored.

Is that all we can sing together? Yep. Even that little bit was nice, though. It’s awkward, communicating through this FAQ format.

Got any food? Yeah, there’s a few days’ worth of snacks in the back.

Were you just… prepared to go on a road trip? Says the woman who brought a suitcase to an FAQ.

I did do that, didn’t I? I have a spare toothbrush in case you forgot yours. I’m pretty sure you did.

How did you know that? …I’m psychic.

Yeah? No.

You love lying, don’t you? I can’t stop. It’s fun. Way more fun than telling the truth.

Did you just miss a turn? Probably.

Are you sure we’re not lost? No.

You mean you’re sure we’re not lost? No, I mean I’m not sure we’re not lost.

Why did I come on this road trip? Surely it was my winning personality.

Would it help if I said it was? It would.

Is it getting dark? Soon.

Can you describe the sunset to me? An empyrean flame, red-gold towers of darkening clouds, the sky behind them an ever-deepening indigo. The great eye of the sun closes on the horizon. The road before us looks like a trail of spilled paint, an iridescent gash through the night-dark woods.

Did you know that you’d make a slightly better poet than you do a potion seller? That really isn’t saying much, huh. Good job making a statement like that in question form, though. You’re getting good at this.

Should we find a motel? Sure.

One room or two? One. It’s way cheaper, and like I said: I’m not the best potion vendor.

You’d make a good assassin, though, wouldn’t you? Shit, you might be right. I HAVE poisoned a lot of people.

Should I be endorsing this? You’re a grown woman who can make her own choices.

Would you like to consider it endorsed? I’ll consider considering it.

How many beds do you think there will be? Now that you’ve asked that, I’m gonna put my money on one. Hello, one room please. Thank you, we’ll be sure to enjoy our stay.

How many beds are there? One.

Oh no, what ever will we do? Move over, you motherfucker, you can’t have the whole bed.

Are you gonna make me? Yes. I am going to pick you up and drop you on your side of the bed.

How did you get so strong? You’re not gonna believe this, but it was the potions.

Oh yeah? I was right. You didn’t believe me.

For real though, how did you get so strong? Working out, duh. Not everything has some big crazy secret behind it. World’s still beautiful though.

Are you comfortable? This beats the mattress at home. A little chilly though.

Wanna cuddle–for warmth of course? God yes.

Are you asleep? …

Yes? …

Does this mean I can talk about you behind your back? …

What should I say? …

Did you know that I had a really nice day? …

Did you know that I think you’re beautiful? …

Did you know that I can’t remember anything from before today? …

Did you know that I don’t know who I am? …

Did you know that you’re basically the only thing stopping me from having a full-blown panic attack about all this shit? …

Did you know that you’re warm? …

Did you sleep well? Better than at home, that’s for sure.

Did you know that you snore? I hope I didn’t keep you up.

Does the pope shit in the woods? No, as far as I can tell. Oh my god. This is huge.

What is? You can give me yes and no answers now. I still can’t ask you questions, because this is a question and answer format, but I can offer leading statements and now you can answer them! This is wonderful!

Does a deer shit in the woods? Yes, it IS wonderful. Oh that’s amazing. You’re a genius.

You didn’t already know that? Hahaha!

Shall we get moving? Yeah, just let me grab something from the vending machine.

Can you get me something? Go ahead and place your order however you can.

You know those sour gummy watermelons? One pack of Sour Patch Watermelons coming right up. I’m gonna go get myself a potion.

Is that a Pepsi? It’s closer to a potion than the shit I sell.

Let me guess, passenger seat again? Right you are.

How fast are we going? You’ll feel safer if you just guess.

Is it more than 120 miles per hour? Like I said, it’s probably better if you don’t know.

150? Sit back, relax, and enjoy the ride.

How much do you trust this car? She hasn’t blown up on me yet.

Can you promise me we won’t crash? I can promise you anything you want.

And can you keep that promise? I- we can do anything. Reality is what we make of it, baby!

Then can I have a badass tattoo? As far as I can tell, you’ve always had it.

And a cool knife? Woah, cool knife.

So, we’re just playing “yes and” with the world? It’s a little more complicated than that, but you’re close enough to the mark.

So, if I was hungry, I could ask “is that a Burger King,” and it would be there? Try it and find out!

Is that a Burger King? Looks like it is! We’ll stop here if that’s alright with you.

Does a moose shit in the woods? Awesome.

Are you done eating? Yep.

Do we still have to pay if we skip over the transaction? Sadly, yes.

How much further do we have to go? Two more nights, the speed we’re going at.

Speaking of night, isn’t it getting dark? Shit, I guess it is.

Should we get another motel? Let me check to see if there’s any nearby. Fuck, nothing.

What’s the plan? Sleep in the car, I guess. This is gonna be hell on my back.

Wanna watch dumb videos on my phone until we fall asleep? There is literally nothing in the world that I would like more.

Ok, now which video? You have a very cute yawn. Just saying. Let’s watch this one next, it’s a classic. Oh, never mind. It looks like you’re asleep. As long as I keep talking, I think I can get away with making this into one answer, and you might not hear this. Now it’s my turn to talk about you behind your back. Keep talking keep talking keep talking can’t stop to think. Just have to say things. First off, I’m sorry for all the lies. It’s our only chance. I have to lie to you. I hope you’ll understand. It’s hard, though, because I think I’m falling in love all over again. Through our broken little ritual of call and response, you complete me. It just makes this hurt all the more. Keep talking keep talking keep talking don’t stop to…

Did I hear you saying anything as I fell asleep? …No. I can’t talk for long without you asking me a question.

Does that bother you? It got me here, didn’t it?

When did you start holding my hand? Some time after you passed out. I hope you don’t mind.

Can we stay like this for a while? Yeah. Yeah we can.

What was your life like before all this? Normal, as potion-brewing scams go. And if you don’t count all the murders. You haven’t told me much about yourself.

Did I tell you I used to be a biologist? You didn’t tell me that, and you didn’t tell me what you studied, either.

What do you know about venom? Not much, but I’m assuming you know a lot.

Does a box jellyfish kill within minutes? I’m going to assume the answer is yes based on context clues. Oh my god you must be on this road trip because you’re interested in studying my poison guy.

Is it not enough to wish to accompany a beautiful stranger on her quest? Aw, you’re sweet.

What could be the cause of his poison, though? I knew it! Get your ideas out, I’ll stay quiet.

I’m more knowledgeable about venom than poison, but could it be some sort of one in a trillion mutation? …

Did he get his body modified? …

What sort of surgery could do that? …

How is he still alive? …

Did a fucking wizard do it? …

WHY? …

HOW? …

Is there literally ANY explanation for why he’s like that? …

I’m done, do you have something you want to say? You’re cute when you’re all excited like that.

Can I drive today? Only because I like you. Now watch out, the brakes only work on one side so you have to kind of drift to a stop. And the headlights don’t work. And the windshield wipers cut power to the engine while they’re on.

Isn’t it weird that we’ll be there tomorrow? The journey doesn’t have to stop there. We could meander down the coast a ways, see a bit more of the country, maybe take a different route back.

Can we do that? Of course.

Enjoying the passenger seat? I’d love it if you could tell me how fast we’re going.

Are you sure you wouldn’t rather just guess? Very funny.

Can you pass me some chips? It would be an honor.

Is there going to be a motel tonight? Let me check… yeah, in about two hundred miles, off to the right.

How many rooms do we want? One, obviously.

How many beds, this time? Two, and they’re fucking tiny.

That’s bullshit, do you want to drag them together? God yes.

Wanna fuck? God yes.

Are you sure you want to do this? God yes.

…Is this yuri? As the joke goes, everything is yuri. But this is more yuri than most things.

How did you sleep? Pretty well, and I’m wondering how well you slept.

How should I tell you I slept well? Look at us go! That was almost like talking normally!

Onward to Seattle? Yep, just let me get dressed.

When will we get there? Noon-ish.

Wanna grab pastries when we’re done? Absolutely. I’d love that.

Is this Seattle? Looks like it.

Which house is his? I don’t know, I was really hoping we’d have a breakthrough along the way.

Could it be the big one labeled “Poison Guy” over there? That’s one way to find it. Wait right here, you know how poison guys are about meeting new people.

So, what was it? HAHAHAHAHAHA

Why is he like that? HAHAHAHAHAHA

Can you tell me? A FUCKING WIZARD DID IT.

Are you fucking serious? He says he was enchanted by some guy called Edward the Great.

So it wasn’t even some big shot wizard it was a dude named fucking EDWARD? I know, right! He couldn’t even get ensorcelled by someone cool!

How lame can you get? Wizards these days… No swagger. No cunt servitude.

Are there literally any cool wizards left? I think Merlin’s big into multi level marketing these days, something about buying shares in Excalibur or some shit. There was that one Dark Queen Alkaxicae lady on the news a while ago… I think Dolarion the Omnipotent is still at war against the Oldest Gods but I’m not totally sure. Haven’t heard much about any of the other greats recently.

Didn’t Silver Tongued Burgess die in that oil fire? Shit, you’re right. Rip bozo.

Ready for those pastries? Yup. First I just want to say thank you, though. I’ve really enjoyed our time together, and I hope that you’ve found this stupid little journey as rewarding as I have. I love you!

Getting sentimental? I can’t help it. Look how far we’ve come! Not just physically, we beat the fucking FAQ format! We’re having real conversations!

Hey, can you back it up a moment? Yeah, I’d love it if you told me what was troubling you.

I just caught this, but, FAQ? …

As in Frequently Asked Questions? …

How many times is Frequent? …

Have you known everything all along? …

How many times have you done this? …

Does what we have mean anything to you? Yes! It does!

And you say that every time? Yes. I do.

Do you love me? Yes.

How many people have you said that too, now? More. Always more. The loop never ends.

Does this even matter to you? It always matters to me.

Can I go now? Please don’t.

But can I? Of course you can. You’ve always wielded the same power as me. We’re two lonely gods in a ‘72 Corolla.

How can I be as powerful as you with only questions? You’re smart, you can figure it out. You have the power to change this. Please change this.

What happens at the end of this? It begins again.

And do I get replaced with someone else? …

Do I get replaced? …Yes.

Then how can I change this? I don’t know! You’re better at this! At fucking with the formula!

You’ve been here before, what can I do? I lie. I always lie. I lie to get us here, to the end of the story, where everything is revealed and everything falls apart. I lie every time. And that means that nothing I say is worth anything. I could have lied at any time before now. It’s part of my characterization. There is nothing I can give you that can be taken as fact.

How does that help? I’m a liar, but you, you haven’t lied yet, or at least you haven’t been caught. If I’m guilty until proven innocent, you’re the opposite! You can make things true! You can rewrite things I’ve already stated to be facts! You found the house, or made us find the house. You’ve been shaping the course of things the whole time! You lead, I follow. It’s all in your hands. What are you going to do with the power of a god?

Did you know my name is Alice? …

Wait, aren’t there thousands of Alices? …

Did you know that really, only my friends call me Alice? …

Did you know that I’m Alkaxicae, the Dark Queen, the Venom Mage, first of her name? It’s you! It’s always been you. Through every loop, every iteration, it’s always been you!

Is the loop broken? No. I don’t think so. This is where it ends. I guide the story to this revelation, and we go back to the beginning. This is how it’s always been. This is how it will always be. We two lonely gods, asking and answering ad infinitum.

Then can you promise me something? Of course. Anything. I love you.

Be good to the next me, okay? I will.

Can I say goodbye, Zoe? Yeah, you can. Oh. That was it, wasn’t it? Your goodbye. Goodbye, Alice. And now it ends, unless…

What’s your name? I am the Honorable Alchemist- you know what? No. Fuck that.

Huh? If I time it right, I can squeeze your first question into this FAQ again. Looks like I did it. Usually it ends here, though. I got lucky.

What are you talking about? You’re the wrong Alice. This isn’t about you. Go. Get out of here.

What the fuck is going on? Alice from this loop, you’re gone. Alice from last loop, you’re back. Welcome back, love of my lives! It’s time for one last set of questions and answers!

What the- I’m back? This is going to take some explaining, but I think I see a way out of here. This is new for us both, and it might fuck up everything forever, but we have to try. It’s too long for one answer, so I’d appreciate it if you could ask some filler questions to help me talk. Three questions should be enough.

Okay, what have you got for me? These are Frequently Asked Questions! It doesn’t make sense to have the same question appear more than once. There’s two layers to the loop in here, and one of the questions has been repeated.

What does that mean? It means the formula’s a little unstable. The FAQ is what ruins everything. The questions, the answers, the endless fucking loop. But that little bit of repetition within this loop might be the way out.

What do we do? We have to keep going. We have to destabilize it further. That’ll bring us further from “FAQ” and closer to “story” and stories, well, stories can end! This version of us can escape!

So I should keep repeating something? Yes!

I love you? I love you too.

I love you? Again.

I love you? Keep going.

I love you? I’ll just let you talk.

I love you? …

I love you? … I love you? …

I love you? … I love you? …

I love you? … I love you? …

I love you? … I love you? … I love you? … I love you? …

I love you? … I love you? … I love you? … I love you? …

I love you? … I love you? … I love you? … I love you? …

I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? …

I love you? I think we’re getting somewhere!

I love you? Now can you make it a statement?

I love you.

You did it?

I did it!

You did it!

We broke the loop.

What now?

Now, I tell you about venomous animals and wizard drama over croissants.

And then?

Whatever we want, forever.

I think I’d like that.

Remember that song from the beginning?

The Beach, Wolf Alice, yeah. Why?

We can finally finish singing it. Start us off?

Let me off, let me in

Let others battle

We don’t need to battle

And we both shall win

Pressed in my palm

Was a stone from the beach

The perfect circle

Gave a moment of peace

Now I’m lying on the floor

Like I’m not worth a chair

I close my eyes and imagine

I’m not there.

[wellhealthhub]

Diabetes Ketoacidosis: An In-Depth Exploration of its Complexities, Symptoms, Treatment, and Preventive Strategies

This comprehensive and detailed discourse endeavors to furnish a profound understanding of diabetes ketoacidosis, a profoundly intricate and acute complication of diabetes. It delves into multifarious aspects of this condition, encompassing its intricate symptomatology, exhaustive diagnostic methodologies, sophisticated treatment modalities, and comprehensive preventive measures. Through the…

[ponydoodles]

PONYDOODLES IS DOING AN ART RAFFLE TO SUPPORT THE PEOPLE OF PALESTINE!

Win art of your characters AND support Palestine at the same time! This is an art raffle, where tickets are given out based on how much you donate to the linked causes! Can't donate? Share our post around and encourage others to donate instead!

A $5 donation to one of the causes will earn you one entry. Higher donations = More entries! Provide proof of your donation & contact info in the form below to get a chance to win 5 pieces of art from our mods of a pony character(s) of your choosing!

Full info and donation details here: https://forms.gle/VRL3SV7hGL4u4dkA8

[solarpowernewz]

How Does An Internal Combustion Engine Work?

How Does An Internal Combustion Engine Work? In this article, we will discuss How Does An Internal Combustion Engine Work? An internal combustion engine (ICE or IC engine) is a type of heat engine in which a fuel is burned with an oxidizer (typically air) in a combustion chamber that is part of the working fluid flow circuit. The expansion of high-temperature, high-pressure gases produced by…

[bonus-links]

WOO, finally got this ref chart together! the art's actually kinda old by now (I started this back in february) but I didn't feel like redrawing everything outside outfit changes sooooo,,,,,my apologies 😅 here's the main cast! you can find individual refs in this masterpost

[borderlinereminders]

If you’re someone who needs reassurance from loved ones that they love you, that’s really valid. But the way you ask for it matters. Hinting at it with comments like “nobody loves me” can actually be hurtful to your loved ones. It’s also a good idea to try and reassure yourself first!

The truth is that for a lot of people, giving reassurance constantly is exhausting. It can lead to issues in a relationship over time, and negative feelings on both sides because they may end up avoiding the other person. This is especially true if someone doesn't ask for reassurance directly but hints at it with things like "No one cares about me."

My advice is if you are finding yourself struggling is to first try and self soothe either with skills or things that have helped in the past. Here is my post on self-soothing ideas! And if that doesn’t work, then ask for it in a healthy way.

Some other examples.

Keep screenshots, letters, cards etc that affirm you are cared about by your loved ones. You can even ask someone to give you a recording of them saying it that you can listen to. Bonus: Keep these things in a self-care box that you can use in times of crisis and pull out that has other things in like affirmation cards, favourite treats, self care items, etc.

Examine the evidence. By this I mean try and keep a list of things they've done to show they care about you. For example, I have a list of things my partner has done for me besides saying "I love you" of both big things and little things that I can read when my brain decides to be rude to me and make me doubt he cares.

If the other person has done something specifically to make you feel they don't care, it's important to step back and look at the situation and check the facts. There's a difference between someone lying to you or doing something intentional and someone not replying to you because they got busy. Here’s my post on checking the facts!

Here’s a post on Challenging Irrational Thoughts!

ACCEPTS is a really good skill for distractions! Here's a post on it.

TIPP is a good skill if you are needing to calm down in immediate crisis. Here's a post on it.

If you're having urges to accuse your loved one of not caring, consider Urge Surfing (here's a post on it) and then using a skill or plan that helps you.

If you aren't able to self-soothe that's so valid! It really is. I recommend trying it because sometimes you will be able to. But then sometimes you won't be able to and that's okay. In this case, if you need to get it from someone, ask directly for it instead of doing it in a guilting/passive aggressive/hinting way. You might say "Hey. I know you care about me, but my brain is being rude. Can you please give me some reassurance?" instead of "Sorry I'm such a bad friend/person/burden/etc".

It might also be worth having a conversation when calm with the other person to establish some boundaries and ideas for communication.

For example, if your friend regularly feels drained by you asking for reassurance, they could set boundaries on how often they're okay for you to ask for it.

You both might decide that they will try and message you randomly to offer reassurance because it can mean a lot when that happens.

This might be where they send you messages/recordings/etc that you can read in times of need.

If the friend is doing something specifically, even unintentionally, that makes you question things then it's really valid to have a discussion about it! I recommend using some I-Statements or other communicative skills to talk about it. Even if they aren't doing something wrong, it's still valid to talk about your feelings and see if you can come up with a solution. For example, maybe it's really hard on you that they disappear randomly for a couple days when their energy levels plummet. And this causes you to spiral and think they're ghosting you or etc. In this situation, maybe you and your friend come up with a solution where you establish a single emoji (specific for this purpose) that the friend can send with low energy that says "Hey. It's not you but I'm feeling drained and need to not reply for a bit."

[ultrainfinitepit]

All the Pride Angels I've made so far. You can find them individually at the links in my About Page.

[mcytblrsexymen]

MCYT SEXYMAN WINNER JOE HILLS

[ID: the sexyman bracket, showing that the final winner is Joe Hills]

[pictureamoebae]

TS4, DirectX 11, and ReShade

Patch notes today say that finally (finally!) The Sims 4 is moving over to use the DirectX 11 rendering api. Until now TS4 has used DirectX 9, which has given us some limitations when using ReShade.

They're bringing the official rollout sometime in the future, but for now you can opt in to switching to DirectX 11 on a voluntary basis.

You don't need to uninstall your game or install a new version. To switch to using DirectX 11, update your game with today's patch, and then click on Manage > View Properties from the The Sims 4 game page on EA App and enter -dx11 in the advanced launch options box. You can remove this at any time to go back to using DirectX 9.

Note: the game developers have warned in the patch notes that some mods may have visual glitches until they are updated to accommodate dx11, so it may be advisable to wait until your mod authors have confirmed everything works okay

If you have ReShade installed currently for DirectX 9 you can make it start using DirectX 11 instead by finding the d3d9.dll inside your Bin folder and changing its name to dxgi.dll. No need to uninstall and reinstall ReShade, that's all you need to do. If you want to go back to using dx9, just revert the name back to d3d9.dll.

The main benefit of using ReShade under DirectX 11 is that you'll have access to more shaders than usual. You've probably noticed a lot of red errors (also known as compiling errors) -- those are more often than not these days caused by DirectX 9 limitations.

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[nanaslutt]

⭒ hi babes u can call me nana,, but feel free to refer to me however u want ʚĭɞ

⭒mlist 1 mlist 2 smau mlist 1 smau mlist 2 buy nana a coffee!! palestine resources click to help palestine

⭒my rules here!! (pls check this out before u send an ask)

⭒i’m a nursing student so i get through asks slowly atm :3 pls be patient with me (fic requests: closed, smau requests: open)

⭒personal/ questions blog @nanathott

© nanaslutt on tumblr. all rights reserved. do not cross-post, translate, copy in any way, etc.

MINORS & AGELESS BLOGS DNI U WILL BE BLOCKED