#wizard blog ‘24

[isabelguerra]

if we happen to know your main is it cool if we follow? i dont know if you want everything separate and i dont want to like. cross a boundary as a random follower ya know?

you could show up at my house and id be like hey

[concoctionboy]

You know, as much as I like to think of myself as kind of unique in being a living magic potion, humans are mostly water, so I guess all you humans out there are sort of living potions too.

Though you are fortunate in having a protective outer layer of skin that makes it a lot harder to drink you.

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[yandere-sins]

Monstober 2024

Monster-Enthusiasts, Monster-Lovers, and Monster-Fucker, I call upon thee! This upcoming October is going to be spooky!

It's time for a whole month of delicious monster content! Whether you want them to stalk, to hunt, or to devour your little protagonists (mind you, the monsters are the real protagonists of the story, hehe), I want to see a month dedicated to the beauty of the Ugly and Horrible! All things monster are welcome—art, writing, any kind of showcasing a monster! No matter how cruel or how obscene you like it—now's the time to show it off! ♥

I have prepared a list of monsters & prompts for your guidance, however, if you'd rather do a different monster or a different prompt, that is totally fine! If you prefer to stay private and not have your post reblogged to this blog, that is totally alright, too! This is merely for fun and giggles, and I welcome everyone who wants to challenge themselves this upcoming October to use this list if they want!

How to participate in my Monstober:

- Starting October 1st create something with the monster or prompt of the day! That is all you have to do.

You don't have to do all days or even in chronological order. Feel free to alter the prompts as needed. Your monsters do not have to match the usual descriptions of their kind! Post whenever and whatever you like as long as it is still connected to monsters!

- If you want your entry to be reblogged: @ me yandere-sins in your post, don't forget to put content warnings if any apply (especially Violence & Sexual Content—however, those are very welcome!), and put long texts (once they reach 3k words) under a read more! I'll reblog the posts as soon as I see and have the time to get to them!

Prompts

Day 1: Chimera | Mixed // Misunderstood // Insanity

Day 2: Werewolf/Werecat | Full Moon // Claws // Beastly

Day 3: Alien | Otherworldly // Uncanny Valley // Space

Day 4: Harpy | Cliff // Flying // Illusion

Day 5: Nymph/Dryad/Leshy | Plants // Playful // Nature's Bounty

Day 6: Naga/Lamia | Scales // Wrapping around // Poisonous

Day 7: Sphinx | Riddles // Sand // Giant

Day 8: Merfolk | Water // Singing // Alluring

Day 9: Folklore Creatures | Cautionary Tales // Truth // Naivity

Day 10: Mimic | Treasures // Hungry // Wrong

Day 11: Yuki-onna/Snow Spirit | Snowstorm // Promise // Guiding

Day 12: Witch/Wizard/Magician | Magic // Spells // Towers

Day 13: Shifter | True Form // Unbelievable // Transformation

Day 14: Minotaur | Labyrinth // Bannished // Following

Day 15: Eldritch Horror | Eldritch // Imprisoned // Tentacles

Day 16: "Church" Grim | Graveyard // Protecting // Spirit

Day 17: Dragon | Fire // Hoarding // Fairytale

Day 18: Kitsune | Tricked // Tails // Mystical

Day 19: Elf | Warrior // Swift // Merciless

Day 20: Goblin/Orc/Troll/Oni | Hordes // Village // Brutish

Day 21: Kelpie | Deception // Following // Stuck

Day 22: Skeleton/Zombie | Undead // Loved // Grave

Day 23: Angel | Feathers // Guardian // Watching

Day 24: Ghost | Shadows // Invisible // Coldness

Day 25: Vampire | Blood // Biting // Night

Day 26: Fae Folk | Lost // Fairy Circles // Names

Day 27: Drider | Silk // Cave // Ensnared

Day 28: Demon | Summoning // Contract // Otherworldly

Day 29: Gods | Reign // Glow // Worshipping

Day 30: Human | Real Monsters // Dangerous // Smile

Day 31: Free Choice of your favorite monster or a completely new one!

I look forward to all the monstrous ideas you'll come up with! ♥

[14dayswithyou]

💖 Slight 14DWY + Blog Changes! 💖

(16/12/23)

Leon will now move away from Corland Bay when he’s 10 years old. Originally, I never really put that much thought into it because it won't be explicitly mentioned in the game, but I figured I might as well make it more accurate now ^^;

Teo is now 26 (instead of 27). Again, zero thought went into this aside from wanting a wider range of ages for the cast — but now I want him to be closer to Jae and Violet’s age — especially considering they were all childhood friends and Violet was in the grade below them.

Elanor is now 30 and Kiara is 29. In the 2017 version, Elanor was originally the eldest sister, but it just didn't feel right to change it in the 2020 version. Day 3 will still be lore accurate, but everything on this blog will need to be retconned.

14DWY Purple (unofficial) will now be changing from #A14BF4 to #9D64FD.

Not a change, but adding more clarification: Angel will still attend university (and Jae and Teo will still be their university friend), but whether or not they enrolled will remain ambiguous! Day 1/2 kinda insinuates that they studied something ("Teo attended some of their classes"), but I wanted it to imply that they could've attended orientation and/or took "mock classes" after high school to see what it's like as well. I may change a few lines in the demo (in the future) to reflect that.

Egg

I'd like to (hopefully) try to remind everyone that whenever I write about Angel on this blog, they are gender neutral. Because if my ass had a dollar for every time someone assumed they were female because of the cutesy/pink themes or how "soft" I made the MC, I'd have enough money to fund voice actors, translators, custom soundtrack, and pay the $100 Steam fee /hj

Changed the crackpot theory tag into an actual tag!! About time sdghjdg

(07/01/24)

Also not a change, but to solidify Haruko's appearance + Ren's likeness a bit more... Haruko is supposed to be an anime character with pink/blue hair, blue eyes, and fair skin. He's a modern day "sorcerer" (a reference to JJK, not a literal fantasy wizard lmao) from an anime called "Attack on Giants" (another reference to "Attack on Titan"); and is very kind, ditzy, and empathetic. All Ren has copied is his hairstyle, vibe, and demeanour. Ren isn't outright cosplaying Haruko, and it'd take an avid anime enjoyer to notice that Ren is attempting to mimic Haruko.

I'll make a poll one day, but I might change Ren's left sleeve tattoo to the spoiler-free placeholder I used in this artwork. A lot of people seem to prefer it, but I'll wait until the poll to make any final decisions.

I might also make another poll to see if perhaps a new BGM theme would better suit the demo. Because in my mind, the "summer/beach location" = acoustic guitar (rather than piano) — and for some reason I get lo-fi vibes from 14DWY??

I don't think anyone has picked up on this subtle shift yet, but Ren will mainly use "he/him" over "he/they" now (since Haruko is a he/him enjoyer 👍). [REDACTED], however, will still greatly prefer "they/he", and will continue to use them interchangeably.

21/02/24 — or search through Obsidian. (Future Sai here.... I have no clue what this means???? What??? T_T)

I'm gonna cut down on the Teo and Ren bullying on this blog (and in general). I don't find it fun anymore, and it genuinely upsets me when people put down certain characters to make others look better (i.e. "Ren has no ass which makes Leon superior >:)" Just say you like Leon... I beg T_T). It also makes me doubt whether Ren is genuinely a good character or not, and it's gross seeing y'all tear down people who genuinely enjoy Teo. Be kind.

(11/01/24)

Eventually, I'd like to turn this meme into an event in the 14DWY Discord to help create an actual landlord for Day 3. The current landlord has always been a meme-y placeholder (I thought the idea would be funny), but looking at how the game is currently, I want 14DWY to be more "serious". The current landlord will eventually be turned into an easter egg!!

Whether or not Jae had bottom surgery will now remain ambiguous. Everyone is now free to headcanon whatever they'd like, so long as it's not offensive or too OOC.

From now on, I'll also try my best to remind everyone that Jae is gay and Kiara is lesbian. I tried not to bring it up frequently because I was afraid it'd come across like "being gay" was their only defining personality trait, but I'm tired of people sending in asks that don't apply to these characters ^^;

I might move all of the curiouscat questions to this blog and archive the account. It's becoming too much of a hassle for me to manage 3+ social media accounts sgkshjj

[writers-potion]

How do I plan out chapter plots so they flow okay??

Currently working on a 36 chapter thing. Would love some help. Thanks

Chapter Planning Tips

Hi thanks for asking! 

I’m not a great plotter myself (I’m somewhere in between a plotter and a pantser), but here are some frameworks you can use. 

Planning The Overall Plot 

Before you start dividing the chapters, think about how you’d like the whole story to flow. You can use any of the below frameworks: 

The Three-Act Structure (Act 1 - 1st doorway - Act 2 - 2nd doorway - Act 3)

Freytag’s Pyramid (Exposition - Inciting incident - rising action - climax - falling action - resolution)

9-step Plot Dot 

The 15-Beat Structure (from Save The Cat!) 

Then, think about how long you want each Act/Section to be. 

In the 3-Act structure, Act 1 will be less than 25% of the overall word count

In Blake Synder’s 15-beat structure, Break into Act 2 comes at the page 25/110 mark. 

Effective “Chapter Plots”

The most important thing in a chapter is that you make the reader want to move on to the next. To do this, consider the following:

Using a cliffhanger/foreshadowing at the end of chapters. 

Each chapter must have a significant plot point assigned to it. 

If you have a lot of time skips/flashforwards and backwards, consider titling each chapter with a timestamp. The same technique can be used for changing location/POV. 

Have a mini-plot for each chapter. What I mean by this is that a chapter must have scenes with varying levels of tension. Just like in a story plot, a chapter will generally start off with mid/low tension, climb up to the major event of the chapter, then fall slightly at the end as the particular event comes to a close. 

If you are a pantser and you feel like you can never stick to a plot (and that’s why your chapters are being disconnected), make sure you have a place where you track your plot changes, and alter the original plot as you write. 

It also helps to write the whole story in a relatively short period of time so that you won’t come back to Chapter 24 after a 3-month hiatus, not knowing where you left off.

─── ･ ｡ﾟ☆: *.☽ .* . ───

💎If you like my blog, buy me a coffee☕ and find me on instagram! 

💎Before you ask, check out my masterpost part 1 and part 2 

💎For early access to my content,  become a Writing Wizard 

[kaitsawamura]

🪞 🔮 🍅 🧺 🍯 🌱 The Farmer & The Wizard

❦ SUMMARY ❦

You need a change, a big one. When your estranged grandfather passes away and bequeaths you his farm in a little town just south of the middle of nowhere, you take it as the sign you needed to make a change instead of waiting for one.

The farm, while having fallen into a state of disrepair, is just the thing to cure your modern-world ailments. The people are kind and always ready to offer help, if a bit unusual. They have old superstitions, a haunted community center, and a resident wizard. Spoiler alert: those last two on the list take some getting used to.

Yes, things are different here but you have a sneaking suspicion that the slow pace and a certain alchemical practitioner are going to remind you that sometimes, all you need is time and a little bit of magic.

THIS SCROLL WAS LAST UPDATED: 6/1/24

❦ STATS ❦

Pairing: Wizard!Gojo Satoru x Farmer!Reader

Rating: M for Mature, 18+ only minors do not interact

Warnings: Fantasy/Stardew Valley violence, sexual content, angst (maybe like just a tiny lil bit)

Tags: Stardew Valley AU, strangers to friends to lovers, red thread of fate, soulmates (kinda) eventual smut, fluff focused, canon divergent, more tags to come (literally am too excited, I need to get this masterlist post out in the world lol)

Projected Word Count: 100K

Author’s Note: In unsurprising news, I have still been in the trenches with my Stardew Valley hyperfixation. Then, along comes this lovely PC Gojo mod and the fate of this fic was sealed. It's going to be inspired a touch by that mod (which I will link below, full credit to that amazing modder) and will heavily follow a standard Stardew Valley play through timeline. I'm a lil nervous to write Gojo since he doesn't fall neatly into the character type I normally am drawn to but I have WRITING HANDS (like jazz hands but for writers :P ) and so I'm adding another fic to my WIPs list.

Important Note: This fic is part of this blog's contribution to the @ficsforgaza initiative!

❦ LINKS ❦

Fics for Gaza Masterlist <- now linked! ->

GOJO MOD FOR PC'ERS

JJK Masterlist

Main Masterlist

Playlist

Moodboard

❦ TABLE OF CONTENTS ❦

SPRING

Part 1: In Which You Unexpectedly Receive The Deed to A Farm

Part 2 | In Progress | TBL

SUMMER

Placeholder

AUTUMN

Placeholder

WINTER

Placeholder

This work and its digital elements (credit for pixel art to ConcernedApe) are © Kait of @kaitsawamura 2020-PRESENT. I do not own any rights to Stardew Valley and any subsequent settings/characters, but this work is heavily inspired by that amazing game. Please do not alter or copy this work. Please do not repost this work to other platforms without my express permission.

[wolfstarshipping]

June Masterlist (Wolfstar Fic Recs)

Here's another wolfstar fic rec list! I missed 2 days of the daily fic recs in June, but I decided to just include 2 other fic recs in this list as compensation, because 30 fic recs is a much nicer number than 28. Again, these are mostly different kinds of AUs, with a few angsty non-AU fics strewn in!

1. Marauder FM by hollyivydruzy (12.809 words/current WIP, radio AU, muggle AU)

2. The Lab by de_sire (de-sire-blog) (95.450 words, university/scientist AU, muggle AU)

3. sucker punch by moonnixie (5681 words, post Azkaban)

4. lessen my load by moonymoment (73.424 words, university AU, muggle AU)

5. Ullswater by eyra (30.973 words, university AU, musician AU, muggle AU)

6. saccharine by moonymoment (26.447 words, ghost AU, modern AU)

7. Fire Escape by longlostweasley (9418 words, high school AU, muggle AU)

8. The Road Not Taken by mollymarymarie (88.278 words, popstar AU, modern AU, muggle AU)

9. Neither Hide nor Hair by puuvillaa (28.117 words, wizard AU: no Voldemort)

10. everybody else looks like they’ve figured it out by spellingmynamewrong (15.015 words, university AU, muggle AU)

11. Everything's Connected by mizdiz (44.297 words, boarding school AU, magical realism)

12. A Cure For Nightmares [+podfic] by picascribit (36.083 words, boarding school AU, muggle AU)

13. Signs of Affection by KittyCargo (8258 words, modern AU, muggle AU, sign language)

14. I need you (Like I need to breathe) by bookish_changeling (16.745 words, first war AU)

15. Everything is right by de-sire (10.875 words, marauders era, hogwarts)

16. Learning (Dis)Abilities by MakkAttackk (15.824 words, marauders era AU, hogwarts)

17. Dear Your Holiness by mollymarymarie (142.264 words, priest AU, band AU, modern AU, muggle AU)

18. they're just pretty words, my dear by lowhangingfru1t (31.444 words, high school AU, muggle AU)

19. losing my mind, thinking about you by drowsyanddazed (16.265 words, first war, flatmates)

20. Step & Repeat by theresthesnitch (62.744 words, modern AU, celebrity AU, muggle AU, fake dating)

21. (everybody here was) someone else before by mcdynamite (13.163 words, modern AU)

22. It Can't Be Helped by moongnome (9752 words, marauders era, post-prank, hogwarts)

23. It's cold outside by Remustrash (1788 words, post hogwarts, bed sharing)

24. Led by Light of a Star Sweetly Gleaming by wolfpants (53.025 words, 1960s AU, muggle AU)

25. My Dearest Moony [+podfic] by picascribit (581 words, epistolary, post OotP)

26. I'll Be Yours In a Landslide by MoonCat457 (mooncat457writing) (8464 words, Lie Low at Lupin's)

27. Modern Love by enigmaticfish (40.354 words, muggle AU, modern AU, student AU, flatmates)

28. Terms and Conditions by mblematic (6852 words, post hogwarts, flatmates)

29. The Things We'd Do For A Coffee Maker by AllThisAndLoveTooWillRuinUs (6805 words, muggle AU, fake dating)

30. Honey If I'm Not and If You're Gonna by BrigidFaye (75.771 words, wizard AU, post first war)

[rainbowgod666]

Wizardposting blogs and my view of them, OR:

My ass out here cataloguing wizards like they're pokemon 💀 i ran out of things to do fr 💀💀💀

@official-megumin: dutch (EDIT. SHE ISNT. I WRONGLY REMEMBERER A POST OF HERS. I KNOW HER ASS IS LIVING [OR FROM] NORTH EUROPE THO) megumin that still has the "only knows one spell and its the stupidest and hardest to unlock and use. Balancing the Meta my ass" problem. In a relationship with @a-sentient-cup

@autism--wizard: just a lil neurodivergent guy that likes spooders. Not much of it really. Possibly strong enough to defeat spiders georg

@the-adhd-sorcerer: moot :) also more powerful than they let on, but its like DBXV2: starter gear and GODLY stats

@mossy--wizard: moss-fueled neurodivergent boi with lots of moss. Yes their blog feels like a wet forest in the sunlight, drying up after a long rain. Not really interacted with them tho...

@wizard-council-bureaucrat: basically the MC of tumblr wizardposting. If they say something its either wizard law or just a suggestion. Probably the only wizard here that ISNT "surprisingly powerful even though their learning was less than advanced"

@wizard-intern: the blorbo.

@the-gnomish-bastard: ok i get that theyre basically pilaf from dragonball, but A: the stew arcanum is REAL bur the 24 gods thing either sounds like bullshit or he made a stew out of 24 REALLY HUBRIS-FILLED PEOPLE (which would explain his "holy fucking shit how are you even capable of HAVING A STRUCTURE WITH THE FUNCTION OF A BRAIN"), B: he was the dude that came up with the whole "floating wizard island thing" (which has so many holes like wtf put it back down) and C: im pretty sure they have been corrupted by some kind of mushroom deity, which would explain the fact that when calling him "stupid" its like SCP-682 saying that humans are disgusting. Because there literally isnt a stronger word in the human language. How in the fuck does someone have so little intellect we have to do like the jewish population of europe after 1945 when they came up with the word "shoah" to describe what happened to them. To the user running that blog. GET SOME PSYCHIATRIC HELP ASAP. Holy shit.

@not-a-suspicious-wizard: "I aM vErY tRuStWoRtHy" dude everyone knows you wanna do some weird "subjugate reality" bullshit. How about you start making drafts and NOT murdering opponents? Seriously dude if you wanna be in charge as long as you dont try weird "consolidating power like its the 1940s" shit its alright. Maybe take some craftmanship things as a hobby! Make your own throne! Come up with something to do when you are too tired to do Dominant King Bullshit! Play modded minecraft/terraria! Make origami! If youre gonna blanket the world in darkness, at least make it look cool and welcoming instead of "inevitable rebel uprising lol have fun with Prophetic Children lmao" :3

@incompetent-wizard: are you SURE youre incompetent? Chances are, you're just unlucky 😊

[tournament-winners-tournament]

TOURNAMENT² LINEUP(so far)

(aka Hand Over The Blorbos, Now[or when you finish ig])

the tournament will start MAY 9 to let as many polls finish as posible!!

1. @cinnamon-roll-competition - kirby

2. @2023himbotournament - Kronk

3.@blorbopoll - WINNER PENDING

4. @worstcharacterpoll - Ross Geller

5. @hellsite-hungergames - Perry the platypus

6. @minecraftmobtournament - Enderman

7. Tumblr sexyrematch(@sexymanotd) - cecil palmer

8. @siblingtournament - Dipper and Mabel Pines

24. @ultimate-poll-tournament

9. @ultimatepinkgirl - miss piggy

10. @aminoacid-swag-tournament - Tryptophan

11. @manicpixiedreamgirltournament - WINNER PENDING

12. @autismswagsummit - Mob Kayegama

13. @nonbiney-swag-competition - Gonzo

14. @2023vampiretournament - WINNER PENDING

15. @asexual-swag-competition - Jessica Rabbit

16. @fictional-malewife-tournament - WINNER PENDING

17. @fictionalpresidentelection - Betty Boop

18. @2023-yaoi-off - Kim Dokja x Yoo Joonghyuk

20. @tentacletournament - The Rot

19. @best-green-character - Toph Beifong

21. @protagonistpolling - WINNER PENDING

22. @clown-poll - WINNER PENDING

23. @mushroom-showdown - Dewdrop Bonnet

25. @i-need-to-fuck-that-old-man - Din Djarin

26. @the-animated-hero-tournament - BLOG DOES NOT EXIST, WINNER DOES NOT EXIST

27. @baldguy-fight - Megamind

28. @babygirl-beatdown - WINNER PENDING

29. Wizard tournament (@wizardwithglitter) - Wizard Animal

30. @squimbusfrommypolls - Zonic the Zone Cop

31. @lovecore-swag-showdown - crying cats edits

32. @youngersiblingstournament - WINNER PENDING

33. @greenguysummit - WINNER PENDING

34. @tobyfoxsongtournament - WINNER PENDING

35. @tboyswagcompetition - Sonic the hedgehog

36. @the-trope-bracket - Found Family

37. @thief-throwdown - Team Rocket

38. @into-the-mikuverse - WINNER PENDING

39. @boomerbracket - uncle iroh

40. @blackandpinkbracket - Anthy Himemiya and Utena Tenjo

41. @foundfamilyarena - WINNER PENDING

42. @failgirl-royale - WINNER PENDING

43. @mad-scientist-showdown - Team bubblemindshmirtz(Princess bubblegum, megamind and doofenshmirtz)

44. @may-the-best-penguin-win - Adelie

45. @girlbosswar - Cancelled

46. @fashiondisastertournament - Teruki Hanazawa

47. @whaleswagbracket - Blue Whale

48. @ultimatepokemontournament - NEED TO SWAP

49. @bestfictionaldivorce - WINNER PENDING

50. @white-boy-bracket - WINNER PENDING

I can only add 50 @, so I'll add the rest in another post later(there will be 64 in total)

[duketectivecomics]

[ID: An edit by @redroseworks advertising Duke Thomas Week 2023. The background consists of two panel edits of Duke in his Signal costume facing outwardly from the left and right side respectively, and a third Duke in the center in his civilian clothes facing the viewer straight on. There is a dot overlay on these panels and they are broken up into triangular comic panels. The dates and themes for Duke Week are listed in text boxes spread throughout, & are listed in further detail in the post below.]

Once again, it’s

Duke Week 2023!

Further info for this year’s Themes, Rules & Guidelines are under the cut! Be sure to spread the word!

Themes for 2023 (Sept 24th-30th):

Day 1 - Rebellion

From his rough start with Dr. Thompkins, to his rocky team-up with Black Lightning & the Outsiders, Duke’s always been quite the Rebel! Here’s a day to commemorate our Rebellious Rockin’ Robin!

Day 2 - Civilian Life

Duke’s time as a vigilante is full of intrigue & adventure, but what about his time outside of the mask? This day is all about exploring Duke’s civilian identity!

Day 3 - Fav Quote

From his introduction in Batman (2011) all the way up through his more recent appearances in Batman: Urban Legends, there’s plenty of quotes to pull from Duke. But which ones stand out among the crowd? Which ones have resonated the most with you? (And here’s a link to our Duke Reading guide in case you want a refresher!)

Day 4 - What is… Normal? (Meme/Free Day)

A free day for folks to share general Duke work, or of course, memes! This past year I’ve seen an influx as well with more general batfam fans questioning just how ‘normal’ or ‘sane’ our favorite bat is. And to that, I want to invite y’all to come on over and find out!

Day 5 - DnD, Wizards & Knights (oh my!)

One of Duke’s oldest special interests! He’s always been a bit of a fantasy nerd. This day is all about celebrating Duke’s hobbies of fantasy gaming and reading!

Day 6 - We Are Robins (Of the Future)

We’ve celebrated the We Are Robins of the Middletown collective before, but this year we’re predicting where they could go! Duke’s first team will always be an important part of his past, but how could they fit into his future?

Day 7 - Sun vs Moon

And to finish out this year’s Duke Week, we end on another note of duality. Duke’s a bat who operates mainly during the day, and occasionally is called upon at night. The bright sunlight of day may reveal something different about our hero compared to the cool moonlight of night.

Rules & Guidelines:

Tag your posts with “#dukeweek2023” &/or “#duke week 2023” for the event. For Best results use it as one of the first five tags & “@” this blog too. If the work is not reblogged here w/in 24 hrs, feel free to send it directly my way by DMing it to me!

Any medium of fanwork is allowed! Whether it’s fic, art, edits, mixes, meta, or more! In this same vein, multiple works for the same day are also allowed, provided they’re on-theme!

HOWEVER, No NSFW! The character is a minor at this point in canon and we want this week to be as inclusive to fans of all ages as possible.

Fics & ficlets that are posted on tumblr will also need a Read More cut to be up for reblogging. Use the : read more : function (no spaces before the colons) & press enter/return to add a cut to your fic! If linked through Ao3 or other fic websites, no cut is needed. Please provide adequate warnings as they apply to your fic, thank you!

Reposted/stolen art or edits will not be accepted or tolerated.

Got any questions about the event? The ask box is always open! (& remember to reblog & spread the word! Let’s have a GREAT DUKE WEEK!)

[leighsartworks216]

For your prompt kisses list thingy request, do you think you could do either, 24, 32, or 43 (whatever you feel is best) for a reader/tav who suffers from chronic pain? Some days o hurt so bad I sob because I hate my body so much I want to perish. 😭 could Astarion please comfort said reader? Please and thank you I love your work and frequently re-read it! 👀 I re-read your migraine one today as I was dying from my own.

43 - "We'll get through this" kisses

Astarion x gn!Tav/Reader

I already wrote something similar to this (To Ease Your Burden), but I did my best to do something a little different

Warnings: pain, crying

Word Count: 434

Main Masterlist

First Baldur's Gate 3 Masterlist - Second Baldur's Gate 3 Masterlist

AO3

Tag List Form

Kiss Prompts

The sobs wracking through your body only made it hurt worse, but what else could you do? Halsin and Shadowheart had provided balms and pain relievers, to little effect. Astarion had set up his pile of pillows as best he could to ease the stress on your body, sitting dutifully nearby, doing his best to help.

“Shall I see if the wizard knows any remedies?” he offered gently. To willingly suggest talking to Gale of all people, let alone to ask for help, was a line only ever crossed for your sake. He hated sitting here, watching you suffer when he could do so little to help. If it was a creature or curse causing your issues, he’d happily charge out and slay it for you in a heartbeat, but it was much more than that.

You choked on your tears as you tried to shake your head. He hushed you gently when you winced, reaching out to brush back your hair, before he thought better of it and returned his hand to his lap. “Easy, love. You’ve got this.”

Struck with an idea, he bolted up from his spot on the floor of the tent and bustled about. You tried to see what he was doing, but he was out in a flash. He came back a little later with a large, thick quilt. As delicately as he could, he laid it over your body. It was pleasantly warm, as though it’d been hung by the fire for a while. It drew out some of the aching. You sighed with relief.

“There we are. Better?”

You croaked out, “Yes,” with an accompanying little sniffle. He smiled, but his brows were knit together. His cold body wouldn’t help now, nor could he even cuddle with you when the slightest jostle had you crying out in agony, but hand Karlach a blanket for a minute and you’d have a heated one in no time. It was the best he could provide for the pain.

“Do you think you can try sleeping it off for just a bit?”

“With this,” you don’t try to gesture to the blanket, “maybe.”

“Good! Take a nap and when you wake up, maybe Halsin will have come up with another ‘natural remedy’ to try.” He sat up on his knees and leaned over you, careful not to touch you or accidentally fall on you. He brushed his lips ever so lightly to your forehead, before immediately pulling back. He offered you a gentle smile. “You’ll get through this, love. And I’ll be right here if you need me. I promise.”

---

Tag List:

@satelliteapotheosis @hypopxia @flsalazar @beverlybeav @angelofthorr @emiemiemiii @marina-and-the-memes @aurasyn @furblrwurblr @cappsikle @mjmygd @thegirlsadventuresinwonderland @kindadolly @bloopthebat @pandimoostuff @chesb0red @black-star1472 @sessils @puppyg1rl666 @maruichio @cyber-dump-171 @katharynmarie @twinkliker3000 @cherifrog @catching-fire-in-the-wind @phantoms-fandom-blog @thespectacularspaceace @lynnlovesthestars @sylverqueencosplay @tototini @ashrio20 @bambamwolf87 @astarion-imagine-archive @thistrashisreadytobash @rosxtinted @bongwaterflavoredgatorade @the-lake-is-calling @nyxmainex @squid-killer @godoffuckedupcats @dontneedbiologytoadopt

[yen-sids-tournament]

New Valentines Tournament!

Greetings! This is our mini-tournament for Valentines Day <3. Like the Halloween tournament it will be a 16 contestant competition with 24 hour rounds.

Everyone deserves a chance for their True Love to be celebrated! We are looking for nominations of romantic couples* who are not a major Disney couple/a major focus of the plot. This tournament needs 16 submissions to run. We accept canon, assumed, or even non-canon couples. Submitting pictures and a justification will improve their chances of getting into the tournament. Again this is open to animated and live action as well as theatrical releases and small screen favorites with everything in between.

Examples of those not acceptable: Mickey Mouse & Minnie Mouse, Troy & Gabriella, Luca & Alberto, Ariel & Eric, or anything like Mother Gothel and Rapunzel

Examples of those acceptable: Mr. & Mrs. Russo, Pacha & Chicha, Will Turner & Captain Jack Sparrow, Flower & Petunia

We will start the first round on February 7th. The submissions will close February 3rd (but may be subject to change)

And yes, This is a Disney Tournament blog so we are interested in only Disney matches

@tournament-announcer @kimpossible-polls @disneyparksattractionstournament @the-owl-house-blorbo-brawl @the-gay-disney-games @bestanimatedmovie @sleepyhead-poll

*we say "couple" but if you have an ot3 or other polyship that fits please submit those too (like Sleeping Beauty's fairies) Like Donald Jose and Ponchito

The couples pictured are Jerry and Thresa Russo (Wizards of Waverly Place), Flower and Petunia (Bambi), Bobble and Clank (Tinker Bell), Pacha and Chachi (The Emperor's New Groove), King Stephan and Queen Leah (Sleeping Beauty), Rita and Dodger (Oliver and Company), Captain Jack Sparrow and Will Turner (Pirates of the Caribbean)

[thegracelessfaceless]

Coming Home From Work to Sal

Tw: drug use mention

It's been a long day

You might argue the longest

Regardless of the field you work in

Every interaction you had today was a difficult one

People where whiny and obstinate

Simple tasks turned tedious and frustrating

And the work hours just dragged by

Every second expanding and then collapsing on itself with each tick of the clock hand

Whatever they're paying you...

Today it just isn't enough

You want nothing more than this shift to end because at least you know that at clock out time, they can't exactly force you to stay

The moment finally gets here

Clock out time

And you beat feet to your ride home

And as you walk up the front steps

There he is framed in the doorway

Sal, hair mussed from his after work shower, baggy pajama bottoms featuring characters from Ricko's Modish Wife, and a band shirt for King Gizzard and the Lizard Wizard

He holds the door for you and follows behind you as you shed your uniform on the way to the bathroom

And then listens as you unload your day

From the stupid overreaction about a small hiccup provided by Brandy in sales

To the complete Karen of an old woman who just kept haranguing you

To the fact that you totally overcommitted yourself with work duties today that were and weren't actually necessary

Sal diligently follows you from the bathroom and shower, to the bedroom (where he stole a few kisses and maybe a few squeezes too), to the kitchen where you both ate dinner standing up over the sink, and then finally to the living room

To console you on your bad day, Sal turns on your favorite guilty pleasure show

Even though watching it always makes him feel like happily slamming a door onto his head repeatedly

He engages in the show, and finds himself getting invested in it too

Also provided by Sal:

A foot rub after a long foot soak in the foot soaker Maple bought you for Christmas

Warm blankets

A big ol' bowl/joint/blunt/whathaveyou, if you partake. If not, Sal will have already handled this step himself before you got home

Your favorite snacks, along with some of his because he knows you secretly enjoy them

Hot tea/steamed milk/coffee, depending on your preference (Sal actually makes killer coffee despite not drinking it. He's surrounded by coffee drinkers, he had to learn at some point)

And then finally,

When you both retire for the night

Sal reads you a few chapters from whatever book he's reading

He could read you a stereo manual and you'd eat up every minute of it

You constantly suggest to Sal that he should make an ASMR channel on YouTube

Just his deep, raspy voice carefully articulating words so his Jersey doesn't show as much

Lulling you to sleep

And in those last few moments of consciousness, you feel Sal's lips press to your forehead

Goodnight Reader, I hope your day is better tomorrow and I love you

Vent section: For those of you who follow my blog and know my life, I work on a dementia ward. We got a new resident today. She is completely rude and hateful, incessantly talks, picks on/picks fights with other residents, argues for arguments sake, and biological functioned in the hall (TWICE). Needless to say, her presence has thrown off my entire work groove. I tried to compensate by deciding to do linens today, help out... For rooms 13-24... All of them. It was almost too much but I got it done right before my shift was done. I work 12 hour shifts so 15 loads was a completely doable task... Right? Anyway, while I was doing that, two of my residents (besties, Ms. Daisy and Ms. Eileen (all names have been changed for privacy and dignity)) managed to slip through the coded fire doors that lock down the hall (dementia patients wander and get lost easily, we have to keep them locked down for their safety). They didn't go far. The rest of the building caters to elderly people who just need a little help, and Daisy and Eileen went to the dining room on that wing. An elopement is when a resident manages to get completely out of the building, out in the world . So not even really an elopement. But mass panic ensued while we were trying to find out how they got out. Turns out they were camping the doors, and waited for a family member to come through and slipped out... Very crafty. One headcount later, administration finally left and it was back to dealing with the new lady, Glenda, who I'm sure will appear in many incorrect quotes on my blog. I normally completely loathe a new resident when we get them. As you can see, it throws off my whole day. I'll get used to her, figure out who she needs me to be, and be that person for her. I'm sure we'll end up thick as thieves. It's always the difficult ones that I end up liking the most.

[just-some-guy-joust]

Just Some Guy OC Tourney - Side B: Round 2

Rules:

do NOT be mean to anyone or any characters in these polls. you MUST clarify if you are joking/teasing or you will be blocked. if you are someone who entered an oc into this and you are mean to other contestants you will be disqualified

do NOT claim a character doesn't deserve to be here. yes including your own. be nice

if you are posting propaganda you have to @ tag us, including if your propaganda is in the reblogs. it is difficult to tell when something is or isn't propaganda. anything not tagging us will likely be missed

please don't hesitate to let me know if i messed something up!

have fun, hype each other up <3 thank you

Mendel Warrenpeace | He/him | @bittersweetbonbon

CW: Transformation horror, isekai, lightning strikes

Mendel was just a normal guy, who happened to love Toontown: Corporate Clash *so* much that he played it nearly 24/7, maxing out all of his gags and disguises, even going so far as to become a beta tester for experimental VR haptic suits, just so he could be more immersed in the game. However, he was foolish enough to play the game in VR during the most intense lightning storm seen in his area, got struck by said lightning, and was isekaed into the game itself. Now trapped in the world he used to adore, at level one no less, he would do anything to get back home, up to and including re-beating the game, no matter how strenuous running around and throwing pies at robots is in "real life". Of course, beating the game isn't going to free him from Toontown's inky clutches, but we don't have to tell him that, right? Of course not.

Promos: He has a blog at mendelwarrenpeace.tumblr.com and a WIP toyhouse page at toyhou.se/26655994.mendel-warrenpeace

~

Volshebney Rebenok Asteroff | He/him | @splatoonmaster69

The worlds most 14 year old ever. Eats a diet of only mac and cheese. Sneaks onto a boat by stabbing it and passing out. Just. So Incredibly 14 years old

~

Full images and descriptions under the cut!

Mendel is, quite literally, so just some guy that I refuse to develop what he was like or what his name was pre-isekae, because his past is literally so generic and unimportant. He was NPC-core. He was nothingburger. His only friend is a 17-year-old who physically cannot stop themself from stealing things. Even now his only hobby is playing video games all day. He almost died a few days after being isekaed because he didn't want to leave his house. He's scared to walk around because he thinks the robots will shoot him point-blank just for being near them. I want to grab him and spin him around like that gif of a chimpanzee. He's even a furry.

When a powerful wizard loves another powerful wizard very much, they make a chaos magic abomination in the form of a baby. This baby ends up so incredibly sheltered with the most wet kitten energy in the world. He bites so watch out, but he doesnt bite very hard. Overall the fact the most key thing about his character is that hes 14 manages to make him just enough of just some guy that im submitting him to save other just some guys from their fate

[ask-neloth]

"As I value both my time and my sanity, inappropriate, rude, or distasteful questions shall either be delegated appropriately or outright ignored." - Neloth; Archmagister of Tel Mithryn, Master Wizard of House Telvanni

---

This is an RP Blog for Master Neloth of House Telvanni, his apprentice, Talvas Fathryon, and other denizens of the Tel Mithryn settlement. Most posts will be in character voicing. Any non-character voicing will be designated in small text such as this. Meta posts will be limited to announcements, blog status, and the like.

---

GUIDELINES:

Ask box will be closed at 9 asks and will re-open when all asks have been answered

There will be an inbox tally in the blog description as asks are being submitted (i.e. ask box 5/9)

Not all answered asks will have accompanying artwork

Violent, disrespectful, or sexually explicit asks will be ignored and users will be blocked

No guarantee that all asks will be answered - some may be delegated to other members of Tel Mithryn

Questions are accepted from both canon NPCs and OCs

RP is encouraged! Scene-setting and descriptive context are welcome.

An FAQ list will be created as needed

SCOPE:

The starting canon of this blog does not include any previously written fanfiction or relationships outside of the base game canon

References to the Dragonborn will remain nebulous and the blog will predominantly deal in NPCs from Skyrim, Oblivion, Morrowind, and ESO canon

The blog's timeline will be allowed to emerge organically, but will be predominantly pre-Dragon crisis

[ASKS ARE CLOSED]

Thank you, and may Azura guide you! (Edited 1/31/24)