My speculations on Indigo Park
I'm putting this post under a read-more in case it finds someone who hasn't played Indigo Park yet and wants to experience it blind.
(BTW, it's free and takes about an hour to finish so just go play it. The horror value's kinda tame overall, but trigger warning for blood splatter at the end.)
Why Rambley doesn't recognize Ed/the Player: The collectables notes make it obvious that our Character, Ed, used to be a regular guest at Indigo Park as a kid. Yet, when Rambley goes to register them at the beginning he says he doesn't recognize Ed's face. I've seen speculation that this might be due either to Ed's age or the facial data database being wiped or corrupted after the park's closure. However, I think there's another possibility.
The Rambley AI Guide was a relatively new addition to the Park. Indigo Park is essentially Disneyland; it's been around for a long time and I rather doubt that the technology for a sentient AI park guide was available on opening day. Rambley mostly appears on modern-looking flat-screens, but in the queue for the railroad he pops up on small CRTS, so technology has advanced over the park's life time.
I suspect that Rambley as an AI was implemented a short time before whatever caused the park to be shut down, and the reason that Ed's face isn't already in the system is because Ed just never went to the Park during the time between Rambley's implementation and the closure.
Rambley needs Ed just to move around. Rambley claims he'd been stuck in the entrance area since the closure. That might imply that as an AI guide he's not permitted to move around inside the Park unless he's attached to a guest, and he has to stick close to them. He's probably linked to the Critter Cuff we wear, which would explain why he insists we get it and doesn't just override the turnstile or something. He still needs cameras to see us and TVs to communicate, but it's the Critter Cuff that determines which devices he's able to use at a given moment.
There are other AI Guides. Rambley's limitations in where in the park he can be seems inconvenient for an AI that's meant to assist all the park's guests. Perhaps during normal operations he was less limited because every guest had a Critter Cuff on, but that might have put too much strain on his processing if he was the only AI avatar. Ergo, some or all of the other Indigo characters could have been used as AI guides as well; either a guest would be assigned to one character through the whole park or the others would take over for Rambley in their themed areas while the raccoon managed the main street.
Due to the sudden closure, the other AIs may be stuck in certain sections of the Park like Rambley was stuck at the entrance, and we'll interact with them and/or free them as part of the efforts to fix the place up.
The "mascots" are unrelated to the AI. But Rambley believes they are linked. The official music video for Rambely Review has garnered a lot of speculation for how different Rambley's perception of how the Mollie Macaw chase ended is to what we saw in the game. I'm not 100% sold on the idea that Rambley flat out doesn't know that the Mollie mascot got killed. His decision to drop his act and acknowledge the park's decayed state is because he sees how freaked out Ed is by the Mollie chase, and he seems to glance down toward Mollie's severed head when he trails off without describing the mascots.
HOWEVER, I don't think he sees Mollie as being truly dead. He's possibly come to the conclusion (or rationalization) that the AI guides, based on the actual characters, are stuck inside the feral fleshy mascots and the mascot's death has led to Mollie's AI being liberated. This idea will stick with him until such time as we encounter an AI character before dealing with the associated mascot (likely Lloyd).
Salem is central to the park's closure. All we really know about Salem the Skunk is what we see in the Rambley's Rush arcade game, where Salem uses a potion to turn Mollie into a boss for us to fight. This reflects real world events, although whether Salem instigated the disaster due to over-committing to their characterization or was merely a catalyst that unwittingly turned the already dubious new mascots into outright dangers remains to be seen.
Rambley's disdain for Lloyd is unwarranted. Collectables commentary indicates that Lloyd's popularity may have been eclipsing Rambley's, and that ticks Rambley off. That's not the fault of the Lloyd(s) we're going to interact with, however. That's on Indigo's marketing for emphasizing Lloyd so much. And who knows, maybe there were plans for other retro-style plushies, but the Park got shut down before those could come out.
Either way, while Lloydford L. Lion may be a bit of an arrogant overdramatic actor, the AI Guide version of him isn't going to come across as deserving Rambley's vitriol, and that's going to be the cause of one chapter's main conflict.
27 notes
·
View notes
oh the absolute ECSTASY of finding something to do with your special interest when you weren't expecting to it's like woag! the world is full of good things and also my bones are made of CONFETTI FIREWORKS now! another win for autism!
27 notes
·
View notes
so was anyone gonna tell me that there’s a notion knockoff developed by the folks who made trello or was i just supposed to find out during one of my personal database tool deep dives?
4 notes
·
View notes
i don't even want to take half my classes that im registered for autumn quarter
6 notes
·
View notes
i've been thinking about this a lot recently and for like the last year since i've taken translation theory courses and gotten more proficient in my second language buuuuuut. only like 3% of published works in american/english first language book stores are translated from other languages. compare that to how quickly books published in english get translated into other languages. an author could be incredibly well known in their home country or to their audience of native language speakers, but they're still considered "nobodies" by the general english speaking population because of a lack of translations into english.
part of the problem i think is the cultural superiority english speakers feel in the world right now and how its trying to bury other cultures and languages because english is best. this then leads to nobody seeing a reason to translate works from other languages or only translating very few* because there isnt an audience for "foreign" literature. i dont think most of my classmates outside the spanish program have read many, if any works by non-english speaking authors and that really is a shame because it opens so many new viewpoints on the world and gives you a look into other cultures right in your own home!
*the exception here i think is anime/manga which has an incredibly dedicated fanbase creating fanlations for smaller series that havent gotten official english dubs/subs/translations. japanese literature still has a hard time on the market in america though
5 notes
·
View notes
Interesting to not be anti-valentines necessarily but still be in an Incredibly unfitting mood for being Up For Valentines day lmao
1 note
·
View note
I got a job at a Ukrainian museum.
On the first day someone asks me if I have any Ukrainian heritage. I say I had ancestors from Odesa, but they were Jewish, so they weren’t considered Ukrainian, and they wouldn’t have considered themselves Ukrainian. My job is every day I go through boxes of Ukrainian textiles and I write a physical description, take measurements, take photographs, and upload everything into the database. I look up “Jewish” in the database and there is no result.
Some objects have no context at all, some come with handwritten notes or related documents. I look at thick hand-spun, hand-woven linen heavy with embroidery. Embroidery they say can take a year or more. I think of someone dressed for a wedding in their best clothes they made with their own hands. Some shirts were donated with photographs of the original owners dressed in them, for a dance at the Ukrainian Labour Temple, in 1935. I handle the pieces carefully, looking at how they fit the men in the photos, and how they look almost a hundred years later packed in acid-free tissue. One of the men died a few years later, in the war. He was younger than I am now. The military archive has more photographs of him with his mother, his father, his fiancé. I take care in writing the catalogue entry, breathing in the history, getting tearful.
I imagine people dressed in their best shirts at Easter, going around town in their best shirts burning the houses of Jews, in their best shirts, killing Jews. A shirt with dense embroidery all over the sleeves and chest has a note that says it is from Husiatyn. I look it up and find that it was largely a Jewish town, and Ukrainians lived in the outskirts. There is a fortress synagogue from the Renaissance period, now abandoned.
When my partner Aaron visits I take him to an event at the museum where a man shows his collection of over fifty musical instruments from Ukraine, and he plays each one. Children are seated on the floor at the front. We’re standing in a corner, the room full of Ukrainians, very aware that we look like Jews, but not sure if anyone recognizes what that looks like anymore. Aaron gets emotional over a song played on the bandura.
A note with a dress says it came from the Buchach region. I find a story of Jewish life in Buchach in the early twentieth century, preparing to flee as the Nazis take over. I cry over this.
I’m cataloguing a set of commemorative ribbons that were placed on the grave of a Ukrainian Nationalist leader, Yevhen Konovalets, after he was assassinated. The ribbons were collected and stored by another Nationalist, Andriy Melnyk, who took over leadership after Konovalets’ death. The ribbons are painted or embroidered with messages honouring the dead politician. I start to recognize the word for “leader”, the Cyrillic letters which make up the name of the colonel, the letters “OYH” which stand for Organization of Ukrainian Nationalists (OUN in English). The OUN played a big part in the Lviv pogroms in 1941, I learn. The Wikipedia article has a black and white image of a woman in her underwear, running in terror from a man and a young boy carrying a stick of wood. The woman’s face is dark, her nose may be bleeding. Her underwear is torn, her breast exposed. I’m measuring, photographing, recording the stains and loose threads in the banners that honour men who would have done this to me.
Every day I can’t stop looking at my phone, looking up the news from Gaza, tapping through Instagram stories that show what the news won’t. Half my family won’t talk to the other half, after I share an article by a scholar of Holocaust and genocide studies, who says Israel is committing a genocide. My dad makes a comment that compares Gaza to the Warsaw Ghetto. This gets him in trouble. My aunt says I must have learned this antisemitism at university, but there is no excuse for my dad.
This morning I see images from Israeli attacks in the West Bank, where they are not at war. There are naked bodies on the dusty ground. I’m not sure if they are alive. This is what I think of when I see the image from the Lviv pogrom. If what it means for Jews to be safe from oppression is to become the oppressor, I don’t want safety. I don’t want to speak about Jews as if we are one People, because I have so little in common with those in green uniforms and tanks. I am called a self-hating Jew but I think I am a self-reflecting Jew.
I don’t know how to articulate how it feels to be handling objects which remind me of Jewish traumas I inherited only from history classes and books. Textiles hold evidence of the bodies that made them and used them. I measure the waist of a skirt and notice that it is the same as my waist size. I think of clothing and textiles that were looted from Jewish homes during pogroms. I think of clothing and textiles that were looted from Palestinian homes during the ongoing Nakba. Clothes hold the shape of the body that once dressed in them. Sometimes there are tears, mends, stains. I am rummaging through personal belongings in my nitrile gloves.
I am hands-on learning about the violence caused by Ukrainian Nationalism while more than nine thousand Palestinians have been killed by the State of Israel in three weeks, not to mention all those who have been killed in the last seventy-five years of occupation, in the name of the Jewish Nation, the Jewish People — me? If we (and I am hesitant to say “we”) learned anything from the centuries of being killed, it was how to kill. This should not have been the lesson learned. Zionism wants us to feel constantly like the victims, like we need to defend ourself, like violence is necessary, inevitable. I need community that believes in freedom for all, not just our own People. I need the half of my family who believes in this necessary “self-defence” to remember our history, and not just the one that ends happily ever after with the creation of the State of Israel. Genocide should not be this controversial. We should not be okay with this.
Tomorrow I will go to work and keep cataloguing banners that honour the leader of an organization which led pogroms. I will keep checking the news, crying into my phone, coordinating with organizers about our next actions, grappling with how we can be a tiny part in ending this genocide that the world won’t acknowledge, out of guilt over the ones it ignored long ago.
8K notes
·
View notes
filterable picrew database!
original post updated march 7 2024
hey pals!! i'm working on a filterable, tagged collection of picrew i like. right now there's over 100 picrew (and other such makers such as those from neka or meiker) in there with tags for things like fashion, hair options, skin colors, specific features like horns or headscarves, and body types. you can search for multiple tags at a time and filter out tags you don't want. the whole thing is organized in a big grid of sample results from the picrew in question, so you can see the style at a glance and click it for more images and the url, but you can change the view and organization system however you like.
the link is here!!! feel free to share this wherever. i'm still going through my folders and adding more makers, so expect lots of updates real soon.
i'm hoping this makes it easier for people to find picrew that suit them and their characters, especially in cases where it's unfortunately harder to find certain features like dark skin options and fat bodies.
really important notes:
i do not take requests for additional tags. sorry!! please understand that every time i want to use a new tag, i have to manually go into every maker in the entire backlog and check to see if they have it. it's a pain! it takes a while! there's only one of me! the only circumstance under which i'm willing to add a new tag is if you're willing to go through the backlog and link me every picrew that needs the tag, and i can use it going forward.
if something is tagged wrong, i need to know which maker it is so i can fix it. you need to tell me! the most useful way to send me a specific picrew is a direct link, or the artist name (which will be the title when you click into the item in the database). sometimes i get vague comments like "there are makers in x tag that don't fit" and no one EVER follows up with which ones they are so i can't FIX IT.
one big thing that you can do to help me with this database is take one of the links on my tba page and tell me what tags apply to it. literally just one! enough folks see and use this resource that just a few people taking one takes a load off my plate.
💖🍵 if this resource has been useful for you, consider sending me a tip on ko-fi!!
have fun!!!! i hope this is helpful for people!!!
18K notes
·
View notes
jstor appreciation post. i love you jstor.
1 note
·
View note
Im so frustrated today. My datemate and I got approved for an apartment but we had to give it up!! All because I have my name on my family's apartment lease. I'd have to remove myself if I want to lease at the other apartment complex, because its owned by the same place my family is living in. And the office manager said its a problem because it looks like I'm renting 2 apartments on my own. My fam doesn't qualify for an apartment without me, even tho they're fine with paying the bills (they'd have to reapply to stay and miss making three times the rent by only $350)
I can still rent from a place that isn't run by the same company, and keep my name on their lease. So its not hopeless. I'm just upset we had to give up the opportunity that was literally right in front of us. We would have been out by the end of May ;-;
1 note
·
View note
AHH SORRY I LEFT IT A WIP FOR SO LONG
but it's done!!! my character designs for @thewolveswolf's rival gym leader au!!
aziraphale's gym is a library, with steel shutters that automatically slide over all the shelves whenever a battle starts 😂 the library is managed by sinisteas and polteageists that float around to make sure everyone has what they need. his honedge refuses to go in its pokeball and he is CONSTANTLY losing it.
(his pokedex is also handwritten. his is much more meticulous than the official digital database)
crowley's gym is a greenhouse, probably very very dark because of all the huge ferns that envelope the place. his ghosts adore it in there, even in broad daylight.
aziraphale is probably in awe of the fact that crowley grows his own apricorns but do u think for a SECOND that crowley is just gonna hand them over to anybody? get ur own free pokeballs. (but he lets kids come in and pick them on the weekends and take home whatever they can harvest)
zita's teams:
crowley: gengar, spectrier, seviper, phantump, toxtricity, murkrow
aziraphale: chandelure, alcremie, rapidash (galarian), honedge, victini, dratini
2K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
How to Call Your Reps About Gaza
I make a lot of posts telling you to call your reps! Anyway, here's the overall shape of how to argue to them.
Disclaimer: I am not in politics. I do not have experience as a staffer. I am just someone who cares a lot about where things are going, and wants to help. Also, this is specific to the US, because that's where I'm based. Hopefully, people with expertise can add more suggestions on.
Find your elected officials.
My Ko-fi: this took me two days to write up, so uh. If you've got a few dollars, send them my way so I can keep doing this sort of thing, and maybe move out of my parents' house sooner.
General tips:
Be polite, or at least civil. Do not swear or shout at whoever answers the phone. This will quite possibly get your number blocked. Fifty civil calls over the course of several months will do more than one where you shout. You can be frosty, you can say you are disappointed, you can say you find the actions of your reps to be reprehensible or morally bankrupt, sure. But keep calm and aim criticism at the rep, not the staffer.
Keep it short. The staffers who answer call centers are busy. They usually start trying to hurry me off after about two minutes. I've yet to manage a call longer than four or five minutes. Pick one or two topics for the day, and focus on those. Cycle through them every time you call. Stick to just one from day to day if it's a large, ongoing issue like Gaza.
Plan for voicemail. I get voicemail more often than not. My House rep usually has a staffer free, but the Senators are almost always voicemail. This will give you a minute and a half max. Be ready to get your point squeezed into that.
Only call your representatives. The important, powerful word here is "constituent." You will be ignored or even counted against if you are from a different district or state. The first thing you start with is your name and address. A staffer will ask for the information they need. On voicemail, leave your full name, your city and state, and zip code before you go into your message. Do not lie, either. They look these things up in the system when you call. I'm not sure how--I think maybe they have access to a database of registered voters--but every time I call, they ask for my last name and address and at some point say, 'oh, yep, I've got you right here,' which indicates a database of some sort.
Research at least a little bit about their opinions. If they already agree with you, then it's much easier to leave a quick "I support you and want you to know that" to combat anyone who's arguing from the other side. If they don't, then you're best off finding out what specific issue they have so you can know the best kind of comment to leave.
Look up specific bills or arguments. I get daily emails from GovTrack about bills that are on this week's docket or have been voted on in the past day. IDK about anyone else, but being able to say that I disagree specifically with HR 815 or something makes me feel powerful, and possibly like I will be taken more seriously. Sometimes you can start with articles like this one, which include links to specific bills on the official congress website.
Email after if you can. Reportedly less effective, and takes longer, but you are more likely to get a written (canned) response, and it reinforces whatever you called about.
Basic structure of a call, at least as I've been doing it:
"Hi, my name is ____ ____, and I am a constituent from [city, state], [zip]. I am calling to express my opinion on [topic]. I am concerned about [short argument with a clear impact on the topic]. I ask that you support [measure or fellow congress member]/vote [yay/nay on specific legislature]. Thank you for your time, and I hope you keep my opinion in mind."
For this post, the topic can be stated as the war in Gaza, military funding for Israel, or unrest in the Middle East, depending on which you think your elected official will respond to best. That said, the structure should work for whatever your call is about.
Arguments to use against your elected official... or your on-the-fence cousin:
I'll be honest, some of these are not going to do much against your representative. They know the arguments, and have been going over them with each other for months. You just need to have one locked and loaded that they consider relevant instead of a nonstarter, in order to back up your opinion as 'founded' instead of 'nonsense, can be swayed with a good marketing campaign.'
I'll include explanations if I don't think something is self-evident (or needs more evidence to tell your cousin), but in most of them I'll provide some suggested verbiage that you can tweak as needed, and for a few of them, that's really enough.
THESE ARE FOR THE TOPIC OF CONCERN, ONLY. You still need to end each one with "I ask that the [official] votes to [action]" at the end. Give them something actionable (example from Feb. 13th). My go-tos right now:
Both chambers: Reinstate funding for UNRWA
Both chambers: Place mandatory restrictions on any aid to Israel, with contractual threats to cut funding if Netanyahu and his government continue to disregard civilian life
Senate: Put support behind Bernie Sanders and his motion to restrict funding to Israel until a humanitarian review of the IDF’s actions in Gaza has been completed (S.R. 504) (Tabled by the Senate on 1/16, but it is being brought back in as conditions continue to escalate)
House: Put support behind Rep. Rashida Tlaib’s petition for the US government to recognize the IDF’s actions in Gaza as ethnic cleansing and forced displacement, and put a stop to it.
House: Put support behind H.R. 786, introduced by Rep. Cori Bush, calling for an immediate deescalation and cease-fire in Israel and occupied Palestine.
What Not to Say
"There is no threat to Israel." I've talked about this elsewhere, but the short version is that this will be basically laughed out as you not knowing what you're talking about.
Anything generically antisemitic. (I mean, it might work on some of the white supremacists, but do you really want to encourage that thinking? No, so don't do it.)
Facts that you "heard somewhere" but cannot find a reliable source for. If it's being reported by the New York Times, NPR, or the BBC, it's probably trustworthy by government standards. If it's not a super common statistic, cite the journal you got it from by name. Remember, you aren't arguing to tumblr mutuals. You are arguing to your elected official or your 'I don't really pay attention' cousin. When it comes to this, big name news sources are better.
Unrealistic demands for complete isolationism, permanently abandoning Israel to its own devices, supporting Hamas, etc. Again, you will not be taken seriously. Pick an argument they might actually listen to, and use it to press them towards a possible solution. You want them to believe that if they adjust their position, they will be doing the will of most of their constituents, and thus more likely to get reelected.
The Ethics Argument
Third-party reporting has stated that that nearly 29,000 Gazans are dead since Oct. 7th, as of 2/18/24. The vast majority of those are civilians, and over half are children. Palestinians in Gaza are facing an acute hunger crisis threatening to become a full-blown famine.
The International Court of Justice has found that there is credible reason to believe that the state of Israel is committing a genocide against the Palestinians of Gaza.
This does not mean that every single Israeli is complicit. It does mean that the government, particularly Netanyahu and his associates, has been reprimanded by a large, diverse coalition of countries, and has consistently refused to listen to that court since.
This argument will possibly work on your cousin. Less likely to work on your elected official. They already know the numbers. I just wanted to get it out of the way first.
The Re-Election Argument: Michigan vs New York
Meanwhile, this is possibly the most effective. Again, this is not an argument of ethics. This is an argument of "how can I make my elected official do what I want." We do not use only the purest moral argument. We use what works.
What to say to your elected official: Michigan, as a swing state, was won by democrats on the power of the Arab-American vote in the 2020 election. We (either party) are at risk of losing Michigan due to the current Congressional approach to the Gaza conflict, as that demographic is now polling as likely to abstain from voting entirely. The risk of losing several congressional districts due to the Jewish vote is a real one, but the risk of losing the the executive branch is greater, especially after what we saw with Suozzi. Supporting Palestine might lose us parts of New York, but supporting Israel will lose us Michigan.
Explanation: Something that has been taking up a lot of time and space in the election coverage is the situation in Michigan, and more recently, there has been attention paid to the special election of New York's third district, AKA the "who gets to replace disgraced George Santos" competition.
Michigan is traditionally a swing state. While 2.1% doesn't sound like a lot, that is some 211k-278k people (depending on your source), and while not all of them can vote... Michigan was won by about 154k. Arab-Americans are not the only relevant demographic, but they sure are an important one, and they are vocally opposed to the situation. Approval has dropped from 59% to 17%. From that same article:
As Axios notes, Biden won Michigan in 2020 by 154,000 votes, but there are at least 278,000 Arab Americans in Michigan. Biden took Arizona, a state with an Arab American population of 60,000, by only 10,500 votes. In Georgia, Biden prevailed with a margin of 11,800 voters, in a state that has an Arab American population of 57,000.
Democrats cannot afford to lose these states. Pressure your congresspeople about that, especially if you live in one of those states. I assume most Arab-Americans in said states are already calling every day; the rest of you can join in.
Meanwhile, most Jews (considered the most pro-Israel demographic by strategists) in America are concentrated in a very small number of electoral districts. Of the twenty most-Jewish, ten are in New York, which is why I put it up in the section header.
One of those districts was won by a Republican in 2022: George Santos, New York's third congressional district. Following his scandals and ousting, the seat was up for a special election, and the two candidates were Tom Suozzi, a democrat who held the seat previously (he decided to run for governor, and lost), and Mazi Pilip, a Nassau county legislator who was of Ethiopian Jewish background and had been in the IDF. She ran on a campaign that leaned strongly pro-Israel and anti-immigration, and when Suozzi won, she interrupted his victory speech to accuse him of supporting a genocide against Israel due to his rather centrist, rather milquetoast stance on the conflict during his election campaign.
Now, Suozzi's win probably had more to do with Pilip being anti-choice than her pro-Israel arguments, but he still won.
Democrats can better risk possibly losing a few seats in NY than definitely losing three swing states.
"But I don't want Dems to win their districts after what they've been--" Nope. Listen to me. Surveys indicate that Republicans are on average more pro-Israel, because Trump and Netanyahu are buddy-buddy, and we do not have a viable third option.
Also, again, this is about convincing Dems to be better. "If you do not vote to put restrictions on funding to Israel, I will not vote for you in November" is a lot more powerful than "I will not vote for you either way, because of what you've been doing, but you should do what I say anyway."
The Re-Election Argument: Risk of Escalation
So, that thing I said about Trump and Netanyahu?
Yeah, so, while Biden is giving Israel military aid while cautioning them to slow down and be careful, Trump is... complicated, but suffice to say he's much closer to Netanyahu on a personal level than Biden is. Biden's relation with Netanyahu is reportedly pretty frosty, while Trump's is based on relations through the Kushners.
Just from wikipedia:
Netanyahu made his closeness to Donald Trump, a personal friend since the 1980s, central to his political appeal in Israel from 2016.[21] During Trump's presidency, the United States recognized Jerusalem as the capital of Israel, recognized Israeli sovereignty over the Golan Heights, and brokered the Abraham Accords, a series of normalization agreements between Israel and various Arab states.
Trump's been more all-over-the-place recently, badmouthing Netanyahu for being what Trump perceives as a loser, which complicates understanding what his approach is. It's kind of incoherent right now.
Given Trump's general history of being pro-Israel, though, and the attempts by House Republicans to push through a bill of unconditional funding for Israel. It failed, but notable is that the more recent bill passed in part because it was paired with aid for Ukraine and Taiwan (something Dems are much more invested in having happen).
What to say to your elected official: If Trump is reelected due to his current appearance of being more critical of Netanyahu, there is evidence from his presidency to indicate that he will support Israel much less critically if elected. While he claims to want to settle the Middle East, it seems incredibly likely that he will worsen the situation for Palestinians, and ramp up retaliatory strikes to groups like the Houthis in a manner that will impact non-military parties, igniting tensions that are already tenuous.
The Disrespect/Wild Card Argument
This particular argument is best used against the Very Patriotic Politicians who are more concerned with the US's image and Being The Alpha Nation than with other things. Basically, this might work on Republicans.
This isn't really something I believe in, as a matter of foreign policy, buuuut it might work on your rep, so. Consider it!
What to say to your elected official: With Israel's recent actions in ignoring Biden, blocking US-sent aid like those flour trucks that got stopped at the Rafah border because they'd be distributed by UNWA, and generally Disrespecting The USA and Being Unpredictable is not only making the US look bad for being unable to wrangle a smaller country, but also making it so we are less able to wrangle other countries in the future, because Israel cannot be predicted and might set someone off.
The Europe and Reputation Argument
What to say to your elected official: The United States is losing credibility as a world power known for its military and ability to manage international disputes on behalf of the UN, because it is seemingly unable to influence Israel, and losing credibility as an upstanding moral state that is not doing foreign coups and banana republics anymore, as it appears to be tacitly supporting Israel's ICJ-labelled genocide, which is a really bad look with the other Western Powers.
I'm not entirely sure who this might work on, but there's gotta be at least a few politicians who are really concerned about America's image, more than about actually doing the right thing. Figure out if your politician is one of them.
If necessary, you can bring up how Trump is threatening to pull US support for NATO if Russia attacks someone.
The Middle East Stability Argument: Iran-backed Militias
What to say to your elected official: I'm concerned that the continued support of Israel, and thus the funding of their actions in Gaza, will increase the instability of Iran-backed militias, as we have already seen with the Houthis and Hezbollah. Entire Muslim-majority nations are showing increased displeasure not only with Israel, but with the US by extension. We cannot afford another war in the Middle East when we haven't yet pulled all our troops from the last one, not with the recent and recurring economic recessions. Any situation would also very likely be complicated or inflamed by the growing tensions among Eritrea, Djibouti, and Ethiopia regarding Red Sea access as well.
Use this on the ones that claim to be pro-military or pro-veteran. See what they said about HR 815 before the foreign military funding amendment was added.
The Middle East Stability Argument: Egypt
What to say to your elected official: Egypt's government has been unstable since the Arab Spring, and even now the military government is incredibly unpopular. With that existing instability, the addition of economic strain from the reduced usage of the Suez canal, the international disputes occurring because they're the main throughway for aid into Gaza, and the threat of a sudden influx of nearly one and a half million Palestinian refugees should Israel continue to push south... Egypt is looking at a possible near-collapse as we've seen in nearby nations suffering similar instabilities.
Explanation: It took several years for Egypt to really start recovering from the revolts in 2013, and it has applied for four IMF loans in recent years. The current government is unpopular to such a degree that they are looking to build an entire new capital from scratch in the middle of the desert so that they're less open to the risk of civilian uprisings; one of the primary causes for civilian dissatisfaction is economic issues.
Due to Houthi attacks at the Bab al-Mandab Strait, traffic through the Suez canal is down massively, and since the canal "represents almost 5% of the GNP and 10% of GDP and is one of Egypt’s most important sources of hard currency." (src) Various sources are reporting that trade through the canal is down 40-50%, which is putting more strain on the already unstable economic and political situation.
Finally, Egypt's population is about 110 million, but the governorate that shares a border with Israel and Gaza, North Sinai, has a population of barely 500,000. A push of one and a half million starving, injured people will, very suddenly, nearly quadruple the population of the governorate, and require extreme aid response from Egypt's government to keep alive and prevent a larger crisis in North Sinai and neighboring governorates.
The Middle East Stability Argument: Normalized Relations
What to say to your elected official: I am concerned that Israel's continued attack on Gaza is jeopardizing any chance of normalized relations with the Arab states in the future. American has put a lot of work into trying to get these various countries to normalize with Israel, and our funding of the current attacks on Gaza are sabotaging all that effort.
This one can be combined with the Iran-Backed Militias argument: Israel, in pursuit of revenge against Hamas, is setting itself up to be in more danger long-term, rather than less.
The International Trade Argument
What to say to your elected official: I am concerned about how the war in Gaza is impacting international trade and shipping costs. With the Suez Canal down to half its usual capacity and the Panama Canal raising costs and dropping capacity in response to the water restrictions, along with rising fuel costs in Europe and Asia, global trade is incredibly strained. We are being relegated to the Cape of Good Hope, Cape Horn, and the Malacca strait for much of intercontinental trade, and the macroeconomic projections are looking very bad for America.
The Domestic Economics Argument
What to say to your elected official: Many of the plans for Israeli military funding cause damage to other parts of the budget. For instance, a recent plan put forward by the Republicans of the House suggested IRS cuts in order to move that money, a plan which would impact the US budget negatively in the long term; we need those 14 billion being spent domestically, not supporting an overreaction/possible genocide in Gaza.
Explanation: In general, pick something receiving budget cuts that your congressperson will care about. I care about IRS funding, and saw it mentioned as a target in an article, so that's what I've got in my suggested verbiage up there.
The fewer people that are working for the IRS, the more they focus on auditing poor people (simple, easy taxes) and the less they can effectively audit rich people (complicated, time-consuming taxes), which means rich people are more likely to get away with evading millions or even billions in taxation. So yeah, you want more funding in the IRS if you are poor. They are already auditing you. You want them to audit the big guys.
The Russia and China Argument
What to say to your elected official: I am worried that the current focus on funding Israel without restriction is causing us to lose sight of the international threat posed by Russia and China. Russia is actively invading Ukraine, which continues to put massive strain on the European economy with regards to oil prices, especially with the Suez situation, and China has been testing missiles near Taiwan, and thus testing US responsiveness to those threats, for months now. We cannot afford to support an internationally unpopular war if we want to remain ready for Russia and China.
This is less likely to work on Republicans, since Trump is friendly with Russia, but hey, give it a shot if they're one of the ones who aren't fully in his camp.
EDIT 2/22/24: I'm a bit unsure of this tactic, but I'm putting it out there with hopes that someone with more political experience can offer feedback:
"Congress, and the US government in general, has promised to sanction Russia for the alleged assassination of one man within a week of the suspicious death, after five months of refusing to enact even slight consequences on Israel for the deaths of nearly thirty thousand, half of which are children. This is ethically questionable at best, but for the interests of elected officials, it is a very bad look. The mismatch shows a massive bias by the American government in regards to Israel's ongoing mass murder, with over two million facing famine as a result of Israel's aid blocking, and America's reputation on the world stage, as well as individual politicians' reputations domestically with constituents, is plummeting."
-------------------------------------
Finally, my ko-fi again. I spent a long time on this and I'd like to move out of my parents' house sooner rather than later. If you appreciate my time and effort, please feel free to donate a couple bucks.
562 notes
·
View notes
Ferrari's Fairytale (1/3)
Summary: World Championships are the most important part of any Formula One team's history. Except perhaps, Ferrari's. Known for their rabid fans, filthy-rich investors, and pretty boy drivers it shouldn't be a surprise that the team has brought together Soulmates from across the globe. And fate, it seems, is working awfully hard to put all the pieces into place for Ferrari's perfect fairytale - one that's been in the works for decades now.
[Part 1 of Pretty Girls and Ferrari Boys]
Soulmate AU: Soulmates share injuries and pain.
Pairing: Charles Leclerc x Reader (Eventual)
Word Count: 1650
Warnings: Swearing, no Charles in this first part sorry it's his epic love story and those take time ;)
Masterlist
There was something wrong with your soulmate.
Really there had been something wrong with them since you were eight years old. But right now, there was something particularly wrong with them.
“Just some bruising over the ribcage, but no actual damage internally.” The medic presses a latex covered hand gently against your ribs.
“They feel broken.” You suck in a pained breath and glare over her shoulder, at the little framed picture of her cat, Terror, on her desk. “You’re sure I’m not about to sneeze and puncture a lung?”
“Funny.” Though the look she gives you as she pulls off her gloves is less than amused. “Which one of us went to medical school again?”
“My best friend. You might know her. She’s stunning, generous, gives me free check-ups, did I say stunning? Goes by Sunny.”
“It’s Doctor Sunny to you.” She slingshots one of the gloves at you. “But it’s good to know you only keep me around for the free check-ups.”
“My soulmate would bankrupt me without you.”
Sunny taps at her computer, “The fee isn’t that high.”
“Sure,” You shrug. “If you aren’t in here every other week.”
“Have we ruled out hitman as their profession?”
“Since we were eight?”
“I don’t know much about hitmen, maybe they start them young.”
You lower yourself carefully from the observation table and move stiffly toward her desk. “Give it to me straight Doc. How much longer have I got?”
“I’m afraid you’ll live, ma’am.” Sunny doesn’t even look up. “A tragedy for all, I know. I can give you a moment if you need time to process– Ow! Bitch.”
She rubs at her shoulder and huffs.
“I’m going to have to log that in the database, you know.” She says.
“Good, maybe we can both find our soulmates and be done with it all.”
“Real romantic, dude.”
“Your soulmate hasn’t been terrorising you since you were a kid.”
“I had my fair share of scraped knees,” Sunny wrinkles her nose when you stick your tongue out. “You do know it won’t stop after the two of you meet, right? That’s a schoolyard myth.”
“After the talking to I’m going to give him, you bet your perky ass it’s going to stop.”
“That’s the second instance of workplace harassment I’ve coped from you in the last minute.”
“Fine. Your ass is not perky.”
“Mature.” She hums, “What time did you say the pain started?”
“Ten-thirty-ish?”
“All good then.” Sunny makes a few more clicks before powering down her computer. “Your chest and my arm, all nice and logged.”
“You know, sometimes I think you became a Match Medic specifically so you could put every little thing into the database to make it easier to find your soulmate.”
“Perks of the job.” She scoops up her handbag. “Come on, let’s bounce before the front desk starts scheduling over my lunch break.”
“You remember how I said you were stunning and generous and stunning?”
“I’m not buying you lunch.”
“Could this week get any worse?” You throw your head back dramatically.
Sunny cracks a smile at your antics, “Only a few more hours and we’re free for the weekend.”
“Are we still on for pamper-night tonight?”
“Always. Mine or yours?”
You end up spending the night in Sunny’s apartment, covered in different rejuvenating oils and masks until you look like low-budget horror movie villains. In your fluffy robes with The Princess Bride on in the background Sunny tries to teach you how to make Hainanese Chicken the way her mother did. Terror cries at your feet when you tell him he can’t have raw chicken. Sunny pops a bottle of cheap champagne that makes you both grimace and promise one another that you would find an excuse to get a nicer bottle soon. You take turns washing the excess from the face, foot, and hair masks off. Then curl up together on the couch, sipping broth, digging into rice and slathering chicken in Sunny’s family’s super-secret chilli sauce. You both fall asleep at a very respectable eleven o’clock.
So, it’s fucking strange when you wake up feeling like you had spent the night inside a paint mixer.
“Are you okay?” Sunny frowns as she stands over a pan of eggs. “You look ill.”
You squint over your coffee cup, “Soulmate is playing up.”
She plates the eggs next to a small stack of bacon before turning to put a hand to your forehead. “They shouldn’t be making you feel sick, illness doesn’t transfer like that. Are you sure it’s coming from them? Could you just be hung over?”
“It’s definitely him, third weekend in a row, like clockwork.” You take your plate gratefully, “It’s like I always tell you. It’s not nausea. It’s more like…”
“Impossible to explain for you and every medical practitioner you’ve ever seen?”
You groan, “It’s like my brain spent the night trying to escape my skull and the muscles in my neck were in on it.”
“It’s not unheard of for soulmates to feel the repercussions of an intense work out. There was this study from four years ago on high performance athletes and their partners that–”
You groan again, “Oh god and now there’s a nerd in my ear!”
She tosses a gelatinous bit of egg onto your plate. It lands with a splat that makes you fake gag. “Oh, grow up.”
“You should be nice to me,” You lament, “I’m wounded!”
“Your soulmate is wounded.”
“And I’m sure their best friend is taking very good care of them!”
She pulls a face at you but still takes your plate to the dishwasher for you. As she’s rinsing them, she asks, “What’s on for the rest of your weekend?”
“I got a call from my parents on Thursday and guess what?” You sipped at the cold dregs of your coffee, “The dentist finally figured out which one of them the toothache is coming from!”
“That’s great,” Sunny’s smile was genuine. “They’re going in to get it fixed?”
“Tomorrow morning, both going under local anaesthesia.”
You hip checked her lightly out of the way to rinse both your cups. “You want another coffee?”
Sunny propped herself up on the counter, “My caffeine addiction is rubbing off on you I fear.”
“Listen, we have to get through the day somehow.” You coaxed the machine back to life before leaning against the counter to look at Sunny. “Anyway, my parents were supposed to go to this race tomorrow. Dad is particularly devastated and has practically ordered me to represent the family ‘at our home race.’ It’s been tradition for him and mum since they got married. It’s kind of a big deal for him. The man is obsessive.”
“My parents had something similar to say about our family legacy and studying medicine.”
“Speaking of… You remember all the times I sat up with you studying, or brought you food when you forgot to eat, or ran errands for you, or made sure you took breaks, or–”
“Fine, I get it, I’ll go to the stupid race.”
“Oh, how kind of you to offer.” You passed her one of the cups. “It won’t be that bad. Motorsports are supposed to be fun live, right?”
Sunny snorted, “Thank God. Motorsports? I thought you meant like a horse race or a marathon. I was getting war-flashbacks to track-and-field.”
You put a hand to your heart, “You were willing to relive cross country for me?”
“I was willing to ogle fit, sweaty men for you, definitely.”
“Alright, first of all – fuck you. But also same,” You clinked mugs and nodded solemnly at one another, “Maybe we can find some fit, sweaty drivers to ogle instead.”
Sunny hummed, “What do I wear? Is it like sprint cars or more like V8s – ooh is it an illegal drag race?”
“Girl, no.” You swatted at her thigh, “It’s Formula 1, which is perfectly legal and safe and much faster than any of those options.”
“Alright, Miss Daddy’s-Girl, go off.”
“Shut up, I’ve had to hear him go on and on about it my whole life.” You pulled a face at your coffee. “The man has had a hard-on for Ferrari since before he met my mother, and then he met her in the Ferrari hospitality at an F1 race, and he’s fucking worshipped them ever since.”
“Oh my god, why am I only just hearing about this?” She grabbed your face, squishing your cheeks and cooing. “You’re a little Ferrari baby.”
You blew a rather unladylike raspberry at her and knocked her hand away, “Because it’s embarrassing! Dad was only there because he and his friend won tickets. So, when Ferrari marketing caught wind that soulmates had met in their pavilion, they practically fell over themselves.”
“Holy shit!” Sunny practically howled in delight, “Is that where all those baby pictures of you in little Ferrari onesies came from?”
“Ferrari’s own little fairytale, Mr-won-his-way-in and Miss-heir-to-a-real-estate-monopoly. It's like Romeo and Juliet; if Romeo and Juliet survived, had a kid and decided to make it the poster child of their love story.”
“Don’t sound so disgusted, that’s cute as fuck.” Sunny snatches up your empty cup and stacks it next to hers in the dishwasher.
You frown, “Not everything has to be a love story.”
“I don’t know, girl, I’m pretty sure you just asked me to play out your parents first meeting with you tomorrow.” She winks at you over her shoulder as she heads toward her room.
“Oh, fuck off, Sunny.”
“I think this calls for new outfits!” She emerges from her room, towel over one shoulder. “What was your Mum wearing when she met your dad?”
“We are not reenacting my parents meet-cute.”
“Who knows, maybe you’ll have your own meet-cute with a certain pain-prone soulmate, hm?” In the moment it takes you to reorientate yourself after her comment, she’s breezing past you with a bright, “I’m having first shower!”
You squark in indignation. Like hell, you’ll let either of those things happen to you this weekend.
(Part 2 : Ferrari's Prince - 03.05.24)
292 notes
·
View notes
Screenshots under the cut
A total rework of my original satyr legs with a higher quality mesh and a focus on maximum flexibility. I used the Wicked Whims body selector as a framework to create them, and they require it for full functionality, but can still be applied in CAS as pants and shoes. Wicked Whims allows for sims to retain their digitigrade legs while bathing/otherwise undressed and just generally makes things easier, but this version of the legs is completely SFW even when fully nude, it's just a ken doll mesh.
The legs and feet are separate body parts that each have to be equipped or enabled in the body selector (or equipped in CAS for those not using WW). Current foot options include cloven hooves, and canine paws. Both are textured and will have proper shading if used with a skin alone, but for fur and hooves/pawpads they need to have their respective overlays applied in CAS (they will color match with hair by default like any body hair).
While they're available for all gender/genital configurations, I highly recommend setting any sim using the SFW legs to not have a penis, as getting an erection will break their legs. Alternatively, you can use the NSFW version of the legs to avoid that problem.
Because they share a mesh with my werewolves, these are completely compatible with all digitigrade clothing edits.
TOU:
As with Digitigrade Werewolves, everyone has blanket permission to use the digitigrade leg mesh as a base to make their cc clothing compatible with them.
Please tag or message me if you do make a set of digitigrade-compatible cc clothes, I'd like to make a database so people can find them easily (also I will be very excited about it).
DO NOT alter the leg mesh itself in other ways
DO NOT re-upload the original leg mesh; if you make cc that requires it just link back.
Feel free to make your own paws or hooves or whatever else, but please DO NOT upload the leg mesh with them.
Download:
SimFileShare | Patreon
1K notes
·
View notes
Linkrot
For the rest of May, my bestselling solarpunk utopian novel THE LOST CAUSE (2023) is available as a $2.99, DRM-free ebook!
Here's an underrated cognitive virtue: "object permanence" – that is, remembering how you perceived something previously. As Riley Quinn often reminds us, the left is the ideology of object permanence – to be a leftist is to hate and mistrust the CIA even when they're tormenting Trump for a brief instant, or to remember that it was once possible for a working person to support their family with their wages:
https://pluralistic.net/2023/10/27/six-sells/#youre-holding-it-wrong
The thing is, object permanence is hard. Life comes at you quickly. It's very hard to remember facts, and the order in which those facts arrived – it's even harder to remember how you felt about those facts in the moment.
This is where blogging comes in – for me, at least. Back in 1997, Scott Edelman – editor of Science Fiction Age – asked me to take over the back page of the magazine by writing up ten links of interest for the nascent web. I wrote that column until the spring of 2000, then, in early 2001, Mark Frauenfelder asked me to guest-edit Boing Boing, whereupon the tempo of my web-logging went daily. I kept that up on Boing Boing for more than 19 years, writing about 54,000 posts. In February, 2020, I started Pluralistic.net, my solo project, a kind of blog/newsletter, and in the four-plus years since, I've written about 1,200 editions containing between one and twelve posts each.
This gigantic corpus of everything I ever considered to be noteworthy is immensely valuable to me. The act of taking notes in public is a powerful discipline: rather than jotting cryptic notes to myself in a commonplace book, I publish those notes for strangers. This imposes a rigor on the note-taking that makes those notes far more useful to me in years to come.
Better still: public note-taking is powerfully mnemonic. The things I've taken notes on form a kind of supersaturated solution of story ideas, essay ideas, speech ideas, and more, and periodically two or more of these fragments will glom together, nucleate, and a fully-formed work will crystallize out of the solution.
Then, the fact that all these fragments are also database entries – contained in the back-end of a WordPress installation that I can run complex queries on – comes into play, letting me swiftly and reliably confirm my memories of these long-gone phenomena. Inevitably, these queries turn up material that I've totally forgotten, and these make the result even richer, like adding homemade stock to a stew to bring out a rich and complicated flavor. Better still, many of these posts have been annotated by readers with supplemental materials or vigorous objections.
I call this all "The Memex Method" and it lets me write a lot (I wrote nine books during lockdown, as I used work to distract me from anxiety – something I stumbled into through a lifetime of chronic pain management):
https://pluralistic.net/2021/05/09/the-memex-method/
Back in 2013, I started a new daily Boing Boing feature: "This Day In Blogging History," wherein I would look at the archive of posts for that day one, five and ten years previously:
https://boingboing.net/2013/06/24/this-day-in-blogging-history.html
With Pluralistic, I turned this into a daily newsletter feature, now stretching back to twenty, fifteen, ten, five and one year ago. Here's today's:
https://pluralistic.net/2024/05/21/noway-back-machine/#retro
This is a tremendous adjunct to the Memex Method. It's a structured way to review everything I've ever thought about, in five-year increments, every single day. I liken this to working dough, where there's stuff at the edges getting dried out and crumbly, and so your fold it all back into the middle. All these old fragments naturally slip out of your thoughts and understanding, but you can revive their centrality by briefly paying attention to them for a few minutes every day.
This structured daily review is a wonderful way to maintain object permanence, reviewing your attitudes and beliefs over time. It's also a way to understand the long-forgotten origins of issues that are central to you today. Yesterday, I was reminded that I started thinking about automotive Right to Repair 15 years ago:
https://www.eff.org/deeplinks/2009/05/right-repair-law-pro
Given that we're still fighting over this, that's some important perspective, a reminder of the likely timescales involved in more recent issues where I feel like little progress is being made.
Remember when we all got pissed off because the mustache-twirling evil CEO of Warners, David Zaslav, was shredding highly anticipated TV shows and movies prior to their release to get a tax-credit? Turns out that we started getting angry about this stuff twenty years ago, when Michael Eisner did it to Michael Moore's "Fahrenheit 911":
https://www.nytimes.com/2004/05/05/us/disney-is-blocking-distribution-of-film-that-criticizes-bush.html
It's not just object permanence: this daily spelunk through my old records is also a way to continuously and methodically sound the web for linkrot: when old links go bad. Over the past five years, I've noticed a very sharp increase in linkrot, and even worse, in the odious practice of spammers taking over my dead friends' former blogs and turning them into AI spam-farms:
https://www.wired.com/story/confessions-of-an-ai-clickbait-kingpin/
The good people at the Pew Research Center have just released a careful, quantitative study of linkrot that confirms – and exceeds – my worst suspicions about the decay of the web:
https://www.pewresearch.org/data-labs/2024/05/17/when-online-content-disappears/
The headline finding from "When Online Content Disappears" is that 38% of the web of 2013 is gone today. Wikipedia references are especially hard-hit, with 23% of news links missing and 21% of government websites gone. The majority of Wikipedia entries have at least one broken link in their reference sections. Twitter is another industrial-scale oubliette: a fifth of English tweets disappear within a matter of months; for Turkish and Arabic tweets, it's 40%.
Thankfully, someone has plugged the web's memory-hole. Since 2001, the Internet Archive's Wayback Machine has allowed web users to see captures of web-pages, tracking their changes over time. I was at the Wayback Machine's launch party, and right away, I could see its value. Today, I make extensive use of Wayback Machine captures for my "This Day In History" posts, and when I find dead links on the web.
The Wayback Machine went public in 2001, but Archive founder Brewster Kahle started scraping the web in 1996. Today's post graphic – a modified Yahoo homepage from October 17, 1996 – is the oldest Yahoo capture on the Wayback Machine:
https://web.archive.org/web/19960501000000*/yahoo.com
Remember that the next time someone tells you that we must stamp out web-scraping for one reason or another. There are plenty of ugly ways to use scraping (looking at you, Clearview AI) that we should ban, but scraping itself is very good:
https://pluralistic.net/2023/09/17/how-to-think-about-scraping/
And so is the Internet Archive, which makes the legal threats it faces today all the more frightening. Lawsuits brought by the Big Five publishers and Big Three labels will, if successful, snuff out the Internet Archive altogether, and with it, the Wayback Machine – the only record we have of our ephemeral internet:
https://blog.archive.org/2024/04/19/internet-archive-stands-firm-on-library-digital-rights-in-final-brief-of-hachette-v-internet-archive-lawsuit/
Libraries burn. The Internet Archive may seem like a sturdy and eternal repository for our collective object permanence about the internet, but it is very fragile, and could disappear like that.
If you'd like an essay-formatted version of this post to read or share, here's a link to it on pluralistic.net, my surveillance-free, ad-free, tracker-free blog:
https://pluralistic.net/2024/05/21/noway-back-machine/#pew-pew-pew
264 notes
·
View notes